Search

To evaluate the antibiotic resistance pattern, clinical profile and predictors for adverse outcomes in children hospitalized due to staphylococcal infection; and the frequency of nasal and axillary carrier states in these children.This descriptive study enrolled 100 symptomatic children (aged 1 month - 12 years) in whom S. aureus was isolated from cultures of blood, pus or cerebrospinal fluid. All samples were processed as per the Clinical and Laboratory Standards Institute (CLSI) standards. Antimicrobial susceptibility was tested using disc diffusion method; minimum inhibitory concentration (MIC) for vancomycin was measured using E strips. Predictors for poor recovery were determined by univariate and multivariable logistic regression analysis.Skin and soft tissue infections were the most common (47%) followed by respiratory infections (37%). Methicillin-resistant staphylococcus aureus (MRSA) was detected in 62%, out of which 63% (39/62) were multi-drug resistant. Carrier state was present in 49% (93% MRSA); 80% were axillary carriers. High MIC (1 µg/mL) for vancomycin was seen in 65% of patients, and was the only factor associated with poor recovery [aOR (95%CI) 5.3 (1.6-18.5); P=0.008] on multivariable logistic regression analysis.MRSA is the predominant staphylococcal strain in severe staphylococcal infections requiring hospitalization, and majority of them are multidrug resistant. High MIC to vancomycin among S. aureus is an emerging concern.

Considering the significance of Chrysomya megacephala (F.) (Diptera: Calliphoridae) and their larval instars in forensic-entomological investigations, a culture of C. megacephala was established and morphological features of second and third larval instars were studied under a compound microscope. To validate the species’ morphological identification, sequencing of the ‘standard barcode region’ (658 base pairs of mitochondrial cytochrome oxidase subunit I gene) was performed and this sequence was subjected to BLAST analysis using the NCBI database which acknowledged it as Chrysomya megacephala with 99.39% identity with sequence of same species collected from Maharashtra, India. The phylogenetic analysis congregated Jaipur population separately than other samples from different regions of India, however, not much variations were recorded. This is the maiden report of molecular identification of C. megacephala from Rajasthan.

Feature selection is a technique of lowering computation and data collecting costs and rejecting the less significant or redundant factors/variable which in turn may also increase the efficiency of machine learning algorithms. One of the often-used method of feature selection for categorical data is Chi-Square method which is based on certain assumptions. Defilement of assumptions has an impact on the computed p-values which are surrogate to importance of the features. The main purpose of this study is to identify the impact of pre-processing of data keeping in view the assumptions of Chi-Square on raking of features. A secondary objective is to see how in-built sub-routines of computer languages such as Python or R are incorporating the assumptions of Chi-Square. Based on empirical evidence it was found that it is essential to pre-process the data to fulfill the assumptions of chi-square before subjecting it to analysis using either R or Python, or any other application available on web or otherwise.

Schiff's bases are one of the important classes of the ligands, which are obtained by the condensation of amine and aromatic aldehyde. The metal complexes of Schiff's bases are widely considered because they show excellent biological activities. Such as antimicrobial, antitumor, antibacterial, and anti-fungal properties. The present studies deal with synthesis and characterization of Schiff's base transition metal complexes synthesized from general formula (ML) M=Co(II) and Cu(II); L = Schiff's base ligand derived from hydroxy trizene and aromatic aldehyde. The Synthesized complexes were characterized by physical and spectral analysis such as FTIR, 1HNMR, and XRD. They were also tested in vitro biological activities. The Schiff base behaves as a bidentate ligand with O and N donors and binds to metal ions via hydroxy group oxygen and azomethane nitrogen. The Schiff's base ligands and Metal complexes' structure was confirmed by modern instrumental techniques viz, FTIR and 1HNMR. The in-vitro antibacterial studies were carried out against S. aureus, E. coli, and P. Aeruginosa and anti-fungal activities C.albicans, A. clavatus. The result shows that the complexes have excellent biological activities.

