Search

Meloidogyne hapla is a serious pest of many cultivated plants. In response to the economic significance of the species, efforts are being made to develop a new method to reduce its harmful effects on crops. The aim of the study was to determine the effect of diffusates from seeds of selected species of legumes on the motility of second-stage juveniles and to evaluate the effect of meal from seeds of selected species of legume on the capacity to infect the roots of tomato plants by the J2 stage. The experiment examined the effect of diffusates on the motility of the J2 stage performed in Petri dishes, at temperatures of 10 °C, 17 °C and 21 °C. The evaluation of the J2 stage infectivity was estimated in a pot experiment performed under controlled conditions of 20 ± 1 °C. The pots were filled with sterile substrate mixed with meal from the seeds of selected plants at 1%, 5% and 10% of the substrate weight. The studies carried out in the Petri dishes showed varying effects of the seed diffusates from selected legume plants on the motility of the J2 stage of Meloidogyne hapla. J2 were found to lose their motility within 24 h after immersion in water containing seed diffusates from Melilotus albus, Trifolium pratense T. repens, in the temperature ranges investigated (10 °C, 17 °C and 21 °C). However, in a mixture of seed diffusates and soil filtrate from the root zone of tomato plants, the absence of motility in the second-stage juveniles was observed after 24 h at 17 °C and 21 °C, with seed diffusates from Lotus corniculatus, Medicago sativa, Medicago × varia, Melilotus officinalis, as well as Onobrychis viciifolia, Ornithopus sativus, Vicia sativa, used in the mixture. Galega officinalis Risa (GoR) seed diffusates were found to have an inhibiting effect on the motility of the J2 stage of M. hapla 24 h following the immersion of the J2 stage in the solution of the soil filtrate containing tomato root diffusates, at 21 °C. The J2 stage were not rendered immotile in all the experiment set-ups involving the seeds of V. faba, Lupinus spp., likewise in the control set-ups. In the pots studied, a significant effect of the addition of legume seed meal on the development of M. hapla nematodes and tomato plants was found. The introduction of Lotus corniculatus, Onobrychis viciifolia and Vicia sativa seed meal into the substrate in the proportion of 1%, 5% and 10% resulted in the inhibition of the J2 stage penetration into the roots of tomato plants at temperatures of 17 °C and 21 °C. With the admixture of the M. sativa and T. repens seed meal, within the temperature range investigated, no nematode infection was observed in the roots, regardless of the seed meal content in the substrate. As regards to the fresh weight, tomato plants grown in a substrate containing 1% and 5% of the V. sativa cv. Jaga seed meal were characterised by significantly higher plant weight values as compared to those grown in the control set-up. The obtained results imply that is advisable to expand the scope of research to include other economically important crops damaged by the northern root-knot nematode.

Hemp is a crop that has gained interest in Washington and Oregon. As with other crops, hemp production faces challenges due to biotic factors, including plant-parasitic nematodes. During a survey for plant-parasitic nematodes associated with hemp, Meloidogyne sp. was found in a composite root sample collected in Oregon. Morphological characterization of second-stage juveniles identified the nematode as Meloidogyne hapla. Molecular identification confirmed the population as M. hapla. To our knowledge, this is the first report of M. hapla on hemp in the Pacific Northwest of the United States.

Meloidogyne hapla is one of the most important nematode pathogens. It is a sedentary, biotrophic parasite of plants that overwinters in the soil or in diseased roots. The development of M. hapla is temperature dependent. Numerous studies have been performed on the effect of temperature on the development of M. hapla, but only a few of them analyzed the heat shock protein (hsp) genes. The aim of the study was to perform expression profiling of eight hsp genes (Mh-hsp90, Mh-hsp1, Mh-hsp4, Mh-hsp6, Mh-hsp60, Mh-dnj19, Mh-hsp43, and Mh-hsp12.2) at two development stages of M. hapla, i.e., in eggs and second-stage juveniles (J2). The eggs and J2 were incubated under cold stress (5 °C), heat stress (35 °C, 40 °C), and non-stress (10 °C, 20 °C, and 30 °C) conditions. Expression profiling was performed by qPCR. It was demonstrated that only two genes, Mh-hsp60 and Mh-dnj19, have been upregulated by heat and cold stress at both development stages. Heat stress upregulated the expression of more hsp genes than cold stress did. The level of upregulation of most hsp genes was more marked in J2 than in eggs. The obtained results suggest that the Mh-hsp90 and Mh-hsp1 genes can be used as bioindicators of environmental impacts on nematodes of the Meloidogyne genus. [ABSTRACT FROM AUTHOR]

