Search

Infection disease caused by nontuberculous mycobacteria (NTM) have been increasingly reported and often manifest with the same symptoms of tuberculosis (TB). The identification of the causative agent is fundamental for the determination of an appropriate therapy, since each species of mycobacteria requires a specific treatment. Thus, rapid and accurate tests to identify mycobacteria of medical interest, such as Mycobacterium tuberculosis complex (MTBC) and Mycobacterium avium complex (MAC), are necessary in the clinical routine. The present study evaluated an in-house multiplex PCR to detect, in reference and clinical strains, the genus Mycobacterium and also M. tuberculosis and MAC. To identify the Mycobacterium genus, M. tuberculosis and MAC, it was amplified a fragment of hsp65 gene, esat-6 gene, and the internal transcribed spacer between the 16S and 23S rRNA genes, respectively. In total, 87 mycobacteria strains were used, being 10 reference and 77 clinical strains, previously identified as MTBC (n = 66), M. avium (n = 8) or other NTM specie (n = 13). The hsp65 gene fragment was amplified for all mycobacteria strains evaluated (87/87). This multiplex PCR presented sensitivity of 100% and specificity of 95.2% for M. tuberculosis detection, and sensitivity of 100% and specificity of 100% for MAC detection. The multiplex PCR evaluated is an important tool for the differentiation between M. tuberculosis and NTM, as well as for the identification of MAC, a complex composed by species with high prevalence in the world.

Poster session 3, September 23, 2022, 12:30 PM - 1:30 PM Invasive Pulmonary Aspergillosis (IPA) is a relevant opportunistic disease among neutropenic patients with hematological diseases. Besides them, studies have been showing that critically ill patients in intensive care units (ICU), mainly those infected by respiratory virus such as SARS-CoV-2 are also at risk to be co-infected by Aspergillus and developing IPA. Objectives We aimed to evaluate the detection of Aspergillus in tracheal samples from patients in an ICU on mechanical ventilation from a tertiary hospital from Southern Brazil, and its relationship with their outcome. Methods All samples of tracheal aspirate (TA) from patients admitted to the ICU and in mechanical ventilation from July 2020 to June 2021 were included in the study. We performed three different tests to detect Aspergillus spp.: (1) mycological culture in Sabouraud Agar Dextrose, with macro and microscopy evaluation of the colonies to the identification of Aspergillus section; (2) lateral flow assay for the detection of Aspergillus Galactomannan (GM) performed with the cube reader (IMMY® Diagnostics, OK, USA), using a cut-off of ≥4 (nm/ml); (3) quantitative polymerase chain reaction (qPCR) with GoTaq® Probe qPCR (Promega, Wisconsin, EUA) to amplify the small subunit ribosomal RNA target using the forward (3’ TTGGTGGAGTGATTTGTCTGCT 5’), and reverse (5’ TCTAAGGGCATCACAGACCTG 3’) primers, and the probe (3’ TCGGCCCTTAAATAGCCCGGTCCGC 5). Samples presenting the cycle threshold (CT) Results A total of 34 patients were included in the study. Causes of ICU admissions were aids complications (n = 11), COVID-19 (n = 9), severe acute kidney disease (n = 6), tuberculosis (n = 1), and other reasons, including post-surgery, septic shock, severe acute respiratory syndrome, and cardiac problems (n = 6). Aspergillus spp. was isolated in culture of the TA in 50% of the patients (17/34), being 12 Aspergillus section Fumigati, three Aspergillus section Flavi, and two Aspergillus section Nigri. TA from eight patients were positive for GM, and five patients had a positive result in the qPCR assay. Probable aspergillosis was confirmed in 20.6% (7/34), being three patients positive in culture and GM, and three in culture and qPCR. One patient was positive in the three tests. COVID-19-associated aspergillosis (CAPA) corresponded to two of these seven cases. The outcome was death in 13/34 patients, 4 of them (31%) had probable aspergillosis. The other three patients, alive, diagnosed with probable aspergillosis, were treated with amphotericin B, desoxicolate plus itraconazole, and survived. The mortality rate was 57.1% (4/7) and 33.3% (9/27) in the group with and without probable aspergillosis, respectively. Conclusion These partial results suggest that aspergillosis can have an important impact in critically ill patients in the intensive care unit of our hospital.