Vigna is a large, pan-tropic and highly variable group of the legumes family which is known for its > 10 cultivated species having significant commercial value for their nutritious grains and multifarious uses. The wild vignas are considered a reservoir of numerous useful traits which can be deployed for introgression of resistance to biotic and abiotic stresses, seed quality and enhanced survival capability in extreme environments. Nonetheless, for their effective utilization through introgression breeding information on their genetic diversity, population structure and crossability is imperative. Keeping this in view, the present experiment was undertaken with 119 accessions including 99 wild Vigna accessions belonging to 19 species and 18 cultivated genotypes of Vigna and 2 of Phaseolus. Total 102 polymorphic SSRs were deployed to characterize the material at molecular level which produced 1758 alleles. The genotypes were grouped into four major clusters which were further sub-divided in nine sub-clusters. Interestingly, all cultivated species shared a single cluster while no such similarities were observed for the wild accessions as these were distributed in different groups of sub-clusters. The co-dominant allelic data of 114 accessions were then utilized for obtaining status of the accessions and their hybrid forms. The model-based population structure analysis categorized 114 accessions of Vigna into 6 genetically distinct sub-populations (K = 6) following admixture-model based simulation with varying levels of admixture. 91 (79.82%) accessions resembled their hierarchy and 23 (20.18%) accessions were observed as the admixture forms. Maximum number of accessions (25) were grouped in sub-population (SP) 6 and the least accessions were grouped in SP3 and SP5 (11 each). The population genetic structure, therefore, supported genetic diversity analysis and provided an insight into the genetic lineage of these species which will help in effective use of germplasm for development of cultivars following selective prebreeding activities.

Background: India has the world’s largest load of cervical malignancy. A lot of it can be attributed to lack of cervical cancer screening awareness among the general population. The Accredited Social Health Activists (ASHA) are grass root workers who have good reach in the remote areas, where health care facilities are lacking. Training these ASHAs may increase the general awareness about cervical cancer screening. The aim of the study was to train ASHA workers via lectures and question answer sessions and assess the training with pre and post tests. Methods: We organized two training programs of 500 ASHA workers in two tertiary care hospitals with aim of improving their knowledge and attitude about cervical cancer screening which will eventually improve their practice of training women in general population. It comprised of five lectures in language they understand, slogans, posters, question answer session etc. A test comprising of 17 questions was conducted before and after session to check their knowledge and attitude. Results: There was an overall improvement of 35% in knowledge of the ASHAs i.e. 48% answers were correct in pre-test and 78% were correct in post-test. Questions were pertaining to symptomatology, risk factors, screening methods, their utility and prerequisites of performing the screening tests, when and how often to repeat. Improvement was seen in all the areas. There was improvement in attitude too and most of them wanted themselves (98%), their relatives (100%) and the woman within their area (98%) to be screened for cancer cervix. Conclusion: It was a small initiative and successful result was obtained after the training session of ASHAs. These grass root workers may act as key link of awareness for cervical cancer prevention. They live in same community as the client and therefore, have better repo and communication as compared to medical personnel. Though, this study showed improved knowledge and motivation in ASHAs yet the impact on general population needs further evaluation.

