Search

To investigate the virus infections of sour and sweet cherries, various locations of Niğde province were examined during 2017. Ninety sweet and sour cherry leaf samples showing suspicious virus symptoms were collected and screened with virus-specific primers: Little cherry virus 1 (LChV1), Cherry necrotic rusty mottle virus (CNRMV), Prune dwarf virus (PDV), Prune necrotic ring spot virus (PNRSV), Apple mosaic virus (ApMV), Cherry green ring mottle virus (CGRMV), Cherry leaf roll virus (CLRV), Cherry mottle leaf virus (CMLV), Plum bark necrotic stem pitting associated virus (PBNSPaV), Cherry twisted leaf virus (CTLV), Apple stem grooving virus (ASGV), Little cherry virus 2 (LChV2), Cherry rusty leaf virus (CRLV), Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV). Based on RT-PCR analysis, no amplification was observed except LChV1 amplifications, dsRNA analysis resulted in one suspicious profile. To validate those results, more sensitive TaqMan Real-Time PCR analysis and sequence analysis were conducted and LChV1 was detected on 7 samples. It can be concluded that only a low quantity of LChV1 infections was observed on some of the screened cherry samples.

Field surveys were conducted in Greek olive orchards from 2017 to 2020 to collect information on the sanitary status of the trees. Using a high-throughput sequencing approach, viral sequences were identified in total RNA extracts from several trees and assembled to reconstruct the complete genomes of two isolates of a new viral species of the genus Tepovirus (Betaflexiviridae), for which the name olive virus T (OlVT) is proposed. A reverse transcription–polymerase chain reaction assay was developed which detected OlVT in samples collected in olive growing regions in Central and Northern Greece, showing a virus prevalence of 4.4% in the olive trees screened. Sequences of amplified fragments from the movement–coat protein region of OlVT isolates varied from 75.64% to 99.35%. Three olive varieties (Koroneiki, Arbequina and Frantoio) were infected with OlVT via grafting to confirm a graft-transmissible agent, but virus infections remained latent. In addition, cucumber mosaic virus, olive leaf yellowing-associated virus and cherry leaf roll virus were identified.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Pollen transmitted viruses require accurate detection and identification to minimize the risk of spread through the global import and export of pollen. Therefore in this study we developed RT-qPCR assays for the detection of Cherry leaf roll virus (CLRV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), and Cherry virus A (CVA), four viruses that infect pollen of Prunus species. Assays were designed against alignments of extant sequences, optimized, and specificity was tested against known positive, negative, and non-target controls. An examination of assay sensitivity showed that detection of virus at concentrations as low as 101 copies was possible, although 102 copies was more consistent. Furthermore, comparison against extant assays showed that in both pollen and plant samples, the newly developed RT-qPCR assays were more sensitive and could detect a greater range of isolates than extant endpoint RT-PCR and ELISA assays. Use of updated assays will improve biosecurity protocols as well as the study of viruses infecting pollen.

Hydrangea is a popular, summer flowering, ornamental shrub that is native to south and east Asia and North and South America, which is now cultivated throughout the world. Currently, 13 viruses belonging to eight genera have been reported in Hydrangea spp. (1). In April 2011, virus-like disease symptoms, including severe leaf deformation and chlorosis, were observed on two Hydrangea macrophylla ‘Sumiko’ plants from Australia being held in quarantine in New Zealand. Systemic symptoms of veinal necrosis, necrotic halo spots, and severe leaf deformation were observed on Nicotiana occidentalis ‘37B’ 7 days after inoculation with sap from the symptomatic hydrangea plants. Upon reinoculation with sap of symptomatic leaves from N. occidentalis, necrotic ringspots and tip necrosis, typical of nepovirus infection, were observed on leaves of N. tobacum and Chenopodium quinoa, respectively. Transmission electron microscopy of negatively stained sap from symptomatic leaves of N. occidentalis revealed the presence of isometric particles ~28 nm in diameter. Total nucleic acid was extracted from the symptomatic leaves of N. occidentalis with an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). Reverse transcription (RT)-PCR using the reverse primer of Werner et al. (2) and a forward primer, 5′-CGGTGGAGATGCCGGTCCTA-3′ (this study), specific to the 3′-untranslated region (3′-UTR) of Cherry leaf roll virus(CLRV) produced an amplicon of ~1,150 bp from N. occidentalis. A consensus sequence of 1,140 bp generated from four clones of the PCR product (GenBank Accession No. JN418885) was 99 and 98% identical at the nucleotide level to a CLRV isolate from Rumex AGBC (GenBank No. AB168099) and Chinese chives (GenBank No. AB168098), respectively. N. occidentalis also tested positive for CLRV using polyclonal antiserum in a double antibody sandwich-ELISA (BIOREBA, Reinach, Switzerland). The presence of CLRV in the original samples and N. occidentalis was confirmed by direct sequencing of the 380-bp amplicons obtained by immunocapture RT-PCR using CLRV-specific primers (2) and the same antiserum. BLASTn analysis of these amplicons (data not submitted to GenBank) also showed 99% nucleotide identity to a New Zealand isolate from a Rubus sp. (GenBank No. AJ877162). The hydrangea plants were released from quarantine because the same strain of CLRV had previously been reported in New Zealand. To our knowledge, this is the first report of CLRV in hydrangea. CLRV is a seed and pollenborne nepovirus and can be transmitted mechanically and by grafting. Since hydrangeas are mainly vegetatively propagated and are less commonly grown from seeds, the natural spread of CLRV will depend on the movement of infected propagation material. It is unknown whether this virus causes reduction in flower quality in hydrangea as reported in other hosts but any impact on flower quality may be of economic significance in commercial nurseries. References: (1) M. Caballero et al. Plant Dis. 93:891, 2009. (2) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Data from next generation sequencing indicate the complexity of the birch virome in the urban landscape of Berlin. It is well known that plant viruses are widespread and contribute to the decline of birch trees. A mixed infection by Cherry leaf roll virus (CLRV), Apple mosaic virus (ApMV) and two newly discovered viruses from the genus Badna- and Carlavirus were investigated in southern Berlin (Steglitz-Zehlendorf) in 2015 and 2016. To gain a more detailed view on epidemiology of this viral complex in birch, the study was enlarged in 2017 including eight districts all over Berlin. Birch trees with symptoms like defoliation and degeneration were selected for determination of viral pathogens by molecular biological methods. Within the complex occurring symptoms in birch trees, new types of symptoms have been identified. Different combinations of plant viruses in single and mixed infection were detected by Reverse Transcription- Polymerase Chain Reaction (RT-PCR.) CLRV and Badnavirus combinations have shown to be distinct and widely distributed. Heterogeneity is also known from the symptomatology of virus containing birch leaves. As the correlation of symptoms and viral infection is not shown yet for the mixed infections, it is unknown if the complexity of the virome is the cause of the variability of symptoms. Epidemiology and pathogenicity of the newly discovered viruses as well as species specificity, life cycle, mode of transmission, host plant range and phylogeny are totally unknown and have to be investigated within the next years.

