Search

In this study, the safety and functionality of using citrus juice processing waste (CJPW) was confirmed. Large quantities of CJPW are generated on Jeju Island and cause environmental problems. CJPW extract (2,000 mg/kg) was administered intragastrically to male and female Sprague-Dawley (SD) rats for 14 days and the rats were analyzed. No general signs of toxicity were observed in SD rats administered CJPW extract. Feed intake did not differ between experimental and control animals. However, male and female rats administered CJPW extract had greater weight gain (102.9±5.53% and 114.15±6.89%, respectively) compared with the control animals. Higher weight gain was found in male and female experimental animals, but the difference was only significant in female animals. Serum analyses indicated that total protein and albumin, indicators of nutritional status, were significantly increased in animals administered CJPW. Further, serum glucose values were lower in male and female rats treated with CJPW (91.6±9.02% and 69.9±4.11%, respectively) compared with the controls; again, the difference was significant only for female animals. From the results of this study, CJPW can be considered as a safe material that does not induce toxicity in experimental animals. Therefore, CJPW is a potential raw material that can be used as a supplement in animal feed to help improve weight gain and achieve serum glucose con-trol.

This study investigated the safety and functionality of a functional additive for humans and animals from Sargassum horneri (SH) and Ulva australis (UA) waste for recycling marine refuse generated in large quantities in Jeju. Sprague-Dawley rats were orally administered functional additives at 2,000 mg/kg to assess 14-day repeated dose toxicity of the two extracts. For female rats, weight gain after administration of SH was 66.2±18.8% vs. controls. Male rats administered UA showed weight gain of 92.3±8.0% vs. controls. SH and UA significantly decreased serum glucose levels in male rats compared with controls (79.8±11.10% and 76.1±9.67%, respectively). Similarly, significant decrease in serum glucose levels were shown for female rats after administration of SH and UA (79.2±1.58% and 82.8±3.21%, respectively). Furthermore, rats showed significant differences vs. controls in several serological parameters after receiving extracts, however results remained within the normal range. Thus, the SH and UA extracts were considered safe substances that may be used as functional additives to help reduce body weight and serum glucose.

Background/aim Lapathoside A, a phenylpropanoid ester, was isolated from the roots of buckwheat by searching for bioactive compounds against human pancreatic cancer cells. Materials and methods Buckwheat root extracts, prepared by 70% ethanol, were separated into n-hexane, methylene chloride, ethyl acetate, n-butanol, and water fraction by solvent partitioning. Seven fractions were obtained from the ethyl acetate fraction by liquid chromatography, and fraction No. 6 contained lapathoside A. The effects of lapathoside A on Panc-1 and SNU-213 human pancreatic cancer cell lines were examined. Results The structure of lapathoside A was determined by liquid chromatography-mass spectrometry, liquid chromatography-tandem mass spectrometry, and nuclear magnetic resonance analysis. Next, we investigated whether lapathoside A has anticancer activity in human pancreatic cancer cell lines (PANC-1 and SNU-213). After treatment with 25 μM lapathoside A, viability of PANC-1 and SNU-213 cells decreased to about 40 and 27%, respectively. In addition, lapathoside A treatment also increased apoptosis while affecting the expression levels of apoptotic proteins. Conclusion The effect of lapathoside A on apoptosis was confirmed in pancreatic cancer cell lines, supporting the application of lapathoside A in the treatment of pancreatic cancer.