Background: Tuberculosis (TB) remains a serious public health problem, with approximately 10 million new cases reported annually. Knowledge about the quantitative evolution of theses and dissertations (T&Ds) examining human TB in Brazil can contribute to generating strategic planning for training professionals in this field and disease control. Therefore, this study highlights the role of T&Ds on TB in national scientific disclosures. Methods: An integrative review related to TB was performed, including T&Ds produced in Brazil and completed between 2013 and 2019. Results: A total of 559,457 T&Ds were produced, of which 1,342 were associated with TB, accounting for 0.24% of the total number of T&Ds in Brazil. This was evidenced by a predominance of themes such as attention/health care, epidemiology, and TB treatment, and 80.2% of the T&Ds on TB were related to the large areas of health and biological sciences. Only 19.7% of T&Ds were associated with groups of patients considered at risk for TB, and 50.9% were produced in southeastern Brazil. The 1,342 T&Ds on TB were developed in 416 postgraduate programs linked to 121 higher education institutions (HEIs). We highlight that 72.7% of T&Ds on TB were produced in federal HEIs, 27.4% in state HEIs, and 8.5% in private HEIs. Conclusions: Strategic themes, such as TB control, require public policies that aim to increase the number of doctors and masters with expertise in TB, with geographic uniformity, and in line with the priorities for disease control.

Despite thousands of sporotrichosis cases related to the zoonotic transmission of Sporothrix brasiliensis have been described, the diagnostic gold standard is still the classical culturing methods. The mycological culture results are available afterseven to 30 days of incubation. Since an early diagnosis contributes to improving thetreatment and to the spread control of this mycosis, studies evaluating faster diagnosticmethods are needed. Therefore, we aimed to evaluate the species-specific PCR for thesporotrichosis diagnosis caused by S. brasiliensis, using samples collected with a noninvasive technique. Seventy-four swabs from feline (n=64), canine (n=5), and human(n=5) suspect sporotrichosis cases were included. All samples were submitted to classicalmethods for diagnosis and to S. brasiliensis-specific PCR. Using mycological culture asthe gold standard, the diagnosis of S. brasiliensis-caused infection was confirmed in 69%(51/74) of the cases. PCR was positive in 30 out of these 51 cases, showing 59%sensitivity, 100% specificity, 72% accuracy, 100% positive predictive value, and 52%negative predictive value. Consequently, more studies are needed to elucidate theinterference factors that culminated with the high rate of false-negative results and thenoptimize this molecular test for the accurate diagnosis of infections caused by S.brasiliensis.

Case Reports Due to the difficulty in the access to free-ranging birds, data regarding Aspergillus infections in wild avian species is rare compared to captive wild and domestic birds. Objective: report three cases of Aspergillus section Fumigati causing fungal disease in free-ranging aquatic birds, with the identification of the causal agent to the species level. Case reports: The diagnosis of aspergillosis was performed by macroscopic lesions found during the necropsy and confirmed by culture. Molecular identification by partial sequencing of the calM and benA genes allowed to confirm Aspergillus fumigatus sensu stricto as the etiological agent of aspergillosis in Procellaria aequinoctialis (White-chinned petrel) (n = 1), Nannopterum brasilianus (Neotropical cormorant) (n = 1) and Chroicocephalus maculipennis (Brown-hooded gull) (n = 1). Conclusion: Larger studies regarding the importance of aspergillosis in free-ranging aquatic birds are necessary, as well as it potential role in the One Heath context. ehabilitation Center of Marine Animals (CRAM-FURG). This study was supported by the International Cooperation Program financed by Brazilian Federal Agency for Support and Evaluation of Graduate Education within the Ministry of Education of Brazil (CAPES), under the Capes-Print Program and PDSE Program - Finance Code 001. info:eu-repo/semantics/publishedVersion

Tuberculosis (TB) remains a major health problem within the Community of Portuguese Language Speaking Countries (CPLP). Despite the marked variation in TB incidence across its member-states and continued human migratory flux between countries, a considerable gap in the knowledge on the Mycobacterium tuberculosis population structure and strain circulation between the countries still exists. To address this, we have assembled and analysed the largest CPLP M. tuberculosis molecular and drug susceptibility dataset, comprised by a total of 1447 clinical isolates, including 423 multidrug-resistant isolates, from five CPLP countries. The data herein presented reinforces Latin American and Mediterranean (LAM) strains as the hallmark of M. tuberculosis populational structure in the CPLP coupled with country-specific differential prevalence of minor clades. Moreover, using high-resolution typing by 24-loci MIRU-VNTR, six cross-border genetic clusters were detected, thus supporting recent clonal expansion across the Lusophone space. To make this data available to the scientific community and public health authorities we developed CPLP-TB (available at http://cplp-tb.ff.ulisboa.pt), an online database coupled with web-based tools for exploratory data analysis. As a public health tool, it is expected to contribute to improved knowledge on the M. tuberculosis population structure and strain circulation within the CPLP, thus supporting the risk assessment of strain-specific trends., Highlights • The Community of Portuguese Speaking Countries (CPLP) occupies a vast geographical area. • Three CPLP countries are shortlisted in the WHO's list of Top 30 high-burden countries. • Common Mycobacterium tuberculosis population structure denote historical strain flow. • Cross-border clusters suggest recent intercontinental tuberculosis transmission. • CPLP-TB: a novel strain database and framework for collaborative studies and strain tracing.