Cherry leaf roll virus (CLRV) isolates from Malus domestica, Ribes rubrum, Rubus idaeus, Rumex obtusifolius and Vaccinium darrowii were characterized based on nucleotide sequences of a 371 bp fragment of the 3′ untranslated region (UTR) of their genomic RNAs, symptoms in the herbaceous hosts, Chenopodium amaranticolor, Chenopodium quinoa, Nicotiana benthamiana, Nicotiana occidentalis and Nicotiana tabacum, and seed transmission in N. occidentalis. The different isolates induced a range of localized and systemic disease symptoms, of varying severity, in the herbaceous hosts. The isolates from M. domestica, R. rubrum, R. obtusifolius and V. darrowii all showed greater than 80% seed transmission in N. occidentalis, but no seed transmission was observed for the R. idaeus isolate. Based on symptoms and seed transmission, the isolates appear to be biologically distinct strains of CLRV. Phylogenetic analysis of the nucleotide sequences from the 3′ UTR, commonly used to detect CLRV, showed that four isolates from M. domestica, R. rubrum, R. idaeus and V. darrowii were almost identical but an isolate from R. obtusifolius exhibited a pairwise nucleotide difference of up to 5·4% when compared to these isolates. There was no obvious correlation between sequence differences and symptomatology.

Cherry leaf roll virus (CLRV) was detected in apple (Malus sp.), a host not previously reported for CLRV in New Zealand. A total of 72 leaf samples were obtained from two orchards in the Waikato region of the North Island of New Zealand and tested by reverse transcription-polymerase chain reaction (RT-PCR). Virus-specific RT-PCR, sequencing and mechanical inoculation on herbaceous host plants detected the presence of CLRV in three samples. This is the first report of CLRV on apple in New Zealand. Based on a thorough review of literature, results obtained in this study may likely represent the first case of CLRV in apple.

The complete nucleotide sequence of cherry leaf roll virus (CLRV, genus Nepovirus) from a naturally infected cherry tree (Prunus avium cv. Bing) in North America was determined. RNA1 and RNA2 consist of 7,893 and 6,492 nucleotides, respectively, plus a poly-(A) tail. Each RNA encodes a single potential open reading frame. The first 657 nucleotides of RNA1 and RNA2 are 99% identical and include the 5′-UTR and the first 214 deduced amino acids of the polyproteins following the first of two in-frame start codons. Phylogenetic analysis reveals close relationships between CLRV and members of subgroup C of the genus Nepovirus. Electronic supplementary material The online version of this article (doi:10.1007/s00705-011-1208-4) contains supplementary material, which is available to authorized users.

Two new cherry leaf roll virus (CLRV) isolates (Ah and Ad) were isolated and detected from traditionally-grown walnuts that showed severe apical necrosis and chlorotic spots in systemically infected Cheneopodium amaranticolor , in the eastern part of Turkey. The 404 and 405 bp long DNA fragments of the 3’-non-coding region of both isolates from PCR reactions were cloned and sequenced. A significant genetic variability (up to 14% divergence between sequences) was found within the 3’ terminal region of viral genome of CLRV Turkish isolates compared with the isolates in databases. The sequence of Ad isolate was found to share 84 to 98% and the Ah isolate was found to share 85 to 97% nucleotide identity with corresponding sequences of the selected world isolates. An RNA riboprobe generated for CLRV-Ad isolate reacted also with the CLRV-Ah isolate in dot blot molecular hybridization test. Positive reactions were still visible in hybridization test when the extracts of infected fresh and dried leaf tissues of C. amaranticolor diluted 1:20. Western blot analysis revealed that the molecular mass of the coat protein of about 52 kDa for both isolates. Keywords: Walnut, CLRV, 3’ non coding region

Sweet cherries (Prunus avium) are of economic importance in Oregon, which ranks third in sweet cherry production in the United States after Washington and California. Cherry leaf roll virus (CLRV) causes decline in sweet cherry trees. Cherry leaf roll virus is a species of the genus Nepovirus in the family Secoviridae. In May 2016, decline, rosetting (bunching of leaves due to shortened internodes), and enation symptoms in approximately 7% of trees were observed in adjacent sweet cherry orchards cvs. ‘Royal Anne’ and ‘Bing’ on Mazzard rootstock in The Dalles, Wasco County, Oregon. A symptomatic leaf sample (cv. ‘Royal Anne’) was collected and tested positive via CLRV-specific antisera in a double-antibody sandwich ELISA (DSMZ; Braunschweig, Germany). A second collection of both cultivars was made in September 2016 from the same and neighboring orchard blocks. Of the 16 samples collected, eight symptomatic leaf samples tested positive and eight asymptomatic samples tested negative with the same CLRV-specif...