Green mandarins are widely consumed unripe as mandarin oranges (Citrus unshiu Marcov.), which exhibit anti-inflammatory and anti-wrinkle effects by inhibiting the production of inflammatory cytokines and matrix metalloproteinase. A randomized, double-blind, placebo-controlled clinical study was performed to verify the skin improvement efficacy and safety of green mandarin extract (PTE). For the standardization of PTE, narirutin was set as a marker compound, and PTE with a constant narirutin content was prepared for the study. After randomizing subjects with periorbital wrinkles, they were orally administered PTE (300 mg/day) or a placebo for 12 weeks. Periorbital wrinkles were measured using PRIMOSCR SF. Skin elasticity, moisture content, transepidermal water loss, and gloss were also measured. In the study results, the depth, volume, and skin roughness of the periorbital wrinkles were significantly improved compared to the control group (p = 0.011, 0.009, and 0.004, respectively). The survey confirmed that the skin condition improved after PTE consumption for 12 weeks. No adverse reactions associated with PTE were observed during the study period. Thus, the results demonstrate that PTE effectively improves UV-induced skin wrinkles. Therefore, it is considered that PTE has sufficient value as a functional food ingredient that can prevent skin aging.

Background/aim No effective therapeutics have yet been developed for pancreatic cancer. 2-Methoxy-4-vinyl phenol (2M4VP), a member of the class of phenols, has been demonstrated to have anti-inflammatory properties and cause cell cycle arrest making it an attractive candidate drug for the treatment of pancreatic cancer. Materials and methods The effects of 2M4VP were examined in Panc-1 and SNU-213 human pancreatic cancer cells. Results 2M4VP had anticancer effects on pancreatic cancer cell lines, Panc-1 and SNU-213. 2M4VP reduced the viability of Panc-1 cells by inhibiting the expression of the cell nuclear antigen (PCNA) protein. 2M4VP also suppressed the migratory activity of both cell lines. In addition, treatment with 2M4VP effectively decreased the phosphorylation of Focal Adhesion Kinase (FAK) and AKT. Conclusion 2M4VP might be used as a pancreatic cancer treatment supplement.

The complete mitochondrial (mt) genome of Stereolepis doederleini was sequenced from a specimen collected in a commercial aquarium in Jeju Island. The sequence was 16,513 base pairs in length and, similar to other vertebrate mt genomes, included 37 mt genes and a noncoding control region; the gene order was identical to that of typical vertebrate mt genome. Mitochondrial genome sequences of 17 species from 12 families were used to reconstruct phylogenetic relationships within the order Pempheriformes. The phylogenetic trees were constructed with three methods (neighbor joining [NJ], maximum likelihood [ML], and Bayesian method) using 12 protein coding genes, but not ND6. In all phylogenetic trees, Pempheriformes were clustered into three strongly supported clades. Two Acropomatidae species (Synagrops japonicus in clade-Ⅰ and Doederleinia berycoides in clade-Ⅲ) were polyphyletic; S. japonicus was close to Lateolabracidae and was the sister of Glaucosomatidae + (Pempheridae/(Percophidae+Creediidae)), and D. berycoides was sister to Howellidae + Epigonidae. All phylogenetic trees supported a sister relationship between Creediidae and Percophidae in clade-Ⅰ. Glaucosomatidae formed a sister clade with Pempheridae. The relationships within clade-Ⅱ, which was composed of four families (Pentacerotidae, Polyprionidae, Banjosidae, and Bathyclupeidae), slightly differed between NJ/ML and BI tree topologies. In clade-Ⅲ, the relationships among Howellidae, Epigonidae, and Acropomatidae were strongly supported.

Lapathoside A, a phenylpropanoid ester, was isolated from the roots of buckwheat by searching for bioactive compounds against human pancreatic cancer cells.Buckwheat root extracts, prepared by 70% ethanol, were separated into n-hexane, methylene chloride, ethyl acetate, n-butanol, and water fraction by solvent partitioning. Seven fractions were obtained from the ethyl acetate fraction by liquid chromatography, and fraction No. 6 contained lapathoside A. The effects of lapathoside A on Panc-1 and SNU-213 human pancreatic cancer cell lines were examined.The structure of lapathoside A was determined by liquid chromatography-mass spectrometry, liquid chromatography-tandem mass spectrometry, and nuclear magnetic resonance analysis. Next, we investigated whether lapathoside A has anticancer activity in human pancreatic cancer cell lines (PANC-1 and SNU-213). After treatment with 25 μM lapathoside A, viability of PANC-1 and SNU-213 cells decreased to about 40 and 27%, respectively. In addition, lapathoside A treatment also increased apoptosis while affecting the expression levels of apoptotic proteins.The effect of lapathoside A on apoptosis was confirmed in pancreatic cancer cell lines, supporting the application of lapathoside A in the treatment of pancreatic cancer.