Meloidogyne hapla is a serious pest of many cultivated plants. In response to the economic significance of the species, efforts are being made to develop a new method to reduce its harmful effects on crops. The aim of the study was to determine the effect of diffusates from seeds of selected species of legumes on the motility of second-stage juveniles and to evaluate the effect of meal from seeds of selected species of legume on the capacity to infect the roots of tomato plants by the J2 stage. The experiment examined the effect of diffusates on the motility of the J2 stage performed in Petri dishes, at temperatures of 10 °C, 17 °C and 21 °C. The evaluation of the J2 stage infectivity was estimated in a pot experiment performed under controlled conditions of 20 ± 1 °C. The pots were filled with sterile substrate mixed with meal from the seeds of selected plants at 1%, 5% and 10% of the substrate weight. The studies carried out in the Petri dishes showed varying effects of the seed diffusates from selected legume plants on the motility of the J2 stage of Meloidogyne hapla. J2 were found to lose their motility within 24 h after immersion in water containing seed diffusates from Melilotus albus, Trifolium pratense T. repens, in the temperature ranges investigated (10 °C, 17 °C and 21 °C). However, in a mixture of seed diffusates and soil filtrate from the root zone of tomato plants, the absence of motility in the second-stage juveniles was observed after 24 h at 17 °C and 21 °C, with seed diffusates from Lotus corniculatus, Medicago sativa, Medicago × varia, Melilotus officinalis, as well as Onobrychis viciifolia, Ornithopus sativus, Vicia sativa, used in the mixture. Galega officinalis Risa (GoR) seed diffusates were found to have an inhibiting effect on the motility of the J2 stage of M. hapla 24 h following the immersion of the J2 stage in the solution of the soil filtrate containing tomato root diffusates, at 21 °C. The J2 stage were not rendered immotile in all the experiment set-ups involving the seeds of V. faba, Lupinus spp., likewise in the control set-ups. In the pots studied, a significant effect of the addition of legume seed meal on the development of M. hapla nematodes and tomato plants was found. The introduction of Lotus corniculatus, Onobrychis viciifolia and Vicia sativa seed meal into the substrate in the proportion of 1%, 5% and 10% resulted in the inhibition of the J2 stage penetration into the roots of tomato plants at temperatures of 17 °C and 21 °C. With the admixture of the M. sativa and T. repens seed meal, within the temperature range investigated, no nematode infection was observed in the roots, regardless of the seed meal content in the substrate. As regards to the fresh weight, tomato plants grown in a substrate containing 1% and 5% of the V. sativa cv. Jaga seed meal were characterised by significantly higher plant weight values as compared to those grown in the control set-up. The obtained results imply that is advisable to expand the scope of research to include other economically important crops damaged by the northern root-knot nematode. [ABSTRACT FROM AUTHOR]

The rhizosphere bacteria Bacillus velezensis GJ-7, as a biological control agent (BCA), has significant biological control effects on Meloidogyne hapla, and has strong colonization ability in the root of Panax notoginseng. In this study, we conducted a comparative transcriptome analysis using P. notoginseng plant roots treated with B. velezensis GJ-7 or sterile water alone and in combination with M. hapla inoculation to explore the interactions involving the P. notoginseng plant, B. velezensis GJ-7, and M. hapla. Four treatments from P. notoginseng roots were sequenced, and twelve high-quality total clean bases were obtained, ranging from 3.57 to 4.74 Gb. The Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment showed that numerous DEGs are involved in the phenylpropane biosynthesis pathway and the MAPK signaling pathway in the roots of P. notoginseng with B. velezensis GJ-7 treatments. The analysis results of the two signaling pathways indicated that B. velezensis GJ-7 could enhance the expression of lignin- and camalexin-synthesis-related genes in plant roots to resist M. hapla. In addition, B. velezensis GJ-7 could enhance plant resistance to M. hapla by regulating the expression of resistance-related genes and transcription factors (TFs), including ETR, ERF, ChiB, WRKY22, and PR1. The expression of plant disease resistance genes in the roots of P. notoginseng with different treatments was validated by using real-time quantitative PCR (qRT-PCR), and the results were consistent with transcriptome sequencing. Taken together, this study indicated that B. velezensis GJ-7 can trigger a stronger defense response of P. notoginseng against M. hapla. [ABSTRACT FROM AUTHOR]

