Search

Robotic task instructions often involve a referred object that the robot must locate (ground) within the environment. While task intent understanding is an essential part of natural language understanding, less effort is made to resolve ambiguity that may arise while grounding the task. Existing works use vision-based task grounding and ambiguity detection, suitable for a fixed view and a static robot. However, the problem magnifies for a mobile robot, where the ideal view is not known beforehand. Moreover, a single view may not be sufficient to locate all the object instances in the given area, which leads to inaccurate ambiguity detection. Human intervention is helpful only if the robot can convey the kind of ambiguity it is facing. In this article, we present DoRO (Disambiguation of Referred Object), a system that can help an embodied agent to disambiguate the referred object by raising a suitable query whenever required. Given an area where the intended object is, DoRO finds all the instances of the object by aggregating observations from multiple views while exploring & scanning the area. It then raises a suitable query using the information from the grounded object instances. Experiments conducted with the AI2Thor simulator show that DoRO not only detects the ambiguity more accurately but also raises verbose queries with more accurate information from the visual-language grounding., Accepted in IEEE Robotics & Automation Letters (RA-L)

BackgroundHypertrophic cardiomyopathy (HCM) is a genetic heart muscle disease with preserved or increased ejection fraction in the absence of secondary causes. Mutations in the sarcomeric protein-encoding genes predominantly cause HCM. However, relatively little is known about the genetic impact of signalling proteins on HCM.Methods and resultsHere, using exome and targeted sequencing methods, we analysed two independent cohorts comprising 401 Indian patients with HCM and 3521 Indian controls. We identified novel variants in ribosomal protein S6 kinase beta-1 (RPS6KB1 or S6K1) gene in two unrelated Indian families as a potential candidate gene for HCM. The two unrelated HCM families had the same heterozygous missense S6K1 variant (p.G47W). In a replication association study, we identified two S6K1 heterozygotes variants (p.Q49K and p.Y62H) in the UK Biobank cardiomyopathy cohort (n=190) compared with matched controls (n=16 479). These variants are neither detected in region-specific controls nor in the human population genome data. Additionally, we observed an S6K1 variant (p.P445S) in an Arab patient with HCM. Functional consequences were evaluated using representative S6K1 mutated proteins compared with wild type in cellular models. The mutated proteins activated the S6K1 and hyperphosphorylated the rpS6 and ERK1/2 signalling cascades, suggesting a gain-of-function effect.ConclusionsOur study demonstrates for the first time that the variants in the S6K1 gene are associated with HCM, and early detection of the S6K1 variant carriers can help to identify family members at risk and subsequent preventive measures. Further screening in patients with HCM with different ethnic populations will establish the specificity and frequency of S6K1 gene variants.

Dinitrogen fixation through the Nitrogen Reduction Reaction (NRR) under mild conditions without the use of sacrificial agents has its share of formidable hurdles. It has been shown recently that Ru-doped Au nanoclusters can reduce N2 molecule to NH3 only in the presence of UV-Vis light in aqueous medium. Herein, using theoretical techniques we shed light on the mechanistic avenues traversed for achieving this prodigious chemical feat. Our findings suggest that the bimetallic Au22Ru6 cluster successfully accomplishes the NRR process under ambient pressure and temperature conditions by the very virtue of its bifunctional nature. Contrary to the existing views, we find that NRR propagates through an unconventional associative pathway, where the Ru dopant assists in N2 adsorption while the Au-H bonds formed from Au assisted water splitting is implicated for facilitating NRR.

Background: Plant biotechnology revolutionized the branch of plant sciences contributing to improving crop production. Helicobacter pylori was predominantly seen among all the sectors of the human population, closely stuck to stomach ulcers and cancer. Even though traditional vaccines are effective in preventing H. pylori, edible and non-edible parts of special transgenic plants were also being generated to express its antigens which could elicit an immune response after consuming. The induce by contact with epithelium (iceA1) protein of H. pylori is associated with virulence and stated as predisposing factor to stomach cancer. Objectives: This study intends to study the expression levels of iceA1 gene in the brinjal plant. Materials and Methods: The present study, magnified the iceA1 gene from H. pylori strain 26695 and transformed it into callus of brinjal (from leaf explants) through Agrobacterium tumefacians (EHA105). pBI121 vector was used to construct the plant expression vector, and the transgenic plants generated were further validated through gene amplification and protein expression studies. Results: Out of the 46 plants obtained from this study, five of them were found to be positive for the iceA1 expression as seen on validation assays like gene amplification and protein expression studies. Conclusion: The study could beneficially produce a vaccine candidate against H. pylori from transgenic brinjal. In Addition, it could provide, valid scientific data which can further be used by researchers.