This study determined the anti-obesity effect of Crinum asiaticum var. japonicum Baker extract (CAE) on adipocytes and obese mice. The inhibitory effects of CAE on adipocyte differentiation and adipogenesis were determined using differentiation induction medium in 3T3-L1 cells. To get an insight into underlying molecular actions of CAE, we investigated the changes in the expression levels of genes involved in lipogenesis by CAE treatment using qRT-PCR. CAE strongly suppressed adipocyte differentiation through downregulation of PPARγ, C/EBPα, C/EBP β, and aP2. CAE treatment could also suppress the expression levels of ACC, FAS, LPL and HMGCR gene in 3T3-L1 cells. Male C57BL/6 strain and C57BL/6J-ob/ob strain mice were fed with HFD containing 60% fat and normal diet in the presence or absence of 25, 50, and 100mg/kg CAE for 7 weeks. CAE supplementation could highly suppress the body weight gain and epididymal fat accumulation without changes in food uptake in both obese models. Increases in total cholesterol, LDL-cholesterol and triglyceride were highly suppressed in the presence of CAE. In summary, CAE has an anti-obesity effect and this anti-obesity potential might be associated with downregulation of genes involved in adipocyte differentiation and lipogenesis.

600여 종의 제주 천연 추출물을 이용하여 항산화 효과를 스크린한 결과, 조록나무 잎 추출물이 가장 높은 항산화 효과를 나타내었다. 조록나무는 조록나무과에 속하는 상록 나무로써 제주 천연자원이다. 본 연구에서는 극성이 다른 유기용매(헥산, 메틸렌 클로라이드, 에틸 아세테이트, 부탄올, 물)로 순차적으로 분획 한 조록나무물질 5가지를 이용하여 항산화 효과 및 간세포와 폐세포를 이용하여 세포 보호능을 확인하였다. 에틸 아세테이트 분획물질은 0.5mg/mL에서 약93%로 가장 우수한 DPPH 라디칼 소거능을 보이며 양성 대조군으로 사용한 quercetin 보다 높은 효능을 보였다. 총 페놀 함량을 확인 한 결과, 에틸 아세테이트 분획물질은 505 mg GAE/g로 가장 높은 총 페놀 함량을 보였으며, 모든 추출물에서 DPPH 라디칼 소거능과 연관성 있는 결과를 보였다. 또한 에틸 아세테이트 분획물질은 H2O2에 대한 산화적 스트레스로부터 다른 분획 물질보다 높은 세포보호효과를 나타내었다. 본 연구를 통해 조록나무의 에틸 아세테이트 분획물질의 높은 항산화 효과를 확인하였으며, 천연 항산화 소재의 가능성이 높을 것으로 사료된다.

A sex-linked random amplified polymorphic DNA (RAPD) marker was identified from Asparagus officinalis L. and was converted into a sequence-characterized amplified regions (SCAR) marker for the large-scale screening of male and female plants. A total of 100 arbitrary decamer oligonucleotide primers were used for the RAPD analysis. Among them, the primer UBC347 amplified one female-specific 400 base pair DNA. Subsequently, the amplified RAPD fragment was cloned and sequenced. The fragment was abundant in AT and shared sequence homology with retrotransposon elements. On the basis of the sequence obtained, a pair of SCAR primer was designed. The amplification product, named F400, was the same size as the respective RAPD fragment from which it was derived. The F400 SCAR marker resulted to be female-specific in the three asparagus varieties tested in this study. This SCAR marker can be used for an early and rapid identification of female and male plants during breeding programs of asparagus.