Kumari S. (2009): Detection of Cherry leaf roll virus and Strawberry latent ring spot virus by one-step RTPCR. Plant Protect. Sci., 45: 140–143. A one-step reverse transcription-polymerase chain reaction (RT-PCR) protocol was developed and used for the detection of Cherry leaf roll virus (CLRV) and Strawberry latent ring spot virus (SLRSV). The protocol was used to test infected screen house plants and also plants from orchards and vineyards where the vector (Xiphinema diversicaudatum) of SLRSV was detected from the soil. The one-step RT-PCR protocol is rapid and sensitive and has the potential to be used for the diagnosis of CLRV and SLRSV in routine diagnostic laboratories.

Next-generation sequencing technologies enable the rapid identification of viral infection of diseased organisms. However, despite a consistent decrease in sequencing costs, it is difficult to justify their use in large-scale surveys without a virus sequence enrichment technique. As the majority of plant viruses have an RNA genome, a common approach is to extract the double-stranded RNA (dsRNA) replicative form, to enrich the replicating virus genetic material over the host background. The traditional dsRNA extraction is time-consuming and labour-intensive. We present an alternative method to enrich dsRNA from plant extracts using anti-dsRNA monoclonal antibodies in a pull-down assay. The extracted dsRNA can be amplified by reverse transcriptase-polymerase chain reaction and sequenced by next-generation sequencing. In our study, we have selected three distinct plant hosts: Māori potato (Solanum tuberosum), rengarenga (Arthropodium cirratum) and broadleaved dock (Rumex obtusifolius) representing a cultivated crop, a New Zealand-native ornamental plant and a weed, respectively. Of the sequence data obtained, 31-74% of the reads were of viral origin, and we identified five viruses including Potato virus Y and Potato virus S in potato; Turnip mosaic virus in rengarenga (a new host record); and in the dock sample Cherry leaf roll virus and a novel virus belonging to the genus Macluravirus. We believe that this new assay represents a significant opportunity to upscale virus ecology studies from environmental, primary industry and/or medical samples.

Publication Inra prise en compte dans l'analyse bibliométrique des publications scientifiques mondiales sur les Fruits, les Légumes et la Pomme de terre. Période 2000-2012. http://prodinra.inra.fr/record/256699; International audience; Cherry leaf roll virus (CLRV) belongs to the Nepovirus genus within the family Comoviridae. It has a host range which includes a number of wild tree and shrub species. The serological and molecular diversity of CLRV was assessed using a collection of isolates and samples recovered from woody and herbaceous host plants from different geographical origins. Molecular diversity was assessed by sequencing a short (375-bp) region of the 3' noncoding region (NCR) of the genomic RNAs while serological diversity was assessed using a panel of seven monoclonal antibodies raised initially against a walnut isolate of CLRV. The genomic region analyzed was shown to exhibit a significant degree of molecular variability with an average pairwise divergence of 8.5% (nucleotide identity). Similarly, serological variability proved to be high, with no single monoclonal antibody being able to recognize all isolates analyzed. Serological and molecular phylogenetic reconstructions showed a strong correlation. Remarkably, the diversity of CLRV populations is to a large extent defined by the host plant from which the viral samples are originally obtained. There are relatively few reports of plant viruses for which the genetic diversity is structured by the host plant. In the case of CLRV, we hypothesize that this situation may reflect the exclusive mode of transmission in natural plant populations by pollen and by seeds. These modes of transmission are likely to impose barriers to host change by the virus, leading to rapid biological and genetic separation of CLRV variants coevolving with different plant host species.

A new and highly sensitive method for the amplification of viral RNA targets from plant material has been developed and patented. This technique called Co-operational amplification (Co-PCR) can be carried out easily in a simple tetraprimer reaction based on the simultaneous action of four primers. The reaction process consists of the simultaneous reverse transcription of two different fragments from the same target, one containing the other; the production of four amplicons by the combination of the two pair of primers, one pair external to other; and the co-operational action of amplicons for the production of the largest fragment. The technique was used successfully, both in metal block and capillary air thermal cyclers for the detection of plant RNA viruses (Cherry leaf roll virus, Strawberry latent ringspot virus, Cucumber mosaic virus, Plum pox virus and Citrus tristeza virus). The sensitivity observed is at least 100 times higher than that achieved with RT-PCR and similar to nested RT-PCR. Colorimetric detection was coupled with this methodology facilitating its introduction for routine indexing programs and for phytosanitary selection of virus-free plant material. (C) 2002 Elsevier Science B.V. All rights reserved.