Poster session 3, September 23, 2022, 12:30 PM - 1:30 PM Objective To evaluate the diagnostic performance of Candida colonization index and serum Candida mannan antigen predicting candidemia in febrile episodes of pediatric lymphoreticular malignancies Methods It was a prospective observational study done for 18 months, from November 2018 to April 2020 at the pediatric oncology unit of a multispecialty tertiary care center. Based on our patient load, duration of the proposed study, and available resources, a sample size of 49 (n = 49) was decided and 100 febrile episodes in children with lymphoreticular malignancy were studied. Children below 12 years, receiving chemotherapy for hematological malignancy having oral or axillary temperature ˃38.3°C for ˃1 h were included in this study. Children receiving the antifungal treatment in last 7 days were excluded from the study. Blood collected on day1 and day4 was cultured in BACTEC-9120. For colonization, swabs and samples were collected and cultured on SDA on day1, day4, and day8. All Candida isolates were subcultured on SDA and subjected to Gram's stain, germ tube test followed by Microscan identification. DNA sequencing followed by phylogenetic analysis was done for all the isolates of Candida recovered from blood. Antifungal susceptibility of yeast stains was done. Serum collected on day1 was used for C. mannan antigen detection using ELISA system. Results Prevalence of candidemia was 5%. Non-albicans Candida spp were isolated from blood cultures on day 4. Candida colonization decreased from day1 to day8. Colonization index (CI) day1 showed 80% sensitivity 98.9% specificity, and 98.9% negative predictive value. Significant colonization (CI ≥0.5) was seen in a larger proportion of cases that developed candidemia. There was a significant association of Candida colonization (CI ≥0.5) with occurrence of candidemia on day1 and day4. A total of 4 (80%) of candidemia episodes were positive for serum mannan antigen while 1 (20%) was negative. Mannan antigen was detected earlier with 80% sensitivity, 92.6% specificity, and 98.9% negative predictive value. All Candida isolates were sensitive to fluconazole, amphotericin-B, and caspofungin. Receiver operator characteristic curves for diagnostic performance of various parameters in predicting candidemia show the following trends: Conclusion The CI can predict candidemia but the threshold value needs to be explored in pediatric patients with lymphoreticular malignancies. Mannan antigen detection gives early results with a high negative predictive value.

In recent years, retailers across the globe are using information systems/information technology to do their day to day, end-to-end transactions and implementing these technologies to serve their purpose better. Retailers are also very quick to replace their legacy systems to new ones with better features to meet their emerging needs. FreestyleXtreme is no exception to these trends. Information Systems are at the core of FreestyleXtreme strategy to survive, grow (volume & geography) and serve the customers with higher satisfaction. This paper is an attempt to study the role and growth of the information systems at FreestyleXtreme and find out how these information systems helped the company to achieve its goals with a specific reference to the application of artificial intelligence. The paper presents all facets of implementation of the information systems, including social media and benefits accruing to FreestyleXtreme.

Due to awareness and benefits of goat rearing in developing economies, goats' significance is increasing. Unfortunately, these ruminants are threatened via multiple bacterial pathogens such as enteropathogenic Escherichia coli (EPEC). In goat kids and lambs, EPEC causes gastrointestinal disease leading to substantial economic losses for farmers and may also pose a threat to public health via the spread of zoonotic diseases. Management of infection is primarily based on antibiotics, but the need for new therapeutic measures as an alternative to antibiotics is becoming vital because of the advent of antimicrobial resistance (AMR). The prevalence of EPEC was established using bfpA gene, uspA gene and Stx1 gene, followed by phylogenetic analysis using Stx1 gene. The lytic activity of the isolated putative coliphages was tested on multi-drug resistant strains of EPEC. It was observed that a PCR based approach is more effective and rapid as compared to phenotypic tests of Escherichia coli virulence. It was also established that the isolated bacteriophages exhibited potent antibacterial efficacy in vitro, with some of the isolates (16%) detected as T4 and T4-like phages based on gp23 gene. Hence, bacteriophages as therapeutic agents may be explored as an alternative to antibiotics in managing public, livestock and environmental health in this era of AMR.

Reducing levels of fault current infeed as inverter-based resources (IBR) displace synchronous machines are a concern for system operators. The reduction undermines the ability of a conventional protection system to identify and locate faults in an effective manner. A possible route to avoid elevated ratings is to recognise that the increased current is generally needed at times of decreased voltage such that a tap-change transformer could be used to change how the voltage-current rating of an IBR is presented to the network. This paper proposes a thyristor-based electronic tap-changer (eTC) fitted to the coupling transformer of a STATCOM. The thyristors of the tap-changer can be commutated rapidly by using the STATCOM to drive phase currents to zero briefly. The case-study circuit demonstrates delivery of substantial fault current contribution (FCC) of up to 4 pu at the point of common coupling (PCC) in less than half a cycle (10 ms) after detection of three- and single-phase faults.