Tuberculosis (TB) in pinnipeds is typically caused by Mycobacterium pinnipedii, which has also been associated with infections in other species, such as cattle and humans. As a result, this pathogen has zoonotic potential and is a public health concern. In 2016, a female South American sea lion Otaria flavescens in southern Brazil presented with emaciation and severe dyspnea and died within 3 h of capture. Gross pathology identified pulmonary granulomas, and Ziehl-Neelsen stain identified acid-fast bacilli. M. tuberculosis complex bacteria were confirmed by a BD BACTEC™ MGIT™ 320 detection system using fibrinous exudate, lung granulomas and thoracic fluid. Molecular characterization by spoligotyping showed a hybridization pattern characteristic of M. pinnipedii (SIT593/PINI1). Currently, there is a paucity of data concerning the transmission and epidemiology of M. pinnipedii in pinniped populations in South America. The case report shows that the disease appeared in a free-ranging beached sea lion on the coast, and further surveillance is needed to determine the origin of this TB because of its potential impact on public health.

The objective of this study was to evaluate the frequency of different extended-spectrum β-lactamases (ESBL) as well as to associate these ESBL with antimicrobial (ATM) resistance in Escherichia coli and Klebsiella spp. isolates from outpatients and inpatients with urinary tract infections. The study included 435 consecutive nonduplicate clinical isolates, including 362 E. coli isolates, 62 Klebsiella pneumoniae isolates, and 11 K. oxytoca isolates. Isolates were obtained from patients who were treated in a University Hospital between August 2012 and July 2013. Three multiplex PCR were performed to identify the ESBL groups. A total of 48 (11%) ESBL-producing isolates were found. The risk for the ESBL presence was significantly higher in males (26.4%) than females (8%), from hospital-acquired infections (29.1%) than community-acquired infections (7.0%) and in Klebsiella spp. (27.4%) than in E. coli (7.7%). ESBL-producing isolates presented a significantly higher percentage of resistance in 21 of the 23 ATMs analyzed. The CTX-M-1 group was the most predominant ESBL identified. The bla(CTX-M-1-group) gene was found in 56% of the total ESBL producers from community and in 42.4% from hospital origins; it was followed in frequency by the bla(CTX-M-8/25-group), also found in both environments. Klebsiella spp. presented the largest variety of β-lactamase enzyme combinations and a higher level of resistance to cefotaxime. These findings contribute to better knowledge of the epidemiology of ESBL enzymes and are alarming for the reduced therapeutic options available for the risk groups identified in the studied populations.

Funding Information: Funding: This study was funded, in part, by the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (Grant No. 001) and supported by Fundação de Amparo à Pesquisa do Estado do Rio Grande do Sul (Grant No. 17/1265–8 INCT-TB). JP is supported by Fundação para a Ciência e Tecnologia through Estímulo Individual ao Emprego Científico (CEECIND/00394/2017). Funding Information: The authors wish to thank TGen, C-Path and ReSeqTB for supporting WGS, and the Brazilian Network of Tuberculosis Research for enabling this partnership. The authors would also like to thank the Mycobacteria Laboratory at LACEN-RS/CEVS/SES-RS for performing and providing information on drug susceptibility testing. Funding: This study was funded, in part, by the Coordena??o de Aperfei?oamento de Pessoal de N?vel Superior - Brasil (Grant No. 001) and supported by Funda??o de Amparo ? Pesquisa do Estado do Rio Grande do Sul (Grant No. 17/1265?8 INCT-TB). JP is supported by Funda??o para a Ci?ncia e Tecnologia through Est?mulo Individual ao Emprego Cient?fico (CEECIND/00394/2017). Competing interests: None declared. Ethical approval: This project was approved by the Research Ethics Committee of the Funda??o Estadual de Produ??o e Pesquisa em Sa?de (Protocol No. 1.587.621 CAAE: 18269313.0.0000.5320). Data availability: M. tuberculosis genome data were deposited in the NCBI BioProject database (IDs: PRJNA535343, PRJNA639713 and PRJNA692642). Individual accession numbers for genomes analysed in this study are given in the online supplementary material. Publisher Copyright: © 2021 Elsevier Ltd Genomic-based surveillance on the occurrence of drug resistance and its transmission dynamics has emerged as a powerful tool for the control of tuberculosis (TB). A whole-genome sequencing approach, phenotypic testing and clinical-epidemiological investigation were used to undertake a retrospective population-based study on drug-resistant (DR)-TB in Rio Grande do Sul, the largest state in Southern Brazil. The analysis included 305 resistant Mycobacterium tuberculosis strains sampled statewide from 2011 to 2014, and covered 75.7% of all DR-TB cases identified in this period. Lineage 4 was found to be predominant (99.3%), with high sublineage-level diversity composed mainly of 4.3.4.2 [Latin American and Mediterranean (LAM)/RD174], 4.3.3 (LAM/RD115) and 4.1.2.1 (Haarlem/RD182) sublineages. Genomic diversity was also reflected in resistance of the variants to first-line drugs. A large number of distinct resistance-conferring mutations, including variants that have not been reported previously in any other setting worldwide, and 22 isoniazid-monoresistant strains with mutations described as disputed in the rpoB gene but causing rifampicin resistance generally missed by automated phenotypic tests as BACTEC MGIT. Using a cut-off of five single nucleotide polymorphisms, the estimated recent transmission rate was 55.1%, with 168 strains grouped into 28 genomic clusters. The most worrying fact concerns multi-drug-resistant (MDR) strains, of which 73.4% were clustered. Different resistance profiles and acquisition of novel mutations intraclusters revealed important amplification of resistance in the region. This study described the diversity of M. tuberculosis strains, the basis of drug resistance, and ongoing transmission dynamics across the largest state in Southern Brazil, stressing the urgent need for MDR-TB transmission control state-wide. publishersversion published