While ‘Paradox’ hybrid seedlings are often the rootstocks of choice for California walnut orchards, there is a resurgence of interest in using English walnut seedlings because walnut blackline disease, which is endemic in many California walnut production districts, does not affect them. We compared the growth and productivity of walnuts on English rootstocks from a variety of sources to those on Paradox rootstock. The growth and productivity of ‘Chandler’ walnut trees were similar among trees on seedling English rootstocks in one trial, but trees on English rootstocks were smaller and had lower production than Paradox hybrid-rooted trees in the other.

Evidence of RNA‐RNA recombination or transcapsidation was sought in transgenic tobacco (Nicotiana tabacum L. ‘Xanthi‐nc') containing the 3'‐non coding sequence (1.3 kb) from a birch isolate of cherry leaf roll nepovirus (CLRV). Following mechanical inoculation with a rhubarb isolate of the virus, no evidence of recombination was obtained using polymerase chain reactions whether the transgenic gene produced transcripts in the sense or the antisense orientation. Transgenic tobacco containing the CLRV‐derived sequence (in either orientation) did not lessen the pathological effects of the rhubarb isolate of the virus althdugh there was amelioration of the disease caused by the birch isolate. When expressed as a transgenic gene in tobacco, the capsid coding sequence of arabis mosaic nepovirus (ArMV) lessened infectibility by nematodes carrying that virus. This construct did not influence the pathogenicity of potato virus Yo(PVY0), tobacco rattle tobravirus (PRN), alfalfa mosaic ilarvirus (A1MV), or CL...

Cherry leaf roll virus (CLRV) is a well-known virus belonging to the genus Nepovirus, but unlike most members of this genus, it is not known to be transmitted by nematodes but only through seeds and pollen. Since its first description in 1955 on Prunus avium L. in England (1), CLRV has been shown to have a worldwide distribution and a wide natural host range. During a survey of plant viruses in the French sub-Antarctic islands, samples from nasturtium plants (Tropaeolum majus), an introduced plant species, showing symptoms of leaf mosaic, deformation, and veinal necrosis were collected on Amsterdam Island. Upon mechanical transmission with sap extracts, necrotic ringspot and oak-leaf symptoms typical of Nepovirus infection were observed on the leaves of inoculated Nicotiana clevelandii and N. tabacum plants. Inoculation of healthy nasturtium plants resulted in mosaic and pin-point necrosis symptoms. Electron microscopy on negatively stained sap extracts revealed the presence of icosahedral virions, 28 to 30 nm in diameter, in the symptomatic Nicotiana leaves. Amplification by reverse transcription (RT)-PCR with a polyvalent test, which identifies viruses belonging to the family Comoviridae (2), yielded the expected 248-bp fragment. Sequencing of the cloned amplicon showed 80% nucleotide and 90% amino acid identity with a part of the RNA dependent RNA polymerase (RdRp) of CLRV (CAE83562). To confirm the presence of CLRV, an approximate 4.6-kbp cDNA fragment was PCR amplified from double-stranded RNAs purifed from infected Nicotiana plants using the sense primer 5′-GTGGGACTGCCATGCACCTACTC-3′ and an oligo-T25 as antisense primer. This PCR product (GenBank Accession No. GU167974) spans the region between the VPg gene and the polyA tail at the 3′ end of the genome and thus provides approximately 2.8 kb of new internal sequence information on RNA1 of CLRV. The presence of CLRV in the initial nasturtium samples was confirmed with a CLRV-specific RT-PCR assay that amplifies the 3′ non-coding region of the CLRV genome (3). Sequence of the amplified fragment showed it to be identical to the corresponding part of the 3′ non-coding region of 4.6-kbp clone obtained from the CLRV isolate mechanically transmitted to the N. tabacum and N. clevelandii plants. Experimental infection of nasturtium by CLRV has been reported (4), but to the best of our knowledge these results represent the first report of natural infection of T. majus by CLRV. Given its seed transmissible character in many hosts, CLRV likely was introduced in infected seeds of T. majus imported to the remote sub-Antarctic Amsterdam Island. References: (1) R. Cropley. Ann. Appl. Biol. 49:524, 1961. (2) V. Maliogka et al. J. Phytopathol. 152:404, 2004. (3) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (4) K. Schmelzer. Phytopathol. Z. 55:317, 1966.

A series of cDNA clones has been made from the birch isolate of cherry leaf roll nepovirus. Restriction enzyme analysis and sequencing showed that at the 3' end, RNA-1 and RNA-2 are identical for 1.5 kb. Also a 0.7 kb 3' end homology exists between the birch and rhubarb isolate. These sequences do not seem to code for any proteins; however, the sequence conservation points to a role in virus replication.

Three methods were evaluated for the detection of cherry leafroll virus ELISA, dot-blot and reverse transcriptional polymerase chain reaction (RT-PCR). Dot-blot and RT-PCR were carried out in crude plant extracts without any further RNA purification. Dot-blot hybridization using a 32P-labelled DNA probe was as sensitive as previously reported ELISA results for cherry leafroll virus detection. The most sensitive method was RT-PCR, which amplified a specific fragment of 448 bp from the 3' untranslated region of both viral genomic RNAs. RT-PCR was used to detect cherry leafroll virus in infected walnut buds and twigs. © 1992.