Amid the surge of computational studies of gold thiolate clusters in the recent past, we present a comparison of popular density functionals (DFAs) and three-part corrected methods (3c-methods) on their performance by taking a dataset consisting 18 isomers of Aun(SCH3)m (m ≤ n =1-3) stoichiometry. We have compared the efficiency and accuracy of the DFAs and 3c-methods in geometry optimization with RI-SCS-MP2 and energies with DLPNO-CCSD(T) as reference methods. The lowest energy structure out of the largest stoichiometry from our dataset i.e., Au3(SCH3)3 is considered to evaluate the computational time for SCF and gradient. Alongside, the number of optimization steps to locate the most stable minima of Au3(SCH3)3 are compared to assess the efficiency of the methods. A comparison of relevant bond lengths with the reference geometry was made to estimate the accuracy in geometry optimization. Some methods such as LC-BLYP, ⍵B97M-D3BJ, M06-2X, and PBEh-3c are unable to locate many of the minima that are found by most of the other methods; thus, the versatility in locating various minima is also an important criterion in choosing a method for the given project. We have compared the relative energies among the isomers along every stoichiometric series and the interaction energy of the gold core with the ligands to estimate the accuracy of the methods. The dependence of basis set size and relativistic effects on energies are also compared. Some of the highlights are the following. TPSS shows accuracy, whereas mPWPW is fast with comparable accuracy. The range separated hybrid DFAs are the best choice for the relative energies of the clusters. CAM-B3LYP excels, whereas B3LYP shows poor performance. Overall, LC-BLYP is a balanced performer considering both the geometry and relative stability of the structures, but it lacks diversity. The 3c-methods, although fast, are less impressive in relative stability.

Overmodulation techniques of asymmetrical six-phase machine achieve higher dc-bus utilization by applying voltage in the nonenergy transfer plane. This results into unwanted current and associated copper loss. Existing overmodulation technique minimizes this voltage from space-vector perspective with predefined set of four active vectors. To find the best technique, one needs to perform the above minimization problem with all possible sets of active vectors with which higher voltage gain can be attained. Therefore, this requires evaluation of large number of cases. This article formulates the above minimization problem in terms of average voltage vectors of two three-phase inverters, where active vectors need not to be specified beforehand and, thus, the analysis is more general. Sixteen possible techniques with different set of active vectors are derived following the above analysis, which attain minimum voltage injection in the nonenergy transfer plane. This article also identifies one of these 16 techniques, which can be implemented without involving complex six-dimensional transformation. The above technique is validated through experiments on six-phase induction motor and simulations in MATLAB at 3.5-kW power level.

Overmodulation (OVM) techniques of asymmetrical six-phase induction machine (ASIM) achieve higher dc-bus utilization by applying nonzero average voltage in nonenergy transfer plane. This results into unwanted current and associated copper loss. Existing OVM techniques reduce this loss with pulsewidth modulation (PWM) techniques from six-dimensional space vector perspective, which is both conceptually difficult and computationally challenging. The computational complexity of space vector based techniques is reduced by few existing PWM techniques in linear region by splitting the six-phase inverter as two three-phase inverters and modulate these inverters with linear PWM techniques in 30 $^\circ$ phase shifted. This is referred as three-phase inverter based technique in the title. But, three-phase inverter based OVM technique does not exist in the literature due to lack of knowledge of the relationship between six-dimensional space vectors and space vectors of two three-phase inverters. This article first establishes this relation. Based on this relation, an OVM technique is proposed where the reference voltage vectors of two inverters are phase shifted by 30 $^\circ$ but of different magnitudes. The proposed technique achieves THD and WTHD performances similar to space vector based best technique of ASIM with reduced computational complexity, as shown in details. The proposed strategy is validated through experiments and simulations on six-phase induction machine at 4.2 kW.