Highly adapted obligate endoparasites of the root system, root-knot nematodes (Meloidogyne spp.), cause great damage to agricultural crops. Our research is aimed at the assessment of nematicidal activity and effectiveness of antagonist fungal and bacterial strains against the most common type of root-knot nematode in the south of Russia. By means of molecular genetic identification, it was found that in the south of Russia, the species Meloidogyne hapla Chitwood, 1949 and Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 cause galls on the roots of open-ground and greenhouse tomato. Screening of microbial agents against second-stage juvenile (J2) M. hapla was carried out in the laboratory. At the end of the experiment, two liquid fungal cultures of Paecilomyces lilacinus BK-6 and Metarhizium anisopliae BK-2 were isolated, the nematicidal activity of which reached 100.0 and 70.2%, and exceeded the values of the biological standard (Nemotafagin-Mikopro) by 38.4% and 8.8%. The highest biological efficacy was noted in the liquid cultures of P. lilacinus BK-6, M. anisopliae BK-2, and Arthrobotrys conoides BK-8 when introduced into the soil before planting tomato. The number of formed galls on the roots was lower in comparison with the control by 81.0%, 75.5%, and 74.4%. [ABSTRACT FROM AUTHOR]

Assuming that the seeds of Vicia sativa L. have a stressful effect on J2 stage Meloidogyne hapla, we undertook research on the effect of these seeds on the motility and mortality of J2 and determined the expression levels of selected hsp genes in J2. The assessment of the effect of V. sativa seeds on the motility of M. hapla specimens consisted of observing the movement of J2 immersed in a seed diffusate or in a tomato root filtrate at temperatures of 10, 17, and 21°C. In J2 treated with V. sativa (cv. Ina) seed diffusates, the expression level of hsp genes was determined by qPCR. J2 exposed to V. sativa diffusates were found to lose their motility, while their mortality did not exceed 30%. J2 in the seed diffusate were characterized by an increase in the expression levels of the Mh-hsp90, Mh-hsp1, and Mh-hsp43 genes. It is suggested that the hsp90 gene may be a potential bioindicator of the environmental impact on Meloidogyne nematodes. The impaired ability to move in J2 of M. hapla is attributable to the occurrence of V. sativa seeds in their habitat. These studies may contribute to developing methods of reducing crop damage caused by M. hapla.

Meloidogyne hapla is one of the most important nematode pathogens. It is a sedentary, biotrophic parasite of plants that overwinters in the soil or in diseased roots. The development of M. hapla is temperature dependent. Numerous studies have been performed on the effect of temperature on the development of M. hapla, but only a few of them analyzed the heat shock protein (hsp) genes. The aim of the study was to perform expression profiling of eight hsp genes (Mh-hsp90, Mh-hsp1, Mh-hsp4, Mh-hsp6, Mh-hsp60, Mh-dnj19, Mh-hsp43, and Mh-hsp12.2) at two development stages of M. hapla, i.e., in eggs and second-stage juveniles (J2). The eggs and J2 were incubated under cold stress (5 °C), heat stress (35 °C, 40 °C), and non-stress (10 °C, 20 °C, and 30 °C) conditions. Expression profiling was performed by qPCR. It was demonstrated that only two genes, Mh-hsp60 and Mh-dnj19, have been upregulated by heat and cold stress at both development stages. Heat stress upregulated the expression of more hsp genes than cold stress did. The level of upregulation of most hsp genes was more marked in J2 than in eggs. The obtained results suggest that the Mh-hsp90 and Mh-hsp1 genes can be used as bioindicators of environmental impacts on nematodes of the Meloidogyne genus.

Coffee is an important commodity for Kenya, where production is steadily declining, despite a global rise in demand. Of the various constraints affecting production, plant-parasitic nematodes are a significant, but often overlooked, threat. As a perennial crop, treating plantations once infected with nematodes becomes difficult. The current study evaluated the drenching application of two biocontrol agents, Trichoderma asperellum and Purpureocillium lilacinum, for their nematode control efficacy, as well as their impact on the soil nematode community structure on mature, established coffee trees in Kenya. Seven Arabica coffee field trials were conducted over two years on trees of various ages. All the fields were heavily infested with Meloidogyne hapla, the first report of the species on coffee in Kenya. Both fungal biocontrol agents were detected endophytically infecting roots and recovered from soil but not until six months after initial applications. The population densities of M. hapla had significantly declined in roots of treated trees 12months after the initial application, although soil nematode density datawere similar across treatments. Based upon the maturity index and the Shannon index, treatment with T. asperellum led to improved soil health conditions and enrichment of diversity in themicrobial community. Application of P. lilacinum, in particular, led to an increased abundance of fungivorous nematodes, especially Aphelenchus spp., for which P. lilacinum would appear to be a preferred food source. The soils in the trials were all stressed and denuded, however, which likely delayed the impact of such treatments or detection of any differences between treatments using indices, such as the functional metabolic footprint, over the period of study. A longer period of study would therefore likely provide a better indication of treatment benefits. The current study positively demonstrates, however, the potential for using biologically based options for the environmentally and climate-smart management of nematode threats in a sustainable manner on established, mature coffee plantations. [ABSTRACT FROM AUTHOR]