In this study, we investigate a plant commonly used in herbal medicines, Lycopodium serratum , which is believed to have anti-cancer properties. An alcoholic extract of L. serratum (LSE) was investigated for its ability to induce apoptosis in cultured human promyelocytic leukemia HL-60 cells. Treatment of HL-60 cells with various concentrations of LSE (6–100 μg/mL) resulted in a sequence of events characteristic of apoptosis, including loss of cell viability, morphological changes, and increased sub-G 1 DNA content. Serratenediol (SE), a known biologically active agent, was isolated from MC fraction of LSE and was able to demonstrate significant and dose-dependent growth inhibitory effects on HL-60 cells. Similar to the effects observed with the crude LSE, the SE-related effects included the formation of apoptotic bodies and fragmented DNA, as well as the accumulation of DNA in the sub-G 1 phase of the cell cycle. Analysis of the mechanism of these events indicated that SE treated cells had an increased ratio of Bax/Bcl-xL, released the cytochrome c , activated caspase-9, -3, and cleaved poly-ADP-ribose polymerase (PARP); these observations are hallmarks of apoptotic events. Thus, the results suggest that SE can induce apoptosis via regulating the ratio of Bax/Bcl-xL in HL-60 cell lines.

Background: Inguinal hernia repair is a common surgical intervention in the elderly. The aim of this study was to describe the clinical characteristics and treatment outcomes in patients over 80 years of age undergoing inguinal hernia repairs. Methods: We retrospectively reviewed the medical records of 150 patients older than 65 years of age who had undergone an inguinal hernia repair between January 2006 and December 2010. Dividing our subjects by age into two groups, 65 to 79 years and 80 years and older, we compared their clinical features and surgical outcomes. Results: There were 122 patients (81.3%) in the 65 to 79 years group and 28 (18.7%) in the over 80 years group. Average body mass index was 22.8 kg/m in the 65 to 79 group and 21.8 kg/m in the over 80 group. Comorbidities were present in 63.9% of the cases in the 65 to 79 group and 67.9% in the over 80 group. American Association of Anaesthetists score was significantly higher in the over 80 group (1.6±0.3 vs. 1.9±0.3, p=0.046). Comparisons of operative time for each operative method were statistically not different. Postoperative hospital stay and analgesic use also showed no significant differences between the groups. Among the postoperative complications, wound hematoma was most prevalent in both groups but was not statistically different. There was no surgery-related mortality in either group. Conclusion: Our results indicate that inguinal hernia repair can be done safely in those older than 80 years, unless there is high surgical risk per se.

DNA extracted from ancient bones of Cervidae animals was examined to identify the species and to determine the phylogenetic relationships to those from extant cervids. Abundant ancient bones were excavated from Kumsung archaeological site in Jeju Island, Korea, and were identified as Cervidae animals based on morphological features of their antlers and lower mandibles. Their mitochondrial DNA (mtDNA) control region (CR) was partially sequenced and subsequently compared with those previously reported in database. The results confirmed that the ancient sequences are lineage of Cervidae. On the phylogenetic trees constructed using the sequence diversity of the CR sequences of family Cervidae, the ancient DNA sequences were found on distinct clusters. The ancient sequences were located in the subfamily Capreolinae cluster, and six ancient sequences were closely related to those of extant Korean roe deer in Jeju Island and Korean Peninsula. Consequently, the results of this study suggest that the roe ...

The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea.

