Search

Beyond the normal DNA transactions mediated by topoisomerase II, we have recently demonstrated that the cleavage activity of the two human topoisomerase II isoforms is several-fold stimulated if a ribonucleotide rather than a deoxyribonucleotide is present at the scissile phosphodiester in one strand of the substrate. Here we show that ribonucleotides exert a position-specific effect on topoisomerase II-mediated cleavage without altering the sequence specificity of the enzyme. Ribonucleotides located within the 4 bp cleavage stagger stimulate topoisomerase II-mediated cleavage, whereas ribonucleotides located outside the stagger in general have an inhibitory effect. Results obtained from competition experiments indicate that the position-specific effect of ribonucleotides on topoisomerase II activity is caused by altered substrate interaction. When cleavage is performed with substrates containing one ribonucleotide in both strands or several ribonucleotides in one strand the effect of the individual ribonucleotides on cleavage is not additive. Finally, although topoisomerase II recognizes substrates with longer stretches of ribonucleotides, an RNA/DNA hybrid where one strand is composed entirely of RNA is not cleaved by the enzyme. The positional effect of ribonucleotides on topoisomerase II-mediated cleavage shares many similarities to the positional effect exerted by either abasic sites or base mismatches, demonstrating a general influence of DNA imperfections on topoisomerase II activity.

The DNA strand passage activity of eukaryotic topoisomerase II relies on a cascade of conformational changes triggered by ATP binding to the N-terminal domain of the enzyme. To investigate the interdomain communication between the ATPase and cleavage/religation domains of human topoisomerase IIalpha, we characterized a mutant enzyme that contains a deletion at the interface between the two domains, covering amino acids 350-407. The ATPase domain retained full activity with a rate of ATP hydrolysis that was severalfold higher than normal, but the ATPase activity was unaffected by DNA. The cleavage and religation activities of the enzyme were comparable with those of the wild-type enzyme both in the absence and presence of cancer chemotherapeutic agents. However, neither ATP nor a nonhydrolyzable ATP analog stimulated cleavage complex formation. Although both conserved domains retained full activity, the mutant enzyme was unable to coordinate these activities into strand passage. Our findings suggest that the normal conformational transitions occurring in the enzyme upon ATP binding are hampered or lacking in the mutant enzyme. Consistent with this hypothesis, the enzyme displayed an abnormal clamp closing activity. In summary, the region covering amino acids 350-407 in human topoisomerase IIalpha seems to be essential for correct interdomain communication and probably is involved in signaling ATP binding to the rest of the enzyme.

Eukaryotic topoisomerase II is a nuclear enzyme essential for DNA metabolism and chromosome dynamics. The enzyme has a dimeric structure, and subunit dimerization is vital to the cellular functions and activities of the enzyme. Two biochemical approaches based on metal ion affinity chromatography and immunoprecipitation have been carried out to map the dimerization region(s) in human topoisomerase IIalpha. The results demonstrate that two regions spanning amino acids 1053-1069 and 1124-1143 are both essential for dimerization. The regions correspond to the interaction domains revealed in yeast topoisomerase II after crystallization of a central fragment of this enzyme, indicating that the overall C-terminal dimerization structure of eukaryotic topoisomerase II is conserved from yeast to human. Furthermore, linker insertion analysis has demonstrated that the two dimerization regions are located in a highly flexible part of the enzyme. Topoisomerase IIalpha mutant enzymes unable to dimerize via the C-terminal primary dimerization regions due to lack of one of the defined dimerization regions can still be forced to dimerize if DNA and an ATP analog are added to the reaction mixture. The result indicates that secondary interactions occur by ATP analog-mediated clamp closing when the subunits are brought together on DNA.

Eukaryotic topoisomerase II is a dimeric nuclear enzyme essential for DNA metabolism and chromosome dynamics. Central to the activities of the enzyme is its ability to introduce transient double-stranded breaks in the DNA helix, where the two subunits of the enzyme become covalently attached to the generated 5'-ends through phosphotyrosine linkages. Here, we demonstrate that human topoisomerases IIalpha and IIbeta are able to cleave ribonucleotide-containing substrates. With suicide substrates, which are partially double-stranded molecules containing a 5'-recessed strand, cleavage of both strands was stimulated approximately 8-fold when a ribonucleotide rather than a deoxyribonucleotide was present at the scissile phosphodiester of the recessed strand. The existence of a ribonucleotide at the same position in a normal duplex substrate also enhanced topoisomerase II-mediated cleavage, although to a lesser extent. The enzyme covalently linked to the 5'-ribonucleotide in the cleavage complex efficiently performed ligation, and ligation occurred equally well to acceptor molecules terminated by either a 3'-ribo- or deoxyribonucleotide. Besides the enhanced topoisomerase II-mediated cleavage of ribonucleotide-containing substrates, cleavage of such substrates could be further stimulated by ATP or antitumor drugs. In conclusion, the observed in vitro activities of the human topoisomerase II isoforms indicate that the enzymes can operate on RNA or RNA-containing substrates and thus might possess an intrinsic RNA topoisomerase activity, as has previously been demonstrated for Escherichia coli topoisomerase III.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non‐transcribed spacers of r‐chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I‐DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3′ end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence‐specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8‐fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6‐kb fragment investigated; the sequence specific cleavage is increased 2‐ to 3‐fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(‐10) M.