Systemic sclerosis (SSc) is a fibrotic disease that initiates in the skin and progresses to internal organs, leading to a poor prognosis. Unraveling the etiology of a chronic, multifactorial disease such as SSc has been aided by various animal models that recapitulate certain aspects of the human pathology. We found that the transcription factor Snail is overexpressed in the epidermis of SSc patients and a transgenic mouse recapitulating this expression pattern is sufficient to induce many clinical features of the human disease. Using this mouse model as a discovery platform, we have uncovered a critical role for the matricellular protein Mindin (Spondin-2) in fibrogenesis. Mindin is produced by Snail transgenic skin keratinocytes and aids fibrogenesis by inducing early inflammatory cytokine production and collagen secretion in resident dermal fibroblasts. Given the dispensability of Mindin in normal tissue physiology, targeting this protein holds promise as an effective therapy for fibrosis.

We present a performance study on popular density functionals (DFAs) and three-part corrected methods (3c-methods) for their efficiency and accuracy in the geometry and relative stability of gold-thiolate nanoclusters taking Au 3(SCH3)3 isomers. Normalized mean absolute error (NMAE) is analysed to compare the results with the reference methods DLPNO-CCSD(T) and RI-SCS-MP2. The dependence of basis set size and relativistic effects on energies are also compared. TPSS shows accuracy, whereas PBE is fast for geometry optimization. On the other hand, range separation in hybrid DFAs stands out as the proper choice for the relative energies of the clusters. LC-BLYP excels, but 3c-methods are less impressive in relative stability comparison. Counterpoise corrected thiolate interaction energy and bonding analyses delineate the higher stability of bridging sulfur coordination (RS-Au-SR; R = − methyl) than singly-bonded and capping sulfur bonds in Au3(SCH3)3 . With the selected DFAs, we have analyzed the gold-sulfur interaction in Au3(SCH3)3 , and a comparison is made with AuSCH3 . The bonding analysis has revealed a partial covalency between gold and sul- fur atoms. On going from AuSCH3 to Au3 (SCH3)3 , a substantial flow of charge from gold atoms to thiolate ligands stems from the increase in gold s-d hybridization. As the s-d mixing in Au increases, the main character of Au-S interaction shifts from covalent to ionic. Hence, a covalent-charge-transfer interaction dominates in gold-sulfur bonding and gives rise to a charge-shift bonding.

Fibrosis is a result of chronically activated fibroblasts leading to the overproduction of extracellular matrix (ECM), causing tissue hardening and loss of organ function. Systemic sclerosis (SSc) is a fibrotic skin disease marked by inflammation, autoimmunity and vasculopathy along with progressive fibrosis of the skin and internal organs. A major bottleneck in understanding the etiology of SSc has been the lack of a holistic animal model that can mimic the human SSc disease. We found that the transcription factor Snail is overexpressed in the epidermis of SSc patients and a transgenic mouse recapitulating this expression pattern is sufficient to induce hallmark clinical features of the human disease. Using this mouse model as a discovery platform, we have uncovered a critical role for the matricellular protein Mindin in fibrogenesis. Mindin is produced by Snail transgenic skin keratinocytes and aids fibrogenesis by inducing inflammatory cytokine and collagen production in resident dermal fibroblasts. Given the dispensability of Mindin in normal tissue physiology, targeting this protein holds promise as an effective therapy for fibrosis.

We present a benchmark study on popular density functionals for their efficiency and accuracy in the geometry and relative stability of gold-thiolate nanoclusters taking Au3(SMe)3 isomers. We have used normalized mean absolute error (NMAE) analysis as a parameter to compare the results with the reference methods - DLPNO-CCSD(T) and RI-SCS-MP2. We have also compared the performance on the thiolate interaction energy of the stable geometries using the results from our benchmark study. One of the promising functional is PBE that shows robust performance for geometry optimization. On the other hand, M06-2X stands out as the proper choice for the relative energies of the clusters. With the selected methods, we have analyzed the gold-sulfur interaction in Au3(SMe)3 and a comparison is made with AuSMe. The bonding analysis has revealed a partial covalency between gold and sulfur atoms in general. On going from AuSMe to Au3(SMe)3, a substantial flow of charge from gold atoms to thiolate ligands as a result of the increase in gold s-d hybridization. As the s-d mixing in Au increases, the main character of Au-S interaction shifts from covalent to ionic. Hence, a covalent-charge-transfer interaction dominates in gold-sulfur bonding and gives rise to a charge-shift bonding.