Tomato plants are susceptible to significant yield losses when infested by the northern root-knot nematode, Meloidogyne hapla. While there are many options for conventional chemical management, few of these options offer effective control for organic growers or those who seek to adopt more environmentally considerate strategies. In this study, we showed that a new, biologically based product (referred to as “MN21.2”) has potential for controlling populations of the northern root-knot nematode, Meloidogyne hapla, as a pest of susceptible tomato (cv. Rutgers) in a greenhouse trial. This is significant because if this product’s efficacy is supported under field conditions, it may provide organic tomato growers with a valuable tool for fighting the plant-parasitic nematode pest, M. hapla.

The Bacillus velezensis GJ-7 strain isolated from the rhizosphere soil of Panax notoginseng showed high nematicidal activity and therefore has been considered a biological control agent that could act against the root-knot nematode Meloidogyne hapla. However, little was known about whether the GJ-7 strain could produce volatile organic compounds (VOCs) that were effective in biocontrol against M. hapla. In this study, we evaluated the nematicidal activity of VOCs produced by the fermentation of GJ-7 in three-compartment Petri dishes. The results revealed that the mortality rates of M. hapla J2s were 85% at 24 h and 97.1% at 48 h after treatment with the VOCs produced during GJ-7 fermentation. Subsequently, the VOCs produced by the GJ-7 strain were identified through solid-phase micro-extraction gas chromatography mass spectrometry (SPME-GC/MS). Six characteristic VOCs from the GJ-7 strain fermentation broth were identified, including 3-methyl-1-butanol, 3-methyl-2-pentanone, 5-methyl-2-hexanone, 2-heptanone, 2,5-dimethylpyrazine, and 6-methyl-2-heptanone. The in vitro experimental results from 24-well culture plates showed that the six volatiles had direct-contact nematicidal activity against M. hapla J2s and inhibition activity against egg hatching. In addition, 3-methyl-1-butanol and 2-heptanone showed significant fumigation effects on M. hapla J2s and eggs. Furthermore, all six of the VOCs repelled M. hapla J2 juveniles in 2% water agar Petri plates. The above data suggested that the VOCs of B. velezensis GJ-7 acted against M. hapla through multiple prevention and control modes (including direct-contact nematicidal activity, fumigant activity, and repellent activity), and therefore could be considered as potential biocontrol agents against root-knot nematodes. [ABSTRACT FROM AUTHOR]

Coffee is an important commodity for Kenya, where production is steadily declining, despite a global rise in demand. Of the various constraints affecting production, plant-parasitic nematodes are a significant, but often overlooked, threat. As a perennial crop, treating plantations once infected with nematodes becomes difficult. The current study evaluated the drenching application of two biocontrol agents, Trichoderma asperellum and Purpureocillium lilacinum, for their nematode control efficacy, as well as their impact on the soil nematode community structure on mature, established coffee trees in Kenya. Seven Arabica coffee field trials were conducted over two years on trees of various ages. All the fields were heavily infested with Meloidogyne hapla, the first report of the species on coffee in Kenya. Both fungal biocontrol agents were detected endophytically infecting roots and recovered from soil but not until six months after initial applications. The population densities of M. hapla had significantly declined in roots of treated trees 12 months after the initial application, although soil nematode density data were similar across treatments. Based upon the maturity index and the Shannon index, treatment with T. asperellum led to improved soil health conditions and enrichment of diversity in the microbial community. Application of P. lilacinum, in particular, led to an increased abundance of fungivorous nematodes, especially Aphelenchus spp., for which P. lilacinum would appear to be a preferred food source. The soils in the trials were all stressed and denuded, however, which likely delayed the impact of such treatments or detection of any differences between treatments using indices, such as the functional metabolic footprint, over the period of study. A longer period of study would therefore likely provide a better indication of treatment benefits. The current study positively demonstrates, however, the potential for using biologically based options for the environmentally and climate-smart management of nematode threats in a sustainable manner on established, mature coffee plantations.