Osteoarthritis (OA) is a degenerative chronic disease that affects various tissues surrounding the joints, such as the subchondral bone and articular cartilage. The onset of OA is associated with uncontrolled catabolic and anabolic remodeling processes of the joints, including the cartilage and subchondral bone, to adapt to local biological and biochemical signals. In this study, we determined whether 70% ethanolic (EtOH) extract of Litsea japonica fruit (LJFE) had beneficial effects on the articular cartilage, including structural changes in the tibial subchondral bone, matrix degradation, and inflammatory responses, in OA by using a rat model of monosodium iodoacetate-induced OA. Our results showed that administration of LJFE increased the bone volume and cross-section thickness, but the mean number of objects per slice in this group was lower than that in the OA control (OAC) group. In addition, the LJFE decreased the expression of inflammatory cytokines. Compared to the OAC group, the group treated with high doses of LJFE (100 and 200 mg/kg) showed a more than 80% inhibition of the expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases. Our results suggest that LJFE can be used as a potential anti-osteoarthritic agent.

We measured critical current densities (Jcb) at a [001]-tilt grain boundary (GB) of a bicrystalline Sm1Ba2Cu3O7 film under various magnetic fields (Halpha) applied obliquely. The mis-orientation angle, thetas, of the [001] tilt GB was 30deg. Halpha was varied between -0.65 KOe and +0.65 KOe. The angle, phi, between the applied fields and the film surface was varied from 0deg to 90deg. The curves of Jcb vs. Halpha at the different phi s were qualitatively explained by a simple formula suggested in [8]. The formula was expressed by multiplication of the two factors which include the effects of Hperp and Hpar. One fitting parameter, alpha, in this formula was large for the sample of thetas = 30deg in our previous paper. On the contrast, alpha for the present sample in this paper is almost zero. The absolute values of Jcb for this sample are larger than those for the previous sample by one order of magnitude. These results indicate that the parameter, alpha, closely related to the quality of GB: alpha gets smaller as the film quality at GB become better.

PURPOSE The aim of this study was to evaluate the clinical significance of perineal descent (PD) in pelvic outlet obstruction patients diagnosed by using defecography. METHODS One hundred thirty-six patients with pelvic outlet obstruction (POO; median age 49 years) had more than one biofeedback session after defecography. Demographic finding, clinical bowel symptoms and anorectal physiological studies were compared for PD at rest and PD with dynamic changes. RESULTS Age (r = 0.33; P < 0.001), rectocele diameter (r = 0.31; P < 0.01), symptoms of incontinence (P < 0.05) and number of vaginal deliveries (r = 0.46; P < 0.001) were correlated with increased fixed PD. However, the female gender (P < 0.005), rectal intussusceptions (P < 0.05), negative non-relaxing puborectalis syndrome (P < 0.00005) and rectocele (P < 0.0005) were correlated with increased dynamic PD. Duration of symptoms, number of bowel movements, history of pelvic surgery and difficult defecation were not related with PD. There was no significant correlation between fixed and dynamic PD and success of biofeedback therapy. CONCLUSION Age, vaginal delivery and diameter of the rectocele are associated with increased fixed PD. Female gender, rectal intussusceptions and a rectocele are correlated with increased dynamic PD. Biofeedback is an effective option for POO regardless of severity of PD.

We determined the complete nucleotide sequence of the mitochondrial genome for the rock bream, Oplegnathus fasciatus (Perciformes, Oplegnathidae). This mitochondrial genome, consisting of 16,511 base pairs (bp), encoded genes for 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a noncoding control region like those found in other vertebrates, with the gene order identical to that of typical vertebrates. Most of the genes of O. fasciatus were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase 8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The origin of L-strand replication in O. fasciatus was in a cluster of five tRNA genes (WANCY) and was 41 nucleotides in length. The conserved motif (5′-GCGGG-3′) was found at the base of the stem within the tRNA-Cys gene. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (835 bp) was considered to be the control region (D-loop). Within this sequence, we identified a termination-associated sequence and a conserved sequence block characteristic to this region. In most parsimony analyses, the O. fasciatus was positioned in the clade including Emmelichthyidae, Lutjanidae, Percidae, Centrarchidae, and Sparidae, with 100% bootstrap support for their divergence.