Linear modulation techniques (LMTs) of an asymmetrical six-phase machine (ASPM) with two isolated neutral points synthesize the desired voltage vectors by applying at least five switching states. Different choices of applied voltage vectors, sequences in which they are used, distribution of dwell times among the redundant switching states give rise to a large number of possible LMTs. It is desirable that these LMTs avoid more than two transitions of a particular inverter leg within a carrier period. Only a subset of existing LMTs of ASPM follows this rule. Through an innovative approach, this paper finds a way to account for all possible infinitely many LMTs that follow the rule of at most two transitions per leg. Another important criterion for the selection of an LMT is its current-ripple performance. Therefore, through numerical optimization, the paper finds optimal LMTs among the above infinite possible LMTs for all reference voltage vectors in the linear range and for the whole feasible range of a machine parameter. This parameter is related to the leakage inductance of the machine and impacts the current ripple performance of ASPM. An optimal hybrid strategy is proposed with these optimal techniques, which outperforms all existing techniques in terms of the current ripple. The theoretical analysis is validated through simulation in Matlab and experiments performed up to 3.5 kW on a hardware prototype.

Cardiac glycosides are natural sterols and constitute a group of secondary metabolites isolated from plants and animals. These cardiotonic agents are well recognized and accepted in the treatment of various cardiac diseases as they can increase the rate of cardiac contractions by acting on the cellular sodium potassium ATPase pump. However, a growing number of recent efforts were focused on exploring the antitumor and antiviral potential of these compounds. Several reports suggest their antitumor properties and hence, today cardiac glycosides (CG) represent the most diversified naturally derived compounds strongly recommended for the treatment of various cancers. Mutated or dysregulated transcription factors have also gained prominence as potential therapeutic targets that can be selectively targeted. Thus, we have explored the recent advances in CGs mediated cancer scope and have considered various signaling pathways, molecular aberration, transcription factors (TFs), and oncogenic genes to highlight potential therapeutic targets in cancer management.

Among the annelids, earthworms are renowned for their phenomenal ability to regenerate the lost segments. The adult earthworm Eudrilus eugeniae contains 120 segments and the body segments of the earthworm are divided into pre-clitellar, clitellar and post-clitellar segments. The present study denoted that clitellum plays vital role in the successful regeneration of the species. We have performed histological studies to identify among the three skin layers of the earthworm, which cellular layer supports the blastema formation and regeneration of the species. The histological evidences denoted that the proliferation of the longitudinal cell layer at the amputation site is crucial for the successful regeneration of the earthworm and it takes place only in the presence of an intact clitellum. Besides we have performed clitellar transcriptome analysis of the earthworm Eudrilus eugeniae to monitor the key differentially expressed genes and their associated functions and pathways controlling the clitellar tissue changes during both anterior and posterior regeneration of the earthworm. A total of 4707 differentially expressed genes (DEGs) were identified between the control clitellum and clitellum of anterior regenerated earthworms and 4343 DEGs were detected between the control clitellum and clitellum of posterior regenerated earthworms. The functional enrichment analysis confirmed the genes regulating the muscle mass shape and structure were significantly downregulated and the genes associated with response to starvation and anterior-posterior axis specification were significantly upregulated in the clitellar tissue during both anterior and posterior regeneration of the earthworm. The RNA sequencing data of clitellum and the comparative transcriptomic analysis were helpful to understand the complex regeneration process of the earthworm.

Purpose Verminephrobacter is a genus of symbiotic bacteria that live in the nephridia of earthworms. The bacteria are recruited during the embryonic stage of the worm and transferred from generation to generation in the same manner. The worm provides shelter and food for the bacteria. The bacteria deliver micronutrients to the worm. The present study reports the genome sequence assembly and annotation of a new strain of Verminephrobacter called Verminephrobacter eiseniae msu. Methods We separated the sequences of a new Verminephrobacter strain from the whole genome of Eisenia fetida using the sequence of V. eiseniae EF01-2, and the bacterial genome was assembled using the CLC Workbench. The de novo-assembled genome was annotated and analyzed for the protein domains, functions, and metabolic pathways. Besides, the multigenome comparison was performed to interpret the phylogenomic relationship of the strain with other proteobacteria. Result The FastqSifter sifted a total of 593,130 Verminephrobacter genomic reads. The de novo assembly of the reads generated 1832 contigs with a total genome size of 4.4 Mb. The Average Nucleotide Identity denoted the bacterium belongs to the species V. eiseniae, and the 16S rRNA analysis confirmed it as a new strain of V. eiseniae. The AUGUSTUS genome annotation predicted a total of 3809 protein-coding genes; of them, 3805 genes were identified from the homology search. Conclusion The bioinformatics analysis confirmed the bacterium is an isolate of V. eiseniae, and it was named Verminephrobacter eiseniae msu. The whole genome of the bacteria can be utilized as a useful resource to explore the area of symbiosis further.