The rhizosphere bacteria Bacillus velezensis GJ-7, as a biological control agent (BCA), has significant biological control effects on Meloidogyne hapla, and has strong colonization ability in the root of Panax notoginseng. In this study, we conducted a comparative transcriptome analysis using P. notoginseng plant roots treated with B. velezensis GJ-7 or sterile water alone and in combination with M. hapla inoculation to explore the interactions involving the P. notoginseng plant, B. velezensis GJ-7, and M. hapla. Four treatments from P. notoginseng roots were sequenced, and twelve high-quality total clean bases were obtained, ranging from 3.57 to 4.74 Gb. The Gene Ontology (GO) classification and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment showed that numerous DEGs are involved in the phenylpropane biosynthesis pathway and the MAPK signaling pathway in the roots of P. notoginseng with B. velezensis GJ-7 treatments. The analysis results of the two signaling pathways indicated that B. velezensis GJ-7 could enhance the expression of lignin- and camalexin-synthesis-related genes in plant roots to resist M. hapla. In addition, B. velezensis GJ-7 could enhance plant resistance to M. hapla by regulating the expression of resistance-related genes and transcription factors (TFs), including ETR, ERF, ChiB, WRKY22, and PR1. The expression of plant disease resistance genes in the roots of P. notoginseng with different treatments was validated by using real-time quantitative PCR (qRT-PCR), and the results were consistent with transcriptome sequencing. Taken together, this study indicated that B. velezensis GJ-7 can trigger a stronger defense response of P. notoginseng against M. hapla.

Highly adapted obligate endoparasites of the root system, root-knot nematodes (Meloidogyne spp.), cause great damage to agricultural crops. Our research is aimed at the assessment of nematicidal activity and effectiveness of antagonist fungal and bacterial strains against the most common type of root-knot nematode in the south of Russia. By means of molecular genetic identification, it was found that in the south of Russia, the species Meloidogyne hapla Chitwood, 1949 and Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 cause galls on the roots of open-ground and greenhouse tomato. Screening of microbial agents against second-stage juvenile (J2) M. hapla was carried out in the laboratory. At the end of the experiment, two liquid fungal cultures of Paecilomyces lilacinus BK-6 and Metarhizium anisopliae BK-2 were isolated, the nematicidal activity of which reached 100.0 and 70.2%, and exceeded the values of the biological standard (Nemotafagin-Mikopro) by 38.4% and 8.8%. The highest biological efficacy was noted in the liquid cultures of P. lilacinus BK-6, M. anisopliae BK-2, and Arthrobotrys conoides BK-8 when introduced into the soil before planting tomato. The number of formed galls on the roots was lower in comparison with the control by 81.0%, 75.5%, and 74.4%.

Root-knot nematodes in the genus Meloidogyne are an important group of plant-parasitic nematodes causing severe damage on agricultural crops worldwide. A study was conducted to identify the species of root-knot nematodes causing damage on honeybush monocultures and to assess the seasonal variations in the nematode population. Soil samples were collected from six experimental sites in Genadendal, Western Cape province of South Africa from 2016 to 2017. DNA was extracted from single-second stage juveniles and species identifi cation was done using species-specifi c sequence-characterised amplifi ed regions (SCAR) primers. Meloidogyne hapla and M. javanica were identifi ed from the sites. Mean population density of the nematodes varied significantly (p < 0.05) in the six sites, with the peak population being recorded in summer of 2017. The study suggests that seasonal variation in temperature and moisture could contribute to changes in the population density of root-knot nematodes in the soil.