Ancient cattle bones were excavated from archaeological sites in Jeju, Korea. We used molecular genetic techniques to identify the species and establish its relationship to extant cattle breeds. Ancient DNA was extracted from four sources: a humerus (Gonae site, A.D. 700-800), two fragments of radius, and a tooth (Kwakji site, A.D. 0-900). The mitochondrial DNA (mtDNA) D-loop regions were cloned, sequenced, and compared with previously reported sequences of various cattle breeds (9 Asian, 8 European, and 3 African). The results revealed that these bones were of the breed, Bos taurus, and a phylogenetic tree indicated that the four cattle bones formed a monophyletic group with Jeju native black cattle. However, the patterns of sequence variation and reports from archaeological sites suggest that a few wild cattle, with a different maternal lineage, may have existed on Jeju Island. Our results will contribute to further studies of the origin of Jeju native cattle and the possible existence of local wild cattle.

The inheritance patterns of the chloroplast genomes of the Actinidia hybrids A. eriantha (male parent) x A. chinensis (female parent) and A. chinensis (male parent) x A. melanandra (female parent) were analyzed using single-strand conformation polymorphism (SSCP) analysis of the trnL-trnF and psbA-trnH intergenic spacers. This showed that the artificial hybrids between A. eriantha and A. chinensis all had the haplotype of their male parent. Alignment of the sequences of A. eriantha and A. chinensis revealed four substitutions and one insertion (GATTC) in trnL-trnF and two substitutions in psbA-trnH. In contrast, the haplotypes of the artificial hybrids between A. chinensis and A. melanandra had the same patterns as their female parent. Alignment of the entire region of A. chinensis and A. melanandra revealed 12 substitutions: 1 in trnL-trnF and 11 in psbA-trnH. However, no sequence variation in the trnL-trnF and psbA-trnH intergenic spacers was found. We have developed a simple screening method for detecting the inheritance patterns of Actinidia chloroplast DNA haplotypes using SSCP analysis of the trnL-trnF and psbA-trnH intergenic spacers. Our findings indicate that the inheritance of the chloroplast genome in Actinidia hybrids differs according to the species selected.

We recently encountered an interesting case of acute inferior ST segment elevation myocardial infarction (STEMI). This patient had a rare anatomic variation, single coronary artery. The right coronary artery originate from the left circumflex proper artery, not from aorta, was totally obstructed with thrombi. Though it took more time to figure out the patient’s coronary anatomy and the culprit lesion, we successfully performed primary percutaneous coronary intervention within the guideline-recommended time period. We performed left coronary angiography at the beginning. This strategy could be helpful in determining the culprit lesion and preventing unnecessary procedural delay in acute inferior STEMI.

We determined the nucleotide sequences of the hypervariable D-loop region of mitochondrial DNA (mtDNA) from horse bone (humerus, A.D. 700 to A.D. 800) that was excavated from the Kwakji archaeological site, Jeju, Korea. We compared them with ones from extant horses. We designed three pairs of oligonucleotide primers from the tRNA-Thr and tRNA-Phe gene regions of mtDNA that are highly conserved among many other animal species. We cloned 232, 336, and 644 bp from the horse bone in order to determine the mtDNA D-loop sequence. The sequence was 1,124 bp long; the middle contained 19 tandem repeats of an 8-bp sequence (TGTGCACC) that is specific to equines. The mtDNA D-loop region contained each base (total number, percentage of total) as follows: A (317, 28.20%), C (336, 29.89%), G (169, 15.04%), and T (302, 26.87%). This sequence, like those of other horse populations, was AT rich. Sequence divergence was the lowest (1.71%) between the ancient horse bone and that of the Thoroughbred horse 1. The neighbor-joining and strict consensus tree of three of the most parsimonious trees also suggested that the ancient bone was considerably unrelated to native Jeju horses. The molecular phylogenetic characteristics of the horse bone that was excavated from the Kwakji archaeological site (Jeju, Korea) showed that some horse breeds may have existed on Jeju Island, Korea before Mongolian horses were introduced. The horse bone that was excavated from the Kwakji archaeological site may aid future research on the origin and ancestry of native Jeju horses.