The present article reports the complete draft genome annotation of earthworm Eisenia fetida, obtained from the manuscript entitled “Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm E. fetida” (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The E. fetida protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information. The genome wide comparison of orthologous clusters and phylogenomic analysis of the core genes were performed to understand the events of genome evolution and genomic diversity between E. fetida and its related metazoans. In addition, the genome dataset was screened to identify the crucial stem cell markers, regeneration specific genes and immune-related genes and their functionally enriched GO terms were predicted from Fisher׳s enrichment analysis. The E. fetida genome annotation data containing the GFF (general feature format) annotation file, predicted coding gene sequences and translated protein sequences were deposited to the figshare repository under the DOI: https://doi.org/10.6084/m9.figshare.6142322.v1. Keywords: Eisenia fetida, Genome annotation, Orthologous groups, Regeneration

Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)). Keywords: Bacillus cereus, Genome sequencing, Abscessation, Virulence factors

In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al., 2010 from the earthworm Eisenia fetida. Totally 9762 transcripts were successfully annotated against the NCBI nr database using the BLASTX algorithm and among them 7680 transcripts were assigned to a total of 44,354 GO terms. The conserve domain analysis indicated the over representation of P-loop NTPase domain and calcium binding EF-hand domain. The COG functional annotation classified 5860 transcript sequences into 25 functional categories. Further, 4502 contig sequences were found to map with 124 KEGG pathways. The annotated contig dataset exhibited 22 crucial neuropeptides having considerable matches to the marine annelid Platynereis dumerilii, suggesting their possible role in neurotransmission and neuromodulation. In addition, 108 human stem cell marker homologs were identified including the crucial epigenetic regulators, transcriptional repressors and cell cycle regulators, which may contribute to the neuronal and segmental regeneration. The complete functional annotation of this nerve cord transcriptome can be further utilized to interpret genetic and molecular mechanisms associated with neuronal development, nervous system regeneration and nerve cord function.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Context: This research describe the characteristic volume expansion of a moving target as a function of differential margins. Aim: We aimed to ascertain the volume change after giving margin for clinical and set up uncertainties including generating internal target volume (ITV) for moving target. Materials and Methods: Settings and Design – Spheres of diameter (0.5–10 cm) with differential expansion of 1–15 mm were generated using a mathematical formula. Moving targets of radius 1–5 cm were generated, and the resultant volume envelopes with incremental motion from 1 to 20 mm were obtained. All relative volume change results were fitted with mathematical functions to obtain a generalized mathematical formula. Statistical Analysis Used: None. Results: The percentage increase in volume (%ΔVp) was much more pronounced for smaller radius target. For moving target with relatively smaller radius, %ΔVp is predominant over the absolute volume change and vice versa in case of larger radius. Mathematical formulae were obtained for %ΔVp as a function of radius and expansion and for %ΔVp in ITV volume as a function of radius and tumor movement. Conclusions: This study provides an idea of volume change for various expansions for various size targets and/or moving target for different range of movements. It establishes a correlation of these volume changes with the changing target size and range of movements. Finally, a clinically useful mathematical formulation on volume expansion has been developed for rapid understanding of the consequence of volume expansion.

Zika virus (ZIKV) is a reemerging human pathogen that causes congenital abnormalities, including microcephaly and eye disease. The cellular/molecular basis of ZIKV and host interactions inducing ocular and neuronal pathogenesis are unclear. Herein, we noted that the Hippo/Salvador-Warts-Hippo signaling pathway, which controls organ size through progenitor cell proliferation and differentiation, is dysregulated after ZIKV infection. In human fetal retinal pigment epithelial cells, there is an early induction of transcriptional coactivator, Yes-associated protein (YAP), which is later degraded with a corresponding activation of the TANK binding kinase 1/interferon regulatory factor 3 type I interferon pathway. YAP/transcriptional co-activator with a PDZ-binding domain (TAZ) silencing results in reduced ZIKV replication, indicating a direct role of Hippo pathway in regulating ZIKV infection. Using an invivo Ifnar1-/- knockout mouse model, ZIKV infection was found to reduce YAP/TAZ protein levels while increasing phosphorylated YAP Ser127 in the retina and brain. Hippo pathway is activated in major cellular components of the blood-brain barrier, including endothelial cells and astrocytes. In addition, this result suggests AMP-activated protein kinase signaling pathway's role in regulating YAP/TAZ in ZIKV-infected cells. These data demonstrate that ZIKV infection might initiate a cross talk among AMP-activated protein kinase-Hippo-TBK1 pathways, which could regulate antiviral and energy stress responses during oculoneuronal inflammation.