Introduction. Tuberculosis (TB) control is a challenge, especially in vulnerable populations, such as prisoners. Hypothesis. In prison houses, the transmission of micro-organisms that cause infectious diseases can occur due to the susceptibility and immune compromise of prisoners, and due to the precarious physical conditions of the prison houses. However, strategies such as monitoring by health professionals, can mitigate the transmission of these micro-organisms, as well as, reduce the number of coinfections and antimicrobials resistance. Aim. This study attempted to analyse the dynamics of transmission and the antimicrobial resistance profile of Mycobacterium tuberculosis strains obtained from prisoners and to characterize the epidemiological, clinical and laboratory profiles of prisoners diagnosed with TB. Methodology. A cross-sectional and retrospective study was conducted with sputum samples collected from 228 distinct prisoners who were treated at the Health Unit located in the Regional Penitentiary of Rio Grande, Rio Grande do Sul, Brazil. The antimicrobial resistance profile of the strains was evaluated using the Resazurin Microtiter Assay and the transmission dynamics was investigated using 15-loci MIRU-VNTR. Results. Thirty-five patients (15.4 %) were diagnosed with TB, and when a TB/HIV coinfection was assessed, 8.6 % (3/35) of the patients were positive. In addition, all patients with results available for HBV, HCV, syphilis and diabetes mellitus were negative. Based on the genotypic profile, 55.9 % of the clinical isolates were grouped into five groups. One isolate with mono-resistance to isoniazid and two with mono-resistance to streptomycin were found. Conclusion. The presence of a Health Unit may have influenced the low numbers of TB/HIV, TB/HBV, TB/HCV, TB/syphilis coinfections and TB cases resistant to antimicrobials. Recent M. tuberculosis transmission can be inferred based on the high percentage of formatting of clusters. This situation stresses the need to improve active and passive detection, the screening of individuals for TB upon entrance into prison for early detection, and the implementation of prophylactic measures to reduce M. tuberculosis transmission.

Here we described phenotypical, molecular and epidemiological features of a highly rifampicin-resistant Mycobacterium tuberculosis strain emerging in Southern Brazil, that carries an uncommon insertion of 12 nucleotides at the codon 435 in the rpoB gene. Employing a whole-genome sequencing-based study on drug-resistant Mycobacterium tuberculosis strains, we identified this emergent strain in 16 (9.19%) from 174 rifampicin-resistant clinical strains included. Nine of these 16 strains were available to minimum inhibitory concentration determination and for all of them was found a high rifampicin-resistance level (≥ to 32 mg/L). This high resistance level could be explained by structural changes into the RIF binding site of RNA polymerase caused by the insertions, and consequent low-affinity interaction with rifampicin complex confirmed through protein modeling and molecular docking simulations. Epidemiological investigation showed that most of the individuals (56.25%) infected by the studied strains were prison inmate individuals or that spent some time in prison. The phylogenomic approach revealed that all strains carrying on the 12 nucleotide insertion belonged to the same genomic cluster, evidencing a communal transmission chain involving inmate individuals and community. We stress the importance of tuberculosis genomic surveillance and the introduction of measures to interrupt the Mycobacterium tuberculosis transmission chain in this region.