Purpose The aim of this study was to evaluate the clinical characteristics and treatment outcomes, including surgical safety, in patients over 80 years of age who underwent an appendectomy. Methods This study involved 160 elderly patients who underwent an appendectomy for acute appendicitis: 28 patients over 80 years old and 132 patients between 65 and 79 years old. Results The rate of positive rebound tenderness was significantly higher in the over 80 group (P = 0.002). Comparisons of comorbidity, diagnostic tool and delay in surgical treatment between the two groups were not statistically different. American Society of Anesthesiologists score was significantly higher in the over 80 group than in the 65 to 79 group (2.4 ± 0.5 vs. 1.6 ± 0.5; P < 0.00005). Comparisons of operative times and use of drainage between the two groups were not statistically different. In the pathologic findings, periappendiceal abscess was more frequent in the over 80 group (P = 0.011). No significant differences existed between the two groups when comparing the results of gas out and the time to liquid diet, but the postoperative hospital stay was significantly longer in the over 80 group (P = 0.001). Among the postoperative complications, pulmonary complication was significantly higher in the over 80 group (P = 0.005). However, operative mortality was zero in each group. Conclusion In case of suspicious appendicitis in elderly patients, efforts should be made to use aggressive diagnostic intervention, do appropriate surgery and prevent pulmonary complications especially in patients over 80 years of age.

Purpose The appendectomy is the most common emergent surgical procedure in elderly patients. The increasing number of elderly persons has been accompanied by an increase in the number of cases of acute appendicitis in the elderly. In order to understand the clinical significance of a laparoscopic appendectomy for elderly patients with appendicitis, we investigated the results of a laparoscopic appendectomy for treating patients over 60 years of age with appendicitis and compared them with the results for an open technique. Methods We studied retrospectively patients over 60 years of age who underwent an appendectomy with either a laparoscopic (LA) or open (OA) technique for appendicitis between July 2007 and December 2009. There were 30 patients in the LA group and 47 patients in the OA group. The demographic data, operative time, length of the hospital stay, bowel movement, pain control, cost, complications and pre-existing disease were assessed. Results There were no significant differences between the LA and the OA groups with respect to pre-existing diseases, gender, age, American Society of Anesthesiologists (ASA) score and the number of cases of complicated appendicitis, operative time, length of hospital stay, and times of analgesics use. However, the proportion of early gas out (within POD #2) was significantly greater in the LA group (80% vs. 57%, P < 0.05), and postoperative complications were significantly lower in the LA group (7% vs. 32%, P < 0.01). The costs for the two groups were not significantly different. Conclusion A laparoscopic appendectomy is a safe and effective procedure in elderly patients and is not associated with any increase in morbidity. It can be recommended for routine use in treating elderly patients with appendicitis.

Purpose: The aim of this study was to identify the prognostic factors associated with poor outcome of biofeedback therapy. Methods: One hundred thirty-seven (137) constipated patients with pelvic outlet obstruction (median age 49 years) had more than one biofeedback session after defecography. Follow-up data (mean follow-up: 14 months; range: 2∼37 months) were obtained in 114 patients. Any differences in demographics, clinical symptoms, and parameters of an anorectal physiological study were evaluated between the success group and the failure group. Results: At follow-up, 80 (70 percent) patients felt improvement in symptoms, but 34 (30 percent) patients did not. Pre-biofeedback presence of symptoms of difficult defecation predict poor outcome (88 vs. 69 percent for failure vs. success, P＜0.05). The positive and the negative predictive values of difficult defecation for poor outcome were 35 percent and 86 percent, respectively. A negative mean pressure change on pre-biofeedback anal manometry was related to a poor outcome (65 vs. 26 percent for failure vs. success, P＜0.001). The positive and the negative predictive values of negative mean pressure change for poor outcome were 51 percent and 83 percent, respectively. A negative electrical current change on pre-biofeedback anal electromyography was related to a poor outcome (23 vs. 9 percent for failure vs. success, P＜0.05). The positive and the negative predictive values of negative electrical-current change for poor outcome were 53 percent and 74 percent, respectively. Conclusions: Difficult defecation, negative mean pressure change in pre-biofeedback anal manometry, and negative electrical current change in pre-biofeedback anal electromyography were predictors associated with poor outcome of biofeedback therapy for constipated patients with pelvic outlet obstruction.