The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa., The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa. Here we report the draft genome sequence, assembly, and annotation of the isolated CMSTMSU phage. This genome resource can be used to utilize the phage as a crucial biocontrol agent in the fish aquaculture sector.

The steel industry being highly energy intensive in nature is one the major consumers of energy. The iron and steel industry is the largest energy consuming manufacturing sector in the world. It is therefore that the question of fuel or energy has been of the highest importance in steel making, and one can boldly claim that all other conditions remaining constant, saving or wasting of fuel can make the difference between a profit or a loss of a steel plant. Energy conservation in steel plants is very crucial to ensure the competitiveness of the steel producing industries and to minimise environmental impacts. India's leading iron and steel companies, scored averages at best in Centre for Science and environment green rating test. The Indian iron and steel sector's energy consumption of 6.6 GCal per tonne, is 50 per cent higher than the global best practice. The integrated steel plants in India have the opportunities to strengthen their operations and minimise energy losses and wastages to reduce specific energy consumption by 5-6%. To reduce the gaps between India and developed countries we have to follow the technological advancement and implementation of innovative strategies at every stage of the operation of steel plants. The specific energy consumption in the Indian steel industry is high compared to that in advanced countries. Data for four integrated steel plants in India have been analysed. World crude steel production reached 1.621 million tones (Mt) in 2015. To meet the needs of our growing population, steel use is projected to increase by 1.5 times that of present level by 2050.

Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)).

Aim: Intracranial metastases are the most common neurologic complications of systemic cancer. Stereotactic radiosurgery (SRS) is a proven modality for treating single or oligometastatic brain lesions. In this retrospective study, we have analyzed patients data treated in our hospital with SRS. Materials and Methods: The analysis included 52 patient's data treated between August 2010 and January 2018. These include the patients in the complete remission of the primary disease and have recurred in the brain with one to four metastases after a significant disease-free interval. Patient's case sheets and treatment planning system data were analyzed to collect the data for this study. Results: Median follow-up was 10 months (range, 1–37 months). There were twenty cases of Ca (cancer) lung, 13 cases of Ca breast, 5 cases of Ca rectum, 4 cases of Ca endometrium, 2 case of Ca esophagus, and 1 case each of alveolar rhabdomyosarcoma of right parotid, Ca ovary, Ca vaginal vault, Ca lacrimal gland, Ca colon, Ca urinary bladder, and Ca prostate. These patients who had a recurrent disease in the brain were treated with doses ranging from 15 to 20 Gy in single fraction, 24 Gy in 3 fractions, 27 Gy in 3 fractions, or 30 Gy in 5 fractions. Median progression-free survival was 9 months, and median overall survival (OS) was 12 months in these patients. Conclusion: Frameless SRS is an effective treatment of delivering high-dose radiation to patients who develop one to four brain metastasis with comparable median progression free and OS to the previously reported data.