This research was funded by MINAS GERAIS STATE RESEARCH SUPPORT FOUNDATION (FAPEMIG), grants numbers 65/10 and CDS-APQ-03266-13, and by NATIONAL COUNCIL FOR SCIENTIFIC AND TECHNOLOGICAL DEVELOPMENT (CNPQ) grants numbers 310174/2014-7 and 446796/2014-0. Federal University of Minas Gerais. Faculty of Medicine. Mycobacteria Research Laboratory. Belo Horizonte, MG, Brazil. Federal University of Minas Gerais. Faculty of Medicine. Mycobacteria Research Laboratory. Belo Horizonte, MG, Brazil. Federal University of Minas Gerais. Faculty of Medicine. Mycobacteria Research Laboratory. Belo Horizonte, MG, Brazil. Federal University of Minas Gerais. Faculty of Medicine. Mycobacteria Research Laboratory. Belo Horizonte, MG, Brazil. Federal University of Minas Gerais. Faculty of Pharmacy. Department of Social Pharmacy. Belo Horizonte, MG, Brazil. Federal University of Minas Gerais. Veterinary School. Department of Preventive Veterinary Medicine. Belo Horizonte, MG, Brazil. Federal University of Rio Grande. Faculty of Medicine. Laboratory of Mycobacteria. Rio Grande, RS, Brazil. Federal University of Rio Grande. Faculty of Medicine. Laboratory of Mycobacteria. Rio Grande, RS, Brazil. Federal University of Rio Grande. Faculty of Medicine. Laboratory of Mycobacteria. Rio Grande, RS, Brazil. Minist?rio da Sa?de. Secretaria de Vigil?ncia em Sa?de. Instituto Evandro Chagas. Ananindeua, PA, Brasil. Tropical Medicine Foundation Dr. Heitor Vieira Dourado. Manaus, AM, Brazil. Tropical Medicine Foundation Dr. Heitor Vieira Dourado. Manaus, AM, Brazil. Federal University of Rio de Janeiro. Institute of Chest Diseases. Clementino Fraga Filho University Hospital. Rio de Janeiro, RJ, Brazil. Federal University of Rio de Janeiro. Institute of Chest Diseases. Clementino Fraga Filho University Hospital. Rio de Janeiro, RJ, Brazil. Federal University of Grande Dourados. Faculty of Health Sciences. Dourados, MS, Brazil / Oswaldo Cruz Foundation. Campo Grande, Mato Grosso do Sul, MS, Brazil. Adolfo Lutz Institute. Bacteriology Center. Tuberculosis and Mycobacteriosis Center. S?o Paulo, SP, Brazil. Adolfo Lutz Institute. Bacteriology Center. Tuberculosis and Mycobacteriosis Center. S?o Paulo, SP, Brazil. Adolfo Lutz Institute. Bacteriology Center. Tuberculosis and Mycobacteriosis Center. S?o Paulo, SP, Brazil. State Secretariat of Health of Rio Grande do Sul. State Center for Health Surveillance. Center for Scientific and Technological Development. Porto Alegre, RS, Brazil. State Secretariat of Health of Rio Grande do Sul. State Center for Health Surveillance. Center for Scientific and Technological Development. Porto Alegre, RS, Brazil. Oswaldo Cruz Foundation. National Institute of Infectology Evandro Chagas. Laboratory of Bacteriology and Bioassays of Rio de Janeiro. Rio de Janeiro, RJ, Brazil. Sergio Arouca National Public Health School. Professor H?lio Fraga Reference Center. Rio de Janeiro, RJ, Brazil. Sergio Arouca National Public Health School. Professor H?lio Fraga Reference Center. Rio de Janeiro, RJ, Brazil. Nova University of Lisbon. Institute of Hygiene and Tropical Medicine. Medical Microbiology Unit, Global Health and Tropical Medicine. Lisboa, Portugal. Nova University of Lisbon. Institute of Hygiene and Tropical Medicine. Medical Microbiology Unit, Global Health and Tropical Medicine. Lisboa, Portugal. Federal University of Rio de Janeiro. Faculty of Medicine. Tuberculosis Research Center. Rio de Janeiro, RJ, Brazil. Background: The Commercial Kit SIRE Nitratase? PlastLabor, is a drug susceptibility test kit used to detect Mycobacterium tuberculosis resistance to first-line TB treatment drugs. The present study aimed at evaluating its performance in a multicenter study. (2) Methods: To determine its accuracy, the proportion methods in Lowenstein Jensen medium or the BACTECTMMGITTM960 system was used as a gold standard. (3) Results: The study revealed that the respective accuracies of the kit with 190 M. tuberculosis clinical isolates, using the proportion methods in Lowenstein Jensen medium or BACTECTMMGITTM960 system as a gold standard, were 93.9% and 94.6%, 96.9% and 94.6%, 98.0% and 97.8%, and 98.0% and 98.9%, for streptomycin, isoniazid, rifampicin, and ethambutol, respectively. (4) Conclusion: Thus, the kit can rapidly screen resistance to streptomycin, isoniazid, rifampicin, and ethambutol. Additionally, it does not require sophisticated equipment; hence, it can be easily used in the laboratories of low and middle income countries.