Cherry leaf roll virus, CLRV, is a plant pathogen that infects a variety of deciduous trees and shrubs in temperate regions. Little is known about its occurrence at high latitudes and especially in Finnish birch species. Still, symptoms that seemed to be associated with CLRV such as vein banding, leaf roll and decline have been observed in birch trees throughout the country since the summer of 2002. Six different birch species, subspecies or varieties, i.e. Betula pubescens subsp. pubescens (downy birch), B. pendula (silver birch), B. nana (dwarf birch), B. pubescens var. appressa (Kiilopää birch), B. pubescens subsp. czerepanovii (mountain birch) and B. pendula var. carelica (curly birch) originating from all over Finland were assessed by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) for CLRV infection. It was shown that CLRV is widely distributed in B. pendula and B. pubescens throughout the country. Furthermore, dwarf birch, mountain birch, Kiilopää birch and curly birch were confirmed to be previously unkown hosts of CLRV. Genetic analysis of virus sequence variants originating from Finnish birch trees revealed atypical phylogenetic relationships. In contrast to CLRV isolates from birches growing in the United Kingdom and Germany which clustered exclusively within group A, Finnish CLRV isolates belonged either to group B, D or E. Thus, virus population structure in Finnish birches seems to be more variable and host plant dependency seems not to apply for Finnish CLRV isolates.

The inner lining of the food canal of nematodes that transmit plantinfecting viruses is regarded as the retention region of viruses. To characterize the location of transmissible and nontransmissible viruses in the vector nematode Xiphinema americanum, three nepoviruses, Tobacco ringspot virus (TRSV), Tomato ringspot virus(TomRSV), and Cherry leaf roll virus(CLRV), and one non-nematode-transmissible virus, Squash mosaic virus (SqMV), were evaluated for transmission efficiency and localization sites in the nematode. Transmission trials showed highest transmission efficiency for TomRSV (38% with 1 and 100% with 10 nematodes, respectively), intermediate efficiency for TRSV (27% with 1 and 65% with 10 nematodes, respectively), and no transmission for CLRV and SqMV. Electron microscopy and immunofluorescent labeling revealed that TRSV was primarily localized to the lining of the lumen of the stylet extension and the anterior esophagus, but only rarely in the triradiate lumen. Within a nematode population, particles of TRSV were no longer observed in these three regions 10 weeks after acquisition, and it is assumed that there was gradual and random loss of the virus from these areas. The percentage of nematodes that were labeled by virus-specific immunofluorescent labeling in a population of viruliferous nematodes decreased gradually after TRSV acquisition when the nematodes were placed on a nonhost of the virus, and the loss of immunofluorescent labeling paralleled the decrease in the ability of the nematode population to transmit the virus. TomRSV was localized only in the triradiate lumen based on thin-section electron microscopy. No virus-like particles were observed in any part of the food canal of nematodes that had fed on CLRV-infected plants. Virus-like particles that appeared to be partially degraded were observed only in the triradiate lumen of nematodes that had fed on SqMV-infected plants. These results clarified the status of localization of two nontransmissible viruses in X. americanum and presented evidence that two nematode-transmissible viruses, TRSV and TomRSV, are localized in different regions of the food canal of X. americanum.

Seloste artikkelista: Jalkanen, R., Buttner, C. & von Bargen, S. 2007. Cherry leaf roll virus abundant on Betula pubescens in Finland. Silva Fennica 41 (4) : 755-762

Virus-related symptoms such as vein banding, leaf roll, chlorosis and subsequent necrosis on birch leaves were increasingly recorded throughout Finland since 2002. They are widespread in this country and have also been detected in northern Norway and Sweden. Symptomatic foliage has so far been found on Betula pendula, B. pubescens, B. pubescens subsp. czerepanovii, and B. nana. A Cherry leaf roll virus (CLRV) specific IC-RT-PCR was applied to young leaves, buds and catkins of symptomatic shoots of nineteen pubescent and one silver birch trees grown in the centre of Rovaniemi, Finland. CLRV was found in seventeen B. pubescens trees. This is the first time that B. pubescens has been confirmed to be a host species for CLRV in Finland. Nor has CLRV been recorded earlier in northern Finland.

During late spring of 2012 in Snohomish County of Washington State, chlorotic yellow leaf blotch symptoms suggestive of a virus infection were observed on Portuguese laurel (Prunus lusitanica) planted in a hedge row. Leaf samples from representative trees were initially tested for the presence of Cherry leaf roll virus (CLRV) and Plum pox virus (PPV) by ELISA with antibodies specific to CLRV and general potyvirus, respectively (Agdia, Inc., Elkhart, IN). The ELISA test yielded negative results for both viruses. Reverse transcription (RT)-PCR was pursued to detect other viruses known to infect Prunus spp., namely American plum line pattern virus (APLPV), Apple chlorotic leafspot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry raspleaf virus (CRLV), Cherry virus A (CVA), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV), as well as CLRV and PPV. None of these viruses were detected. However, RT-PCR with a generic primer pair Fovea2/AdPr (3) that amplifies the coat protein (CP) coding sequence and 3′-untranslated regions (3′-UTR) of several members of the family Betaflexiviridae yielded a 1.4-kb amplicon that was cloned into pCR2.1 (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. KF356396). The sequences from three clones were 99.8% identical to each other at the nucleotide level. Comparison of the consensus CP coding region with the nucleotide sequence database revealed 86 to 93% identity to Cherry rusty mottle associated virus (CRMaV), and only 73 to 75% identities to Cherry necrotic rusty mottle virus (CNRMV) (1) and 71 to 76% identities to Cherry green ring mottle virus (CGRMV) (4) isolates from sweet cherry (P. avium). This result suggested that the cloned fragment represents a strain of CRMaV. Prunus avium ‘Bing’ and ‘Sam,’ and P. serrulata ‘Kwanzan’ were grafted with bark patches from the symptomatic tree and observed for induction of cherry rusty mottle disease (CRMD) symptoms. Ninety days after grafting, symptoms typical of CRMD consisting of chlorotic yellow mottle appeared on ‘Bing,’ ‘Sam,’ and ‘Kwanzan’ indicators. Small necrotic spots also appeared on the leaves of the latter. Angular necrotic lesions on ‘Sam’ and epinasty of ‘Kwanzan’ that are diagnostic symptoms of cherry necrotic rusty mottle disease (CNRMD) and cherry green ring mottle disease (CGRMD), respectively, were absent from graft inoculated indicators. Further RT-PCR tests on the indicators using primers specific to CNRMV, CGRMV, and CRMaV (2) yielded negative results for CNRMV and CGRMV but showed positive amplification for CRMaV. The results of the woody indexing corroborate the presence of CRMaV but the absence of CNRMV and CGRMV in the symptomatic Portuguese laurel. To our knowledge, this is the first report of CRMaV in Portuguese laurel in the United States and the first description of symptoms associated with CRMaV in this host. As a potential reservoir of CRMaV, Portuguese laurel could play an important component in management of CRMD in cherry production areas where this ornamental cherry is also present. References: (1) M. E. Rott and W. Jelkmann. Arch. Virol. 146:395, 2001. (2) D. E. V. Villamor and K. C. Eastwell. Phytopathology 103:1287, 2012. (3) D. V. Villamor et al. Arch. Virol. 158:1805, 2013. (4) Y. P. Zhang et al. J. Gen. Virol. 79:2275, 1998.