Seed longevity mainly depends on initial seed quality and storage conditions therefore; farmers and gene bank curators need to be aware of the storage potential of rajmash cultivars that contribute to the production of high quality seed during routine germplasm regeneration/multiplication. Consequently, it is important to generate information on seed longevity of rajmash. In the present investigation, 14 high yielding rajmash cultivars were stored for 4 years and periodical germination percent, time to initiate germination (t1), time to achieve 50% germination (t50) and uniformity of germination (U7525; time between 25 and 75 % germination) were recorded. The varieties exhibited the mean germination percentage of 93, 93, 73, 3 and 0.9 when stored for 0, 1, 2, 3 and 4 years, respectively. The results demonstrated that, all the 14 varieties could be safely stored for a minimum period of 1 year at ambient condition. Seven varieties (Arka Komal, IPR 98-5, IPR 98-3-1, HUR 137, HUR 203, HPR 35, Gujarat Rajmash 1) could be stored for 2 years as they demonstrated more than the minimum germination requirement (75%) of Indian Minimum Seed Certification Standard. Storing seeds for extended period not only decreased the final germination percentage, but also increased the time for t1, t50 and t7525, suggesting that use of aged seeds could result into poor field establishment coupled with delayed and non-uniform germination.

Cerebral palsy (CP) is a childhood debilitating condition which impairs the physical and mental ability of an individual to maintain oral health.The objective of the present study was assessment of dental neglect and burden of treatment needs of children affected with CP as compared to normal children in a tertiary care hospital in Delhi.A sample size of 104 children of age group of 6-14 years was selected, in which 52 children of CP (case group) and 52 normal school children (control group) were recruited.Children from both groups were examined, and calculation of drug master files (DMFS), defs, oral hygiene index (OHI), and gingival index was done. The presence of trauma and malocclusion was assessed. Present caries activity was assessed by the level of Streptococcus mutans present in saliva in both groups. Treatment needs were then assessed based on intraoral findings.Data were analyzed by SPSS 20.0 software. Student's t-test and nonparametric statistical tests such as Chi-square test and Mann-Whitney test were used as per the nature of variables studied for statistical analysis with the level of significance denoted at P0.05.The mean DMFS, gingival index, OHI, and treatment needs were observed to be higher in the CP group. Increased S. mutans levels were observed in saliva of CP patients. Defs score, trauma, and malocclusion were not statistically significantly higher in CP group as compared to the control group.Cerebral palsy group had a poor oral and gingival health, a higher DMFT and burden of treatment needs and an increased risk of further caries progression due to high caries activity indicated by increased level of salivary Streptococcus mutans than the control group.

Hypecoum pendulum L., a rare, herbaceous angiosperm plant is being reported here as a new record for the flora of Haryana State. In the present communication, a detailed account of the plant along with coloured photographic plates has been provided to facilitate its easy identification. Keywords: New record, wild herb

Automobile sector in India is gearing for sharing mobility, electric, smart and connected vehicles. Indian two-wheeler makers are either acquiring or investing in electric, IIoT and AI startups to compete in new scenario. This paper presents a brief overview of Indian two-wheeler industry and investment strategies of two-wheeler producer TVS Motors Private Limited in the context of emerging scenario and recent investments in startups. The paper analyses TVS's recent investments in electric vehicle, shared mobility (renting), IIOT and AI startups. It is concluded that TVS Motors is, in the first place, investing to be at the forefront of electric, smart, shared and connected vehicles market. The second reason is to overcome the limitation of internal innovation in new segments in terms of required time, needed knowledge and possibility of being the first mover in the new markets.