Introduction. The increased production of new drugs is parallel with the bacterial adaptation to adverse conditions. There are several factors that have been pointed out as the cause of this, such as: globalization; the abusive use of antibiotics; and the arbitrary prescription of these drugs. Therefore, the objective of the present study was to evaluate antimicrobial usage with antibiotic resistance in 2012 and 2013 at a university hospital in Southern Brazil. Material and Methods. This study was performed at the University Hospital Dr. Miguel Riet Correa Jr. in Rio Grande/RS, Brazil. The data were collected between January 2012 and December 2013, using data from the medical clinic and two intensive care units. Results. Were observed, 385 and 464 cases of bacterial infections, during the years of 2012 and 2013, respectively. Acinetobacter baumannii, Escherichia coli and Klebsiella pneumoniae were the most prevalent species. The total antibiotic consumption in the University Hospital (HU-FURG) in this period was 3.865 units/dose, with 1.995 units/dose in the year 2012 and 1.870 units/dose in the year 2013. Relationships between the rates of main resistant pathogens isolated and the annual consumption of the corresponding antibiotic (carbapenems, cephalosporins, sulfonamides and other β-lactams) were observed; however, they did not show significant positive associations in increased resistance associated with increased consumption. Conclusion. This study reveals the need for the dissemination and feedback of these data to clinicians and decision-makers at the hospital, as it may be crucial to improve policies on prescribing antibiotics and to implement effective infection control. Introducción. El aumento en la producción de nuevos medicamentos surge en paralelo con la adaptación bacteriana a las condiciones adversas. Hay varios factores que se han identificado como la causa de esta afección, como: globalización, abuso de antibióticos y prescripción arbitraria de estos medicamentos. Por lo tanto, el objetivo del presente estudio fue evaluar el uso de antimicrobianos con resistencia a los antibióticos en 2012 y 2013 en un hospital universitario en el Sur de Brasil. Material y métodos. Este estudio se realizó en el Hospital Universitario Dr. Miguel Riet Correa Jr. en Rio Grande / RS, Brasil. Los datos se recopilaron entre enero de 2012 y diciembre de 2013, en la clínica médica y dos unidades de cuidados intensivos. Resultados. Se observaron 385 y 464 casos de infecciones bacterianas durante los años 2012 y 2013, respectivamente. Acinetobacter baumannii, Escherichia coli y Klebsiella pneumoniae fueron las especies más prevalentes. El consumo total de antibióticos en el Hospital Universitario (HU-FURG), en este período, fue de 3,865 unidades / dosis, siendo 1,995 unidades / dosis en 2012 y 1,870 unidades / dosis en 2013. La relación entre las tasas de los principales patógenos resistentes aislado y se observó el consumo anual del antibiótico correspondiente (carbapenémicos, cefalosporinas, sulfonamidas y otras β-lactamas); Sin embargo, no hubo una asociación significativa entre el aumento de la resistencia y el consumo. Conclusión. Este estudio revela la necesidad de difundir y devolver estos datos a los médicos y tomadores de decisiones en el hospital, ya que puede ser crucial para mejorar las políticas en la prescripción de antibióticos y en la implementación de un control efectivo de infecciones. Introdução. O aumento da produção de novas drogas emerge paralelamente com a adaptação bacteriana a condições adversas. Existem diversos fatores que tem sido apontados como causa desta condição tais como: globalização, uso abusivo de antibióticos, e a prescrição arbitrátia destas drogas. Com isso, o objetivo do estudo foi avaliar o uso de antimicrobianos com a antibiótico-resistência em 2012 e 2013 em um Hospital Universitario do Sul do Brasil. Material e métodos. Este estudo foi realiado no Hospital Universitário Dr. Miguel Riet Correa Jr. em Rio Grande/RS, Brasil. Os dados foram coletados entre Janeiro de 2012 e Dezembro de 2013, na clínica médica e duas unidades de tratamento intensivo. Resultados. Observou-se 385 e 464 casos de infecções bacterianas, durante os anos de 2012 e 2013, respectivamente. Acinetobacter baumannii, Escherichia coli e Klebsiella pneumoniae foram as espécies mais prevalentes. O consumo total de antibióticos no Hospital Universidtário (HU-FURG), neste período, foi de 3.865 unidades/doses, sendo 1.995 unidades/dose em 2012 e 1.870 unidades/dose no ano de 2013. A relação entre as taxas dos principais patógenos resistentes isolados e o consumo anual do antibioticoa correspondentea (carbapenêmicos, cefalosporinas, sulfonamidas e outros β-lactâmicos) foi observada; entretanto, não mostrou associação significativa entre o aumento da resistência e o consumo. Conclusão. Este estudo revela a necessidade de disseminação e retorno destes dados para os clínicos e tomadores de decisão no hospital, pois pode ser crucial o melhoramento de politicas na prescrição de antibiotiocs e na implementação de um crontrole eficaz das infecções..

INTRODUCTION: Previous studies that detected Paracoccidioides spp. DNA in soil taken from rural areas have shown this to be a valuable tool for ecological and epidemiological studies. This study reports the detection of Paracoccidioides spp. DNA in soil samples from an urban area of southern Brazil. METHODS: Sixteen soil samples were submitted to nested-PCR and the amplicons of a representative number of positive samples were sequenced. RESULTS: Paracoccidioides spp. DNA was found in 44% of samples. Four DNA amplicons were sequenced, showing 100% homology with P. brasiliensis. CONCLUSIONS: The southern Brazilian urban population is commonly exposed to the Paracoccidioides fungus.