A single-step multiplex RT-PCR was developed for the simultaneous and colourimetric detection of six RNA viruses (Cucumber mosaic virus, Cherry leaf roll virus, strawberry latent ringspot virus. Arabis mosaic virus, Olive latent-1 virus and Olive latent-2 virus) which infect olive trees. Six compatible primer set for one-step RT-PCR amplification in a single closed-tube and 3' digoxigenin labelled probes were designed in optimal, specific and conserved regions. The method has been assessed with 195 Spanish field olive trees, suggesting that similar to 1.5% of the tested material was infected by Cucumber mosaic virus and 0.5'%, by Cherry leaf roll virus. This method saves time and reagent costs compared with monospecific RT-PCR which needs several reactions for the same number of tests. Using colourimetric detection, it is possible to analyse many samples, it increases sensitivity 10-fold, and whilst facilitating the interpretation of results, it avoids the use of gels and the toxic ethidium bromide. The method could be used routinely for sanitary and certification programmes. (C) 2001 Elsevier Science B.V. All rights reserved.

Rose is the top selling cut flower in New Zealand and is the most popular garden plant in the world. Several virus-like diseases have been described in roses, but the causal agents for many remain unknown. Most of the described viruses infecting rose belong to the genera Ilarvirus and Nepovirus. Only recently, a number of new viruses have been or are in the process of being characterized (1,2,3,4). In January 2011, 10 rose samples showing virus-like symptoms were collected from the Wanganui region on the North Island of New Zealand. Total nucleic acid was extracted from these samples using an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). PCR and reverse transcription (RT)-PCR was conducted using specific primers for Arabis mosaic virus (ArMV), Cherry leaf roll virus, Prunus necrotic ringspot virus (PNRSV), Rosa rugosa leaf distortion virus, Rose spring dwarf associated virus, Rose yellow leaf virus, Rose yellow mosaic virus, Rose yellow vein virus (RYVV), and Strawberry latent ringspot virus. Samples were also tested using generic primers for carlavirus, potexvirus, potyvirus, tombusvirus, and phytoplasmas. Two samples (cvs. Pauls Himalayan Musk and Bloomfield) were positive for ArMV, four samples (cvs. Leda, Rosa Mundi, Charles de Mills, and Indica Major) were positive for PNRSV, and two samples (cvs. Leda and Zephirine Drouhin) were positive for RYVV. Samples were negative for all other tested viruses and phytoplasmas. RYVV was detected using two sets of primers (D. Mollov, personal communication) designed to amplify fragments of estimated sizes of 797 bp and 684 bp of the movement protein (MP) and coat protein (CP) genes of RYVV, respectively. RYVV amplicons were sequenced directly (GenBank Accession Nos. JX887423 to JX887426). A BLASTn search of the MP and CP fragments showed the highest nucleotide identity of 98% and 96 to 97%, respectively, with the type isolate of RYVV (JX028536). RYVV has been reported as the causal agent of a vein yellowing disease in rose (2). Symptoms observed in the ‘Leda’ sample infected with PNRSV and RYVV (vein yellowing and chlorotic mottle in the apex of leaves) were not typical of PNRSV, so they may be caused by RYVV. Symptoms in samples of cv. Zephirine Drouhin (curling of leaves and mottle), observed in both RYVV-positive and -negative samples, may not be associated with RYVV infection. This suggests that vein yellowing may be influenced by cultivar. RYVV has been reported in several rose cultivars, but only in the United States (2). To the best of our knowledge, this is the first report of RYVV infecting rose in New Zealand, where it is likely that the virus has been present for some time. The virus may have a much wider geographical distribution than that reported as the virus was only recently characterized (3). References: (1) B. Lockhart et al. Page 31 in: Program and Abstracts of The 12th International Symposium on Virus Diseases of Ornamental Plants, 2008. (2) D. Mollov et al. Phytopathology 99:S87, 2009. (3) D. Mollov et al. Arch Virol. 158:877, 2012. (4) N. Salem et al. Plant Dis. 92:508, 2008.