Tuberose (Polianthes tuberosa L.) is one of the most important tropical bulbous-ornamental cultivated for production of long-lasting flowers spikes. Adaptation and acclimatization of different cultivars under humid agro-climatic conditions of Goa are to be confirmed for their better performance. The present investigation was conducted to evaluate the performance of tuberose cultivars under agro-climatic conditions of Goa during 2014- 2017. Five single and six double cultivars of tuberose were evaluated during the study period. All the cultivars differed in their growth and flowering behaviour. Among the single cultivars, evaluated, maximum number of florets per spike (47.00) was observed in Pune local whereas spike-length (75.59 cm) was maximum in Mexican Single. Among the double cultivars, evaluated, maximum plant height (52.21 cm) and maximum number of leaves per plant (59.63) were recorded with cultivar Arka Suvasini. Leaf length was significantly higher (52.93 cm) in Pearl double whereas leaf width (2.04 cm) was maximum in Calcutta Double. Days to appearance of flower spike were earlier in Arka Suvasini. Minimum days taken for opening of basal floret (84.88 days) were recorded with cultivar Arka Suvasini. Spike girth (0.68 cm), Spike fresh-weight (69.06 cm), floret stalk-length (3.6 cm), floret diameter (5.24 cm), weight of individual floret (3.49 g) and vase life (7.93 days) was significantly maximum in Cv. Arka Suvasini followed by Pearl Double. Based on the performance evaluation cv. Mexican Single among single types and cv. Arka Suvasini and Pearl Double among double types could be recommended for commercial cultivation under agro climatic conditions of Goa.

In dryland regions, soil moisture stress often leads to desiccation and causes injury to photosynthetic machinery. Recently, chlorophyll fluorescence (ChlF)-based assessment of photosynthetic efficiency under drought stress is gaining attention due to advances in instrument development and methodology optimisation. Our study was designed to explore the use of spike photosynthetic efficiency as a trait to differentiate drought responses in wheat. Bread and durum wheat were assessed for spike, stem, and leaf tissue photosynthetic efficiency in response to progressive desiccation using ChlF imaging. Results showed that durum wheat had higher quantum efficiency and lower photoinhibition of PSII relative to bread wheat across spike, stem, and leaf. Rate of decline in maximum photochemical efficiency of PSII with increased desiccation was seen higher in bread wheat spikes as compared to durum wheat. Our investigation clearly demonstrated that ChlF imaging could be effectively deployed as phenotyping tool to differentiate wheat genotypes for their photosynthetic performance under desiccation.

Background and objective: Vitamin D deficiency in antenatal mothers adversely affects not only the health of pregnant mother but also her child. Vitamin D is crucial for proper immune system functioning and management of cytokine environment. Relationship between vitamin D deficiency and TNF-α may prove useful in early detection of inflammatory conditions in pregnant mothers. Therefore, this study assessed serum vitamin D and TNF-α levels in antenatal mothers. Materials & Methods: 78 serum samples of healthy pregnant mothers were included. Serum 25-OH Vitamin D and TNF-α levels were estimated using commercially available ELISA kits. Results:25-OH Vitamin D levels were inadequate (

Objective: Despite the wide availability of markers to diagnose the established disease of RA, there is lack of evidence for the suitability of any of these established biomarkers for diagnosing the disease at an early stage of its pathogenesis. Hs-CRP has the potential to be useful as a predictor of early inflammation in clinically suspected RA cases. Methods: 80 patients (40: anti-CCP positive; 40: anti-CCP negative) irrespective of their age and gender were enrolled. RF status and hs-CRP levels were determined in these patients. Correlation of hs-CRP levels with anti-CCP was done. Results: Mean anti-CCP levels among RF positive and negative cases were 410 U/ml and 62.4 U/ml respectively. Among both the groups of anti-CCP positive and negative patients, majority had hs-CRP levels between 50-60 mg/l. Hs-CRP levels were more than 6 mg/l in majority of the suspected arthritis cases irrespective of the anti-CCP or RF status. Mean hs-CRP levels were 50.8 and 43.6 mg/l among anti-CCP positive and negative cases respectively by unpaired t-test. There was no correlation between serum anti-CCP and hs-CRP levels among both anti-CCP negative and positive cases. Conclusions: Hs-CRP when used alone or in combination with other established markers, can aid in the early diagnosis, prediction of course of disease and assessment of response to treatment in RA cases.