Objectives The aims of this study were (i) to determine the frequency of plasmid-mediated resistance to fluoroquinolones (FQs) in Escherichia coli isolated from patients with urinary tract infections (UTIs) of nosocomial and community origin and (ii) to determine the relationships between the presence of extended-spectrum β-lactamases (ESBLs), mutations in the gyrA and parC genes, and resistance to FQs. Methods A total of 71 E. coli isolates, including 38 ESBL-producers and 33 non-ESBL-producers, were analysed. The aac(6′)-Ib gene was amplified using PCR and was subsequently digested with the BtsCI restriction enzyme to identify aac(6′)-Ib-cr, a variant associated with FQ resistance. Detection of qnr genes was performed by multiplex PCR. In isolates that tested positive for these genes, the gyrA and parC genes were sequenced and the modulation factor of an efflux pump inhibitor was determined on the minimum inhibitory concentration (MIC) of norfloxacin. Results The frequencies of qnrS, qnrB and qnrA were 4.2%, 2.8% and 0%, respectively. The frequency of aac(6′)-Ib-cr was 40.8% and this variant was associated with double mutations in gyrA and parC as well as resistance to FQs and ESBL production. Modulation of efflux pump activity was more frequent in resistant isolates that had a wild-type parC gene. Conclusion An interplay of resistance mechanisms increased the level of resistance to FQs, and the high frequency of putative plasmid-mediated quinolone resistance genes associated with ESBL-producing isolates reduced therapeutic options to treat UTIs in the affected population.

The objectives of this study were to evaluate tetrahydropyridine derivatives as efflux inhibitors and to understand the mechanism of action of the compounds by in silico studies. Minimum inhibitory concentration (MIC) determination, fluorometric methods and docking simulations were performed. The compounds NUNL02, NUNL09 and NUNL10 inhibited efflux, and NUNL02 is very likely a substrate of the transporter protein AcrB. Docking studies suggested that the mechanism of action could be by competition with substrate for binding sites and protein residues. We showed for the first time the potential of tetrahydropyridines as efflux inhibitors and highlighted compound NUNL02 as an AcrB-specific inhibitor. Docking studies suggested that competition is the putative mechanism of action of these compounds.

Introduction. Nosocomial transmission of Mycobacterium tuberculosis is an important health issue and the detection of tuberculosis (TB) cases is the main tool for controlling this disease. Aim. We aimed to assess the possible occurrence of nosocomial transmission of M. tuberculosis in a reference hospital for HIV/AIDS patients and evaluate both the performance of the Xpert MTB/RIF (Xpert) platform and drug resistance profiles. Methodology. We evaluated the performance of the Xpert platform. Samples that tested positive on the BACTEC MGIT 320 (MGIT320) platform were submitted for genotyping and drug susceptibility testing. Results. In this study, pulmonary and extrapulmonary samples from 407 patients were evaluated, and among these, 15.5 % were diagnosed with TB by the MGIT320 platform, with a TB/HIV coinfection rate of 52.4 %. The Xpert platform gave positive results for TB for 11 samples with negative results on the MGIT320 platform. In the genotyping results, 53.3 % of the strains clustered; of these strains, half were in two of the four clusters formed, and the patients had visited the hospital on the same day. Drug resistance was observed in 11.7 % of the strains. Conclusion. Putative nosocomial transmission of M. tuberculosis was detected, showing that genotyping is a powerful approach for understanding the dynamics of M. tuberculosis transmission, especially in a high-burden TB and HIV landscape.

The basis of drug resistance in Mycobacterium abscessus is still poorly understood. Nevertheless, as seen in other microorganisms, the efflux of antimicrobials may also play a role in M. abscessus drug resistance. Here, we investigated the role of efflux pumps in clarithromycin resistance using nine clinical isolates of M. abscessus complex belonging to the T28 erm(41) sequevar responsible for the inducible resistance to clarithromycin. The strains were characterized by drug susceptibility testing in the presence/absence of the efflux inhibitor verapamil and by genetic analysis of drug-resistance-associated genes. Efflux activity was quantified by real-time fluorometry. Efflux pump gene expression was studied by RT-qPCR upon exposure to clarithromycin. Verapamil increased the susceptibility to clarithromycin from 4- to &ge, 64-fold. The efflux pump genes MAB_3142 and MAB_1409 were found consistently overexpressed. The results obtained demonstrate that the T28 erm(41) polymorphism is not the sole cause of the inducible clarithromycin resistance in M. abscessus subsp. abscessus or bolletii with efflux activity providing a strong contribution to clarithromycin resistance. These data highlight the need for further studies on M. abscessus efflux response to antimicrobial stress in order to implement more effective therapeutic regimens and guidance in the development of new drugs against these bacteria.