Purpose: Biofeedback therapy is widely used for the management of constipation associated with pelvic outlet obstruction. Some patients have shown poor outcome after biofeedback alone. A subgroup of patients complains of absence of desire to defecate. The main pathophysiology of constipation may be impaired rectal sensation or compliance. This study evaluated the effect of electrical stimulation and biofeedback therapy (EST-BF) for this subgroup of constipated patients with impaired rectal sensation. Methods: Of the 37 patients diagnosed with pelvic outlet obstruction by using cinedefecography, 9 patients (M：F=2：7, age=22～77 years, median=57 years) who had impaired rectal sensation (rectal desire threshold ≥100 ml) on anorectal manometry were selected. These patients were treated with EST-BF therapy 2～6 (median: 5) sessions, Kontinece, Multichannel system, HMT, Inc, Seoul, Korea). Treatment consisted of 20 minutes of variant-mode electrical stimulation and 20 minutes of EMG biofeedback therapy per week administered by a specialized colorectal surgeon. All patients were evaluated by using a standardized questionnaire and a threshold for rectal sensation based on balloon distention before and after treatment. Results: At post EST-BF, six (67%) patients had experienced an improvement in symptoms, including five (56%) patients with complete symptom relief. Significant improvement in rectal sensation, especially the rectal defecation desire threshold (pre-EST-BF vs. post- EST-BF: 181.0±38.7 vs. 88.3±29.1) was achieved. Conclusions: EST- BF may be an effective option for use in the treatment of functional constipation with impaired rectal sensation.

Purpose: To determine the outcome and identify predictors of success of biofeedback for descending perineum syndrome (DPS). Methods: 103 patients diagnosed with DPS by defecography were evaluated by standardized questionnaire, before, immediately after treatment, and at follow-up. Clinical bowel symptoms and anorectal physiological studies were also analyzed. Results: At post- biofeedback, 81 patients felt improvement in symptoms, including 29 with complete symptom relief. At follow-up (median: 13 months, n=82), 58 patients felt improvement in symptoms, including 12 with complete symptom relief. There was a significant reduction in difficult defecation (from 78 to 34, 37%, from pre-biofeedback to post-biofeedback, and at follow-up respectively; P＜0.001), incomplete defecation (from 88 to 44, 41%; P＜0.001), hard stool (from 63 to 25, 0%; P＜0.01), small caliber stool (from 63 to 0,0%; P＜0.001, P＜0.005), fecal incontinence (from 10 to 1,1%; P＜0,01), anal pain (from 21 to 2, 6%; P＜0.001, P＜0.05), laxative use (from 30 to 11, 6%; P＜0.001), enema use (from 16 to 0, 1%; P＜0.001) and digitation (from 11 to 1%, from pre-biofeedback to at follow-up; P＜0.05). Normal spontaneous bowel movement was increased from 47% pre-biofeedback to 79% post-biofeedback (P＜0.001), 86% at follow-up (P＜0.001). Difficult defecation predict poor outcome (96 vs. 66%; failure vs. success, P＜0.01). Positive mean pressure change predict good outcome (69 vs. 35%; success vs. failure, P＜0.05). Conclusions: Biofeedback is an effective option for DPS. J Korean Soc Coloproctol