Impatiens scullyi Hook.f. is reported here as a new record for India as well as for the western Himalaya from Kullu and Mandi districts of Himachal Pradesh. To facilitate its identification, detailed description along with colour images are provided here.

Hyperthermic intraperitoneal chemotherapy (HIPEC), along with optimal cytoreductive surgery, has been debated to be a viable option for the treatment of advanced epithelial ovarian cancer with peritoneal carcinomatosis. HIPEC is associated with a direct and improved penetration of chemotherapy drugs into the affected tissue and is associated with fewer systemic side effects. There is no standard protocol for the use of HIPEC in advanced ovarian cancer. Hence, there is controversy over the timing, dose, duration, and efficacy of HIPEC. In this review, the history, technique, current evidence, recommendations, and future directions of HIPEC are discussed.

To detectThe study was carried out on 30 cases each in four groups: sputum smear-positive and sputum smear-negative adults, pediatric patients suspected of pulmonary tuberculosis along with healthy controls. The samples were processed for direct microscopy for acid-fast bacilli (AFB) andAFB was demonstrated in 42 and cultured in 39 out of 240 samples. PCR-targeting IS6110 gene showed positive results in 24 (20%) out of 120 stool samples. PCR in stool showed the highest positivity in sputum smear-positive samples followed by gastric aspirates and sputum smear-negative samples.Stool PCR is a potentially useful diagnostic method for pulmonary tuberculosis.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Soil is an important natural resource, a medium for plant growth, and its quality is decisive for sustainable crop productivity. Soil biological properties in evergreen and deciduous fruit crops were estimated under subtropical region of north-west India; wherein, samples were taken from 0–20 to 0–40 cm soil layers. In the present study, total soil organic carbon (TSOC) and carbon (C) pools, viz., very labile (CVL), labile (CL), less labile (CLL), non-labile (CNL) and biological properties were determined in fruit crops. The results revealed that TSOC, C pools and soil enzymes activities were significantly higher in fruit crops as compared to control (uncultivated). The uncultivated soils (1.96 g kg−1) had the lowest TSOC content, which was lower (p 0.05) than evergreen (3.19–4.69 g kg−1) and deciduous (2.99–5.68 g kg−1) fruit crops. Soil biological properties (microbial biomass carbon, basal soil respiration and quotients) were significantly higher in the fruit crops than the uncultivated, which has increased the C mineralization in soil. Principal component analysis identified CL in PC1 (explaining 52.2% of total variability), microbial quotients in PC2 (25.7% variability) and soil pH in PC3 (10.3% variability) as the most dominant and reliable indicators for the assessment of soil quality in fruit crops. In general, evergreen crops showed higher soil biological activities than deciduous fruit crops. The result signifies that the evergreen fruit crops substantially influenced C sequestration than deciduous fruit crops, which consequential mitigate the negative impacts of climate change.