Introduction: Considering that Group B Streptococcus (GBS) persists as an important cause of neonatal morbidity and mortality, the objective of this study was to evaluate the frequency of maternal colonization by GBS, comparing the culture by the Granada broth with the GeneXpert real-time PCR diagnostic methods and the impact of chemoprophylaxis in high-risk pregnant women. Methodology: A prospective cohort of 110 pregnant women hospitalized for gestational complications was formed and recruited following interview and collection of rectovaginal swabs. Results: The frequency of maternal colonization was 28.2% and statistically associated with Capurro> 37 weeks (p = 0.030) and neonatal infection (p = 0.008). Chemoprophylaxis was offered to 80% of those colonized. Among the pregnant women treated, a fivefold reduction in the rate of prematurity and rate of neonatal infection was observed. The sensitivity was 76.6% and 86.6% in culture and PCR, respectively, with an optimal index of agreement between the methods (K = 0.877). Grenade culture was considered an easy and low-cost method, while GeneXpert presented higher cost and error rate of 10%. However, 23.3% of the pregnant women were diagnosed exclusively by GeneXpert and the results were obtained in two hours. Conclusions: This study showed a significant prevalence of maternal colonization for GBS and that both culture and molecular methods had peculiarities that allow different applicability, with the culture being feasible for antenatal screening and in the hospital for high-risk pregnant women with no sign of imminent delivery and GeneXpert being prioritized for situations of preterm birth.

Supplementary data are available at MMYCOL online. Aspergillosis is a respiratory fungal disease of importance in captive marine birds. The aim of this study was to describe the occurrence of aspergillosis in Thalassarche melanophris during rehabilitation events and to identify the etiological agent. All the albatrosses that were received for rehabilitation and died within a 2-year period were included in the study. The proportionate mortality rate caused by aspergillosis was 21.4% (3/14). One of the etiological agents was Aspergillus flavus/oryzae lineage, and the other was A. fumigatus sensu stricto. Our study suggests that aspergillosis can act as a limiting factor in the rehabilitation of albatrosses. This study was supported by the International Cooperation Program financed by Brazilian Federal Agency for Support and Evaluation of Graduate Education within the Ministry of Education of Brazil (CAPES), under the Capes-Print Program and PDSE Program - Finance Code 001. info:eu-repo/semantics/publishedVersion

Background and Objectives: Helicobacter pylori is linked to gastroduodenal pathologies. To determine the frequency and potential risk factors of the H. pylori infection. Material and methods: A cross-sectional study was conducted, including 227 patients, submitted to upper gastrointestinal endoscopy. A questionnaire was applied to the patients, before endoscopy. The biopsy specimens were obtained from the antrum and gastric body for histology and PCR. The chi-square test was used for the categorical data analysis. P-values 0.05). However, we observed a significant association between the number of persons per household and presence of H. pylori (p=0.04). A statistically significant relation also was found between H. pylori and the patient’s age (p=0.04) and between the histological and endoscopic diagnoses and the H. pylori infection (p≤0.01). Conclusions: We found a significant relation between household crowding and presence of H. pylori, which seems facilitate the person-to-person transmission H. pylori within families. Our results also suggest a cohort phenomenon. The increase in the frequency of H. pylori infection according to age may be due the acquisition of bacterium predominantly in childhood, when the sanitary conditions were deficient, and not during adulthood. Once acquired and untreated, the persistent H. pylori infection might have led to the development of severe gastroduodenal diseases.

Objectives This study aimed to evaluate a tetrahydropyridine derivative (THP) as a potential inhibitor of the efflux mechanism and modulator of the high level of antimicrobial resistance usually observed in members of the Mycobacterium abscessus (M. abscessus) group. Methods The strain M. abscessus subsp. abscessus (ATCC 19997) was used as reference, in addition to three clinical isolates: M. abscessus subsp. abscessus (AT 07), and two M. abscessus subsp. bolletii (AT 46 and AT 52). The minimum inhibitory concentration (MIC) of amikacin (AMI), ciprofloxacin (CIP), clarithromycin (CLA), verapamil (VP), and THP derivative (NUNL02) was determined. Results The NUNL02 showed activity against M. abscessus; the MIC of AMI against ATCC 19997 was reduced more than 16-fold, and the MIC of CIP against AT 52 was reduced four-fold. When combined with CLA, the MIC was reduced against all tested strains. In addition, to detect and quantify the activity of the efflux mechanism, the intracellular accumulation kinetics of the fluorometric substrate ethidium bromide in the presence and absence of VP and NUNL02 were evaluated. The NUNL02 was found to be a more effective efflux inhibitor than VP, which is the classical inhibitor. Conclusions The tetrahydropyridine derivative, NUNL02, is a promising adjuvant in the treatment of infections caused by M. abscessus.