Search

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

By an abrupt rise in the power conservation efficiency (PCE) of perovskite solar cells (PSCs) within a short span of time, the instability and toxicity of lead were raised as major hurdles in the path toward their commercialization. The usage of an inorganic lead-free CsSnI3-based halide perovskite offers the advantages of enhancing the stability and degradation resistance of devices, reducing the cost of devices, and minimizing the recombination of generated carriers. The simulated standard device using a 1D simulator like solar cell capacitance simulator (SCAPS) with Spiro-OMeTAD hole transporting layer (HTL) at perovskite thickness of 330 nm is in good agreement with the previous experimental result (12.96%). By changing the perovskite thickness and work operating temperature, the maximum efficiency of 18.15% is calculated for standard devices at a perovskite thickness of 800 nm. Then, the effects of replacement of Spiro-OMeTAD with other HTLs including Cu2O, CuI, CuSCN, CuSbS2, Cu2ZnSnSe4, CBTS, CuO, MoS2, MoOx, MoO3, PTAA, P3HT, and PEDOT:PSS on photovoltaic characteristics were calculated. The device with Cu2ZnSnSe4 hole transport in the same condition shows the highest efficiency of 21.63%. The back contact also changed by considering different metals such as Ag, Cu, Fe, C, Au, W, Ni, Pd, Pt, and Se. The outcomes provide valuable insights into the efficiency improvement of CsSnI3-based PSCs by Spiro-OMeTAD substitution with other HTLs, and back-contact modification upon the comprehensive analysis of 120 devices with different configurations. [ABSTRACT FROM AUTHOR]

Food intake increases the activity of hepatic de novo lipogenesis, which mediates the conversion of glucose to fats for storage or use. In mice, this program follows a circadian rhythm that peaks with nocturnal feeding (1,2) and is repressed by Rev-erba/β and an HDAC3-containing complex (3-5) during the day. The transcriptional activators controlling rhythmic lipid synthesis in the dark cycle remain poorly defined. Disturbances in hepatic lipogenesis are also associated with systemic metabolic phenotypes (6-8), suggesting that lipogenesis in the liver communicates with peripheral tissues to control energy substrate homeostasis. Here we identify a PPARδ-dependent de novo lipogenic pathway in the liver that modulates fat use by muscle via a circulating lipid. The nuclear receptor PPARδ controls diurnal expression of lipogenic genes in the dark/feeding cycle. Liver-specific PPARδ activation increases, whereas hepatocyte-Ppard deletion reduces, muscle fatty acid uptake. Unbiased metabolite profiling identifies phosphatidylcholine 18:0/18:1 (PC(18:0/ 18:1) as a serum lipid regulated by diurnal hepatic PPARδ activity. PC(18:0/18:1) reduces postprandial lipid levels and increases fatty acid use through muscle PPARα. High-fat feeding diminishes rhythmic production of PC(18:0/18:1), whereas PC(18:0/18:1) administration in db/db mice (also known as [Lepr.sup.-/-]) improves metabolic homeostasis. These findings reveal an integrated regulatory circuit coupling lipid synthesis in the liver to energy use in muscle by coordinating the activity of two closely related nuclear receptors. These data implicate alterations in diurnal hepatic PPARδ-PC(18:0/18:1) signalling in metabolic disorders, including obesity. TGTAGATGGGCTTTACCAAAGATG CCACGAGCTTGTCACCATCTC, PPAR PPARδ promotes fatty acid (FA) synthesis in the liver (9). Surprisingly, hepatic PPARΔ overexpression (adenoviral-mediated, adPPARδ) reduced circulating triglyceride (TG) and free fatty acid (FFA) levels (Fig. 1a). FA [...]

Hyperglycemia is a result of impaired insulin action on glucose production and disposal, and a major target of antidiabetic therapies. The study of insulin-independent regulatory mechanisms of glucose metabolism may [...]