The genetic base of 150 pigeonpea varieties released in India during1960 to 2018 was examined. Of these, 89, 57, three, and one variety were developed by pedigree selection, pureline selection, mutation and population improvement, respectively. Examination of pedigree records of 89 pigeonpea varieties developed through pedigree breeding method between 1971 and 2018 traced back to 113 ancestors. The highest mean genetic contribution was recorded for the genotype T 190 (0.051) accompanied by UPAS 120 (0.049) and ICP 8863 (0.043). The ancestor T 190 appeared with highest frequency of 21, directly as one of the parent (male/female) in four varieties and indirectly in the development of 17 varieties. Similarly, the ancestors UPAS 120 and ICP 8863 were more frequently used (in nine varieties) as direct parents followed by T 21 and C 11 (in five varieties). The variety PRG 176 involved the highest number (9) of ancestors during the course of its development followed by the variety VBN (Rg) 3 with eight ancestors. Results indicated that 51.69% (46 of the 89 varieties) of released varieties were developed through bi-parental crossing whereas 48.31% involved multiple parents. The frequent use of a limited number of ancestors has caused the narrow genetic base of released pigeonpea varieties. We recommend large-scale deployment of novel germplasm resources for generating broad-base breeding populations. This will help to obtain improved pigeonpea cultivars with high grain yield, biotic tolerance and climate adaptation.

Growth and development of acridid grasshopper, Chrotogonus trachypterus Blanchard was greatly influenced by different levels of temperature (20, 25, 30, 35 and 37oC) and relative humidity (40, 60 and 70%). A laboratory study was revealed that temperature between 30-35oC with 60% relative humidity is mostly suitable for life cycle of the test insect. Maximum oviposition period was 54.6±2.21 days at 25oC whereas, maximum hatching percent was recorded at 30oC (90.6±1.18). Average fecundity of a female increased with the increase in temperature up to 35oC (242.1±2.55) but decreased at 37oC. Developmental period of nymphs was longer at 20oC as 94.03±3.45 and 105.3±3.16 days for males and females whereas, nymphs quickly developed at 37oC within 50.3±0.55 and 60.2±2.44 days, respectively. Highest survivability was obtained at 25o and 30oC. Relative humidity ranged from 60-70% gave non-significant differences and found to be most suitable for insect growth. Study of interaction of ecological factors will be helpful in management strategy of the pest and future adaptation behavior and outbreak issues.

Pigeonpea productivity is greatly constrained by poor plant ideotype of existing Indian cultivars. Enhancing pigeonpea yield demands a renewed focus on restructuring the ideal plant type by using more efficient approaches like genomic tools. Therefore, the present study aims to identify and validate a set of QTLs/gene(s) presumably associated with various plant ideotype traits in pigeonpea. A total of 133 pigeonpea germplasms were evaluated along with four checks in the augmented design for various ideotype traits i.e. initiation of flowering (IF), days to 50% flowering (DFF), days to maturity (DM), plant height (PH), primary branches (PB), seeds per pod (SP) and pod length (PL). We observed significant genetic diversity in the germplasm lines for these traits. The genetic control of IF, DFF, DM and PH renders these traits suitable for detection of marker trait associations. By using residual maximum likelihood algorithm, we obtained appropriate variance–covariance structures for modeling heterogeneity, correlation of genetic effects and non-genetic residual effects. The estimates of genetic correlations indicated a strong association among earliness traits. The best linear unbiased prediction values were calculated for individual traits, and association analysis was performed in a panel of 95 diverse genotypes with 19 genic SSRs. Out of five QTL-flanking SSRs used here for validation, only ASSR295 could show significant association with FDR and Bonferroni corrections, and accounted for 15.4% IF, 14.2% DFF and 16.2% DM of phenotypic variance (PV). Remaining SSR markers (ASSR1486, ASSR206 and ASSR408) could not qualify false discovery rate (FDR) and Bonferroni criteria, hence declared as false positives. Additionally, we identified two highly significant SSR markers, ASSR8 and ASSR390 on LG 1 and LG 2, respectively. The SSR marker ASSR8 explained up to 22 and 11% PV for earliness traits and PB respectively, whereas ASSR390 controlled up to 17% PV for earliness traits. The validation and identification of new QTLs in pigeonpea across diverse genetic backgrounds brightens the prospects for marker-assisted selection to improve yield gains in pigeonpea.