Purpose: To evaluate the performance linked to the consistency of a-Si EPID and ion-chamber array detectors for dose verification in advanced radiotherapy.Methods: Planar measurements were made for 250 patients using an array of ion chamber and a-Si EPID. For pre-treatment verification, the plans were generated on the phantom for re-calculation of doses. The γ-evaluation method with the criteria: dose-difference (DD) ≤ 3% and distance-to-agreement (DTA) ≤ 3 mm was used for the comparison of measurements. Also, the central axis (CAX) doses were measured using 0.125cc ion chamber and were compared with the central chamber of array and central pixel correlated dose value from EPID image. Two types of statistical approaches were applied for the analysis. Conventional statistics used analysis of variance (ANOVA) and unpaired t-test to evaluate the performance of the detectors. And statistical process control (SPC) was utilized to study the statistical variation for the measured data. Control charts (CC) based on an average , standard deviation ( ) and exponentially weighted moving averages (EWMA) were prepared. The capability index (Cpm) was determined as an indicator for the performance consistency of the two systems.Results: Array and EPID measurements had the average gamma pass rates as 99.9% ± 0.15% and 98.9% ± 1.06% respectively. For the point doses, the 0.125cc chamber results were within 2.1% ± 0.5% of the central chamber of the array. Similarly, CAX doses from EPID and chamber matched within 1.5% ± 0.3%. The control charts showed that both the detectors were performing optimally and all the data points were within ± 5%. EWMA charts revealed that both the detectors had a slow drift along the mean of the processes but was found well within ± 3%. Further, higher Cpm values for EPID demonstrate its higher efficiency for radiotherapy techniques.Conclusion: The performances of both the detectors were seen to be of high quality irrespective of the radiotherapy technique. Higher Cpm values for EPID indicate its higher efficiency than array.

Purpose: Evaluation of the newly integrated system for its validation and designing a quality assurance frame work to assess its geometrical, radiological and mechanical accuracy.Methods: Isocentric accuracy of two independent imaging modalities, kV based ExacTrac and MV based iViewGT was evaluated using Winston-Lutz test. A pelvic humanoid phantom was used for the radiological end-to-end test for its clinical utilization. Image quality for the systems was evaluated using Las Vegas Phantom and ETR-1 plate. The kV system was also assessed for kVp accuracy, kVp - dose linearity, mAs-dose linearity and timer linearity and its accuracy. The system was tested for total filtration and output consistency. Tests for uniformity and noise measurement of kVp accuracy and its reproducibility, linearity test between applied kVp and the x-ray dose, linearity Test between applied mAs and the x-ray dose were also done. Results: Winston-Lutz test gave the isocentric deviation of 0.058 ± 0.015 mm with the average lateral deviation as 0.028 ± 0.021 mm, average longitudinal deviation as 0.032 ± 0.015 mm and average vertical deviation as 0.030 ± 0.016 mm. With the phantom test, the minimum measured displacement of Exactrac positioning was 0.2 ± 0.3 mm, 0.0 ± 0.2 mm and 0.1 ± 0.3 mm in longitudinal, lateral and vertical directions respectively. In image quality test, visible smallest visible hole size seen by both Exactrac and EPID imaging system was 5 mm and can resolve 1.5 lp/mm or better. The image uniformity was found to be 132.9 ± 3.06 pixels for MV images and 139 ± 4.41 pixels for kV images with the associated noise of ≤1% both for 120 kV-20 mAs and 4 MV beam energy of ExacTrac and iViewGT respectively. The uniformity and noise test, measured pixel intensity values for various points on MV and kV images separately were found to agree within ± 1% with respect to the central axis pixel value. The kVp accuracy and its reproducibility were tested for kV imager only. The deviation of kVp was found to be than ± 1% and its precision was seen to be even lesser than ± 0.1%. Linearity test between applied kVp and the x-ray dose and applied mAs and x-ray dose were tested only for the ExacTrac. Both the coefficient of linearity for kVp as well as mAs was found to be < 0.1. Conclusion: It is feasible to install ExacTrac imaging system with an Elekta linear accelerator. Both the imaging systems were found to be compatible in terms of image quality test and isocentric accuracy and can be used for the patient imaging in the same Linear accelerator.-----------------------------Cite this article as: Jassal K, Munshi A, Sarkar B, Paul S, Sharma A, Mohanti BK, Ganesh T, Chougule A, Sachdev K. Validation of an integrated patient positioning system: Exactrac and iViewGT on Synergy Platform. Int J Cancer Ther Oncol 2014; 2(2):020212. DOI: 10.14319/ijcto.0202.12