The Bacillus velezensis GJ-7 strain isolated from the rhizosphere soil of Panax notoginseng showed high nematicidal activity and therefore has been considered a biological control agent that could act against the root-knot nematode Meloidogyne hapla. However, little was known about whether the GJ-7 strain could produce volatile organic compounds (VOCs) that were effective in biocontrol against M. hapla. In this study, we evaluated the nematicidal activity of VOCs produced by the fermentation of GJ-7 in three-compartment Petri dishes. The results revealed that the mortality rates of M. hapla J2s were 85% at 24 h and 97.1% at 48 h after treatment with the VOCs produced during GJ-7 fermentation. Subsequently, the VOCs produced by the GJ-7 strain were identified through solid-phase micro-extraction gas chromatography mass spectrometry (SPME-GC/MS). Six characteristic VOCs from the GJ-7 strain fermentation broth were identified, including 3-methyl-1-butanol, 3-methyl-2-pentanone, 5-methyl-2-hexanone, 2-heptanone, 2,5-dimethylpyrazine, and 6-methyl-2-heptanone. The in vitro experimental results from 24-well culture plates showed that the six volatiles had direct-contact nematicidal activity against M. hapla J2s and inhibition activity against egg hatching. In addition, 3-methyl-1-butanol and 2-heptanone showed significant fumigation effects on M. hapla J2s and eggs. Furthermore, all six of the VOCs repelled M. hapla J2 juveniles in 2% water agar Petri plates. The above data suggested that the VOCs of B. velezensis GJ-7 acted against M. hapla through multiple prevention and control modes (including direct-contact nematicidal activity, fumigant activity, and repellent activity), and therefore could be considered as potential biocontrol agents against root-knot nematodes.

Root-knot nematodes (RKNs) are soil-borne pathogens that severely affect Panax notoginseng growth and productivity. Thus, there is an urgent need for biological control agents or green nematicides to control root-knot nematodes. Rhizosphere bacteria can effectively control RKNs through different mechanisms. In this study, the three rhizosphere Bacillus strains, isolated from the root of P. notoginseng , were evaluated for the nematicidal activity and biological control efficacy against root-knot nematodes. In addition, we also evaluated the colonization ability of the two bacterial strains with significant biocontrol effect and dynamic regulation of genes related to systemic resistance in P. notoginseng. The rhizosphere Bacillus velezensis GJ-7 and Bacillus cereus NS-2 showed high nematicidal activity against Meloidogyne hapla in vitro and significantly reduced the number of root galls in three different control experiments. The results of colonization experiments showed that the strains GJ-7 and NS-2 colonized P. notoginseng root rapidly and stably. Additionally, the colonization of the strains NS-2 and GJ-7 activated the defense-responsive genes in P. notoginseng. These results indicated that the B. cereus strain NS-2 and B. velezensis strain GJ-7 have the potential for successful ecological niche occupation and enhance plant resistance and therefore could be considered as potential biocontrol agents against root-knot nematodes. [ABSTRACT FROM AUTHOR]

Root-knot nematodes (RKNs) are soil-borne pathogens that severely affect Panax notoginseng growth and productivity. Thus, there is an urgent need for biological control agents or green nematicides to control root-knot nematodes. Rhizosphere bacteria can effectively control RKNs through different mechanisms. In this study, the three rhizosphere Bacillus strains, isolated from the root of P. notoginseng, were evaluated for the nematicidal activity and biological control efficacy against root-knot nematodes. In addition, we also evaluated the colonization ability of the two bacterial strains with significant biocontrol effect and dynamic regulation of genes related to systemic resistance in P. notoginseng. The rhizosphere Bacillus velezensis GJ-7 and Bacillus cereus NS-2 showed high nematicidal activity against Meloidogyne hapla in vitro and significantly reduced the number of root galls in three different control experiments. The results of colonization experiments showed that the strains GJ-7 and NS-2 colonized P. notoginseng root rapidly and stably. Additionally, the colonization of the strains NS-2 and GJ-7 activated the defense-responsive genes in P. notoginseng. These results indicated that the B. cereus strain NS-2 and B. velezensis strain GJ-7 have the potential for successful ecological niche occupation and enhance plant resistance and therefore could be considered as potential biocontrol agents against root-knot nematodes.

The activity of alcohol extracts from 6 plant species was investigated with respect to the root-knot nematode-strawberry system. An evaluation was made of the nematostatic and nematicidal activity of the extracts. In production conditions, the most active was the extract Tanacetum vulgare at concentration 0.6%. It had the lowest M. hapla population density, with gall index and root/soil population densities not different than the oxamil treated plants and there were no stastically proved difference between T. vulgare and non-infested control.

Gene expression studies often require reliable housekeeping (HK) genes to accurately capture gene expression levels under given conditions. This is especially true for root-knot nematodes (RKN, Meloidogyne spp.), whose drastic developmental changes are strongly dependent upon their environment. Here we utilized a publicly available M. hapla RNAseq database to identify putative HK genes throughout the nematode lifecycle. We then validated these candidate HK genes on M. incognita in order to develop a small library of suitable HK genes for