Cherry leaf roll virus (CLRV) is a member of the genus Nepovirus , family Secoviridae (Sanfacon et al ., 2009) and has a wide host range and geographical distribution. CLRV was first described in 1933 in Persian English walnut ( Juglans …

The long-distance movement of cherry leaf roll virus (CLRV) in tobacco plants was studied using a tissue printing technique with non-isotopic RNA probes. Time-course analysis revealed that CLRV RNA accumulated in the inoculated leaf at an early stage, such as 20 h post-inoculation. The virus accumulation reached a peak at 8–10 days post-inoculation (d.p.i.) and then progressively decreased. The virus RNA signal was detected before the appearance of symptoms. The virus invaded stem vascular tissues at 3 d.p.i., moving towards the roots before moving to the upper leaves. In systemically infected leaves, the virus appeared first in the basal regions and then moved to the distal parts through the vascular system. The distribution pattern of the virus coat protein in systemically infected leaves was parallel to that observed for the virus RNA, suggesting that CLRV requires the coat protein for long-distance movement. The movement of the virus was influenced by the phyllotactic position of the leaves. The viral symptoms and the virus RNA signal in older systemically infected leaves were asymmetrically distributed, being localized in the side of the lamina closest to the inoculated leaf. Virus distribution in infected plants as well as the susceptibility of the plant to systemic infection were also influenced by the developmental stage of the inoculated leaves. Inoculation of leaves at 95% of their final size resulted in virus replication but no systemic infection. In fully mature leaves the virus did not replicate.

Hybridization analyses of cDNA clones derived from the two genomic RNAs, RNA1 and RNA2, of the walnut strain of the nepovirus cherry leafroll nepovirus (wCLRV) demonstrated a long region of high homology between the two viral RNAs. Subsequent mapping and nucleotide sequencing revealed a long, noncoding, presumably untranslated, region (3′ UTR) immediately 5′ of the terminal polyadenylate, a region that is almost identical in the two RNAs. This 3′ UTR is 1567 nucleotide residues long in RNA1. Homologies of about 80% were found with corresponding regions of genomic RNAs from other strains of CLRV, but not with the corresponding regions of other nepovirus genomic RNAs. © 1995 Kluwer Academic Publishers.

The 3' termini of RNA1 and RNA2 of blueberry leaf mottle virus (BBLMV) were cloned and the cDNA sequence of a portion of the putative polymerase gene, the complete coat protein (CP) gene, and the 3' non-coding regions was determined. The N terminus of the coat protein gene was precisely located by comparison with the amino acid sequence determined by the Edman degradation sequencing of the purified coat protein. The coat protein gene encoded a polypeptide of 521 amino acids with a predicted Mr of 57,542. Homology to BBLMV coat protein was highest with tomato ringspot virus (TomRSV) and cherry leaf roll virus (CLRV); two other nepoviruses also belonging to a sub-group defined by the presence of large RNA2 components. The 3' terminal 1390 nt of RNA1 and RNA2 were nearly identical and apparently non-coding. No statistically significant sequence homology was found between the 3' non-coding regions of BBLMV and other nepoviruses. A highly conserved 3' non-coding region of this length is unusual, but has been reported for two other related viruses, TomRSV and CLRV. The biological function of the long 3' non-coding region and how the high level of sequence homology is maintained between RNA1 and RNA2, is unknown. Possible mechanisms for conservation of the 3' terminus are discussed.

A virus, designated JCM-79, was isolated from wild potato (Solanum acaule Bitt.) plants grown from true seed received at USDA-APHIS Potato Quarantine Program from Peru. JCM-79 was mechanically transmissible to Nicotiana clevelandii and N. tabacum cv. Samsun NN. Symptoms in the original S. acaule were general chlorosis and spreading necrotic lesions. Symptoms in N. tabacum and N. clevelandii included necrotic ringspots on inoculated leaves and oak-leaf patterns or necrotic spots, respectively, on upper leaves. Cultivated potatoes (S. tuberosum) infected with JCM-79 by grafting from N. clevelandii were symptomless but virus was detected by back-inoculation to N. clevelandii. Viral nucleoproteins were purified by differential centrifugation and sucrose density gradient fractionation from N. clevelandii and N. tabacum. Transmission electron microscopy of nucleoproteins revealed isometric particles approximately 25 nm in diameter. Two RNA species of approximately 8,000 and 6,500 nucleotides were obtained from nucleoproteins digested with sodium dodecyl sulfate and Proteinase K. The above characteristics suggested JCM-79 was a nepovirus or nepovirus-like in nature. Reverse transcription (RT)-PCR tests for Cherry rasp leaf virus, genus Cheravirus, which was reported from potato (3), were negative. An approximately 1,600-bp cDNA clone was obtained from RNA of JCM-79 by oligo dT primed reverse transcription and second strand cDNA synthesis. Sequence analysis (GenBank No. GU321989) revealed the closest homology (82%) to nucleotides 327 to 1801 of Accession No. S84125 Cherry leaf roll virus (CLRV), genus Nepovirus. Subsequent RT-PCR tests with CLRV-specific primers (4) resulted in amplification of a 417-bp product from nucleic acid extracts of infected N. clevelandii and N. tabacum. The amplified product from N. clevelandii was cloned and three clones were sequenced in both directions. The consensus sequence (GenBank No. GU321988) showed approximately 90% homology to the 3′ untranslated region of isolates of CLRV including those from birch, walnut, and sweet cherry (GenBank Nos. S84124, Z34265, and AJ877128, respectively). JCM-79 was also detected in extracts of infected plants by ELISA using CLRV-cherry reagents (Bioreba AG, Reinach, Switzerland). These results indicate JCM-79 represents a new variant of CLRV. To our knowledge, this is the first report of CLRV naturally infecting S. acaule. S. acaule is common in the Andean regions of South America and has been used for crosses with S. tuberosum because of its pathogen resistance (1). The fact that JCM-79 is seed transmitted in S. acaule suggests that this virus could be a threat to potato-breeding programs. Another nepo-like virus with properties similar to JCM-79, designated Potato virus U (PVU), was reported from South America, but PVU was not serologically related to CLRV (2). References: (1) K. Hosaka and D. M. Spooner. Theor. Appl. Genet. 84:851, 1992. (2) R. A. C. Jones et al. Phytopathology 73:195, 1983. (3) J. R. Thompson et al. Arch. Virol. 149:2141, 2004. (4) B. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