Purpose: The use of positron emission tomography (PET) for radiotherapy planning purposes has become increasingly important in the last few years.In the current study, we compared the SUV values of images at the PET CT console to the SUV values obtained at the RT planning workstation. Materials and Methods: The PET-CT cylindrical body phantom was filled with a uniform 18F solution of 5.3. ± 0.27 kBq/mL radioactivity concentration. PET-CT scans were performed on a16 slice Time of Flight system. On a single day, the three consecutive scans were done at three time points 15 minutes apart to generate time points image data sets titled T1, T2, and T3. SUV calculations were performed by drawing region of interest. (ROI) encompassing the entire hot spot on each slice on the PET-CT console and the iPlan workstation. Minimum SUV, Maximum SUV and the Mean SUV were recorded. Statistical analysis was done using the SPSS software. (SPSS Inc.) (Version 18). Results: The absolute difference in average max SUV values i.e. Max (PET-CT) – Max (iPlan) for the time points T1, T2 and T3 were -0.168 (SD 0.175), -0.172 (SD 0.172) and -0.178 (SD 0.169). The difference in the minimum SUV values were -0.513 (SD 0.428), -0.311 (SD 0.358) and -0.303 (SD 0.322), respectively. Finally, the difference in the mean SUV values were -0.107 (SD 0.040), -0.096 (SD 0.067) and -0.072 (SD 0.044), respectively. Conclusions: Our study found out that the average difference in the two systems for maximum SUV values was < 0.2 absolute units.Our study suggests good reproducibility of SUV between the two systems. The relevance of these findings would be of seminal importance in current and future SUV-based PET-CT-based contouring in treatment planning systems.

A sixty year old male presented with a swelling in the upper lip. On cytopathology, the patient was diagnosed as a case of granulocytic sarcoma. His bone marrow examination was unremarkable. Patient was then treated by radiotherapy alone 30 Gray in 15 fractions and achieved complete response. Eighteen months after follow up the patient is absolutely normal. To our knowledge this is the first ever reported case of granulocytic sarcoma of lip.

Post-mastectomy radiotherapy (PMRT) in early breast cancer has long been a matter of debate among oncologists. The American Society of Clinical Oncology (ASCO) and the American Society for Therapeutic Radiology and Oncology (ASTRO) recommend the use of PMRT for patients, whose primary tumor is larger than 5 cm and/or patients who have four or more involved axillary lymph nodes (ALNs). Recently, few trials have been published showing the positive impact of PMRT on overall survival (OS) even in patients having 1-3 positive ALNs with T1-T2 primary disease or early breast cancer (EBC). So, it has become a matter of controversy whether to radiate or not to radiate? We have made an extensive search in the internet in Pubmed and other sites of medical publication mentioning our topic of discussion and reviewed the relevant articles. We nearly got 3,220 articles. After reviewing the available publications in the internet, we blended the elixir with our experience and tried to find an answer of our question. In conclusion, PMRT significantly and substantially improved loco-regional control and overall survival in patients with 1-3 positive nodes as in patients with 4 or more positive nodes, and nearly the same number of patients is needed to treat to avoid a loco-regional recurrence and/or death in both groups. We should reconsider the current guidelines for the indication for PMRT.

Primitive neuroectodermal tumor (PNET)/ewing's sarcoma is a rare neural crest tumor of central nervous system, thoracopulmonary regions, pelvis, and lower extremities. Visceral involvement by PNET is a rare phenomenon, with kidney being the most commonly involved organ. We report a 35-year-old Asian female presenting with left inguinal swelling, with computed tomography scan evidence of conglomerate lymph nodal mass in the left external iliac and inguinal region. A clinico-radiological diagnosis of lymphoproliferative disorder was made. She subsequently underwent excision biopsy. Histopathology of the biopsy specimen revealed completely effaced lymph nodal architecture, which was replaced by a tumor composed of nests of small, round, blue cells. On immunohistochemistry, the tumor cells were positive for CD99 and negative for CD3, CD20, leucocyte common antigen, epithelial membrane antigen, cytokeratin, desmin, vimentin, synaptophysin, and chromogranin A. Extensive search regarding any possible different site of involvement by the tumor was negative. The clinical presentation and histological, cytological, and immunohistochemical pattern, lead to the diagnosis of metastatic PNET of the left external iliac and inguinal lymph node with unknown primary origin. To the best of our knowledge, it is the first ever reported case of inguinal lymphadenopathy as the solitary metastatic presentation of PNET of unknown origin.

Cyclophosphamide therapy may rarely cause pigmentation of the nails which is of different patterns. We report a patient who developed pigmentation of nails after six cycles of cyclophosphamide, methotrexate, and 5-flourouracil chemotherapy, each repeated after 28 days for breast cancer. The patient developed nail pigmentation that started proximally and spread distally and involved all the nails of both hands and feet except the second and third toenails of right foot. Using Naranjo ADR Probability Scale, the case revealed a “probable” association with cyclophosphamide.