DNA-topoisomerase I has been implied in RNA splicing because it catalyzes RNA strand transfer and activates serine/arginine-rich RNA-splicing factors by phosphorylation. Here, we demonstrate a direct interaction between topoisomerase I and pyrimidine tract binding protein-associated splicing factor (PSF), a cofactor of RNA splicing, which forms heterodimers with its smaller homolog, the nuclear RNA-binding protein of 54 kDa (p54). Topoisomerase I, PSF, and p54 copurified in a 1:1:1 ratio from human A431 cell nuclear extracts. Specific binding of topoisomerase I to PSF (but not p54) was demonstrated by coimmunoprecipitation and by far Western blotting, in which renatured blots were probed with biotinylated topoisomerase I. Chemical cross-linking of pure topoisomerase I revealed monomeric, dimeric, and trimeric enzyme forms, whereas in the presence of PSF/p54 the enzyme was cross-linked into complexes larger than homotrimers. When topoisomerase I was complexed with PSF/p54 it was 16-fold more active than the pure enzyme, which could be stimulated 5- and 16-fold by the addition of recombinant PSF or native PSF/p54, respectively. A physiological role of this stimulatory mechanism seems feasible, because topoisomerase I and PSF showed a patched colocalization in A431 cell nuclei, which varied with cell cycle.

Topoisomerase I purified from a camptothecin-resistant human leukemia cell line and from the parental, camptothecin-sensitive line were compared in vitro. Relaxation of supercoiled DNA by the wild type enzyme was inhibited in the presence of camptothecin, while the mutant enzyme was unimpaired. Camptothecin altered the cleavage pattern of the wild type but not of the mutant enzyme. The stability of cleavable complexes was studied at a preferred topoisomerase I-binding sequence recognized by both enzymes. Camptothecin greatly enhanced the kinetic stability of the cleavable complex formed by the wild type enzyme, whereas that of the mutant enzyme was only marginally affected. In the absence of camptothecin, the cleavable complex formed by the mutant enzyme was stabilized relative to that of the wild type by several criteria. Thus, the mutant enzyme cleaved the topoisomerase I recognition sequence with 2-fold higher efficiency than the wild type enzyme. The mutant cleavable complex had a higher kinetic stability and was less sensitive to salt dissociation than the wild type complex. Furthermore, the mutant enzyme formed cleavable complexes in the absence of divalent cations, which were required for complex formation by the wild type enzyme.

Nucleoli can be isolated from Tetrahymena in a yield of 30-60%. The isolated nucleoli contain rDNA (at least 90% pure) and have a protein to DNA ratio of 30:1. The endogenous RNA-polymerase activity of the r-chromatin has the following properties: (i) The in vitro transcript has a maximal size identical to the in vivo 35S rRNA precursor, demonstrating correct termination on the gene, (ii) 79% of the in vitro transcript is complementary to cDNA of 17S and 25S rRNA which is close to the theoretical maximum for the 35S rRNA precursor, (iii) the elongation rate of the endogenous RNA-polymerase molecules is 9-12 nucleotides/sec, (iv) an average of 4-16 active RNA polymerases are associated with each rDNA molecule depending upon the preparation.

The strand joining step of recombination mediated by the Flp site-specific recombinase involves the attack of a 3'-phosphotyrosyl bond by a 5'-hydroxyl group from DNA. The nucleophile in this reaction, the 5'-OH, can be substituted by glycerol or other polyhydric alcohols. The strand joining and glycerolysis reactions are mechanistically equivalent and are competitive to each other. The target diester in strand joining can be a 3'-phosphate covalently linked either to a short tyrosyl peptide or to the whole Flp protein via Tyr-343. By contrast, only the latter type of 3'-phosphotyrosyl linkage is a substrate for glycerolysis. As a result, in activated DNA substrates (containing the scissile phosphate linked to a short Flp peptide), Flp(Y343F) can mediate the joining reaction utilizing the 5'-hydroxyl attack but fails to promote glycerolysis. Wild type Flp promotes both reactions in these substrates. The strand joining and glycerolysis reactions are absolutely dependent on the catalytic histidine at position 305 of Flp. Our results fit into a model in which a Flp dimer, with one monomer covalently attached to the 3'-phosphate, is essential for orienting the target diester or the nucleophile (or both) during glycerolysis. The requirement for this dimeric complex is relaxed in the strand joining reaction because of the ability of DNA to orient the nucleophile (5'-OH) by complementary base pairing. The experimental outcomes described here have parallels to the "cleavage-dependent ligation" carried out by a catalytic variant of Flp, Flp(R308K) (Zhu, X.-D., and Sadowski, P. D. (1995) J. Biol. Chem. 270, 23044-23054).

Correct termination of transcription of the rRNA gene in nucleoli isolated from Tetrahymena is dependent on a protein factor with a molecular weight between 50,000 and 100,000. At low ionic strength the endogenous RNA polymerase synthesizes a transcript identical in size to the precursor rRNA extracted from cells. In the presence of ammonium sulfate, however, the RNA polymerase reads through the normal termination point as demonstrated by size and hybridization studies of the transcript. After ammonium sulfate treatment, rDNA associated with chromosomal proteins (r-chromatin) can be separated from the termination factor by differential centrifugation. The endogenous RNA polymerase on the salt-treated r-chromatin is no longer able to recognize the normal terminator even at low ionic strength. Normal termination properties can be reconstituted by complementation with intact nucleoli or with a protein factor extracted from nucleoli.

The interaction between eukaryotic DNA topoisomerase I and a high affinity binding sequence was investigated. Quantitative footprint analysis demonstrated that the substrate preference results from strong specific binding of topoisomerase I to the sequence. The specificity was conferred by a tight noncovalent association between the enzyme and its target DNA, whereas the transient formation of a covalently bound enzyme·nicked DNA intermediate contributed insignificantly to the overall affinity. Topoisomerase I protected both strands over a 20-base pair region in which the cleavage site was centrally located. DNA modification interference analysis revealed a 16-base pair interference region on the scissile strand. Essential bases were confined to the 5′ side of the cleavage site. The 6-base pair interference region observed on the complementary strand did not contain essential bases.