The properties of a virus causing walnut ringspot ofJuglans regia L. which had been identified by the visual examination of symptoms on leaves and fruits of walnut trees in Slovakia were studied. The virus was transmitted mechanically toChenopodium quinoa Willd.,Chenopodium amaranticolor Coste et Reyn.,Nicotiana clevelandii Gray,Phaseolus vulgaris L. cv. Bountiful. Purified virus was used for antiserum production. The thermal inactivation point of the virus lies between 48 and 50 °C and the dilution end-point between 10-1 and 10-2. The obtained antiserum had a titer 1:256. Virus isolates gave a positive immunological reaction with the Mircetich's antiserum against the cherry leaf roll virus obtained from walnut tree.

During the summers of 2001 and 2002, Japanese peony (Paeonia albiflora Pall., synonym P. lactiflora, family Paeoniaceae) plants, cultivated in the Botanical Garden of the University of Parma (Emilia Romagna Region of northern Italy), were found affected by a disease with virus-like symptoms. The oldest leaves showed yellow, mosaic, oak-like arabesques and line-patterns; the remaining leaves and pink flowers were symptomless. A disease of peony, known as peony ring spot disease, has been reported worldwide (Europe, United States, Japan, and New Zeland) for several years and is associated with strains of Tobacco rattle virus (TRV) (1). Electron microscopic observations of peony leaf sap (leaf dip preparations stained with uranyl acetate and phospotungstic acid) did not show the presence of any rod-shaped virus particles, including TRV. Mechanical inoculations of sap from symptomatic leaves caused symptoms typical of Alfalfa mosaic virus (AMV) on Chenopodium amaranticolor Coste & Reyn. (local chlorotic and necrotic lesions and systemic periveinal line-patterns), Ocimum basilicum L. (yellow mosaic), Vigna unguiculata (L.) Walp. (red, local necrotic lesions), and Nicotiana tabacum cv. Samsun (white, necrotic lesions, systemic leaf malformation, and mosaic), and N. glutinosa L. (systemic leaf variegation). Symptomatic leaves of peony and infected herbaceous plants were analyzed for virus presence by protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA). The polyclonal antisera tested were those to AMV (PVAS 92, American Type Culture Collection, Manassas, VA), AMV-Vinca minor L. (DiSTA collection, Italy), and the nepoviruses Strawberry latent ringspot virus, Tomato ringspot virus, and Cherry leaf roll virus. PAS-ELISA revealed only the presence of AMV. Immunoelectron microscopy and gold-labeled decoration confirmed the identity of the virus. In 2001, five symptomless peony plants (provided by a commercial grower and previously analyzed for AMV and TRV presence) were grafted with shoots from peony showing yellow mosaic on the leaves and maintained in a greenhouse under aphid-proof cage. During the summer of 2002, one of the grafted plants showed a mild mosaic on the leaves; PAS-ELISA revealed this peony was infected by AMV. To our knowledge, this is the first report of AMV in peony. Reference: (1) Chang et al. Ann. Phytopathol. Soc. Jpn. 42:325, 1976.

Summary Purified preparations of the two sedimenting nucleoprotein components (M and B) of tomato ringspot virus (TomRSV) and of strains of cherry leaf roll virus (CLRV) from elderberry (G) and from rhubarb (R) had little infectivity alone whereas mixtures of homologous components were very infective. However, whereas heterologous mixtures of the components of CLRV strains G and R were also very infective, heterologous mixtures of the components of CLRV-R and TomRSV were not. These results and serological evidence indicate that CLRV and TomRSV are not closely related to each other or to other nepoviruses with similar properties. Pseudo-recombinants produced by exchanging the nucleoprotein components of CLRV strains R and G were less stable than the parent isolates on storage in sap at 18 °C. Component M determined serological specificity whereas component B determined ability to infect Gomphrena globosa, and the lesion type and severity of systemic symptoms in Chenopodium and Nicotiana spp. Virulence also depended on the compatibility of M and B components and neither pseudo-recombinant was as virulent as the parent donating component B. Systemic infection and symptom production in Petunia hybrida required M and B components from strain R. In plant protection tests, the parent strains of CLRV protected tobacco plants against either parent and against the two pseudo-recombinants, whereas the pseudo-recombinants protected plants against either pseudo-recombinant but not against the parent strains. This suggests that determinants in both nucleoprotein components of either the protecting or challenging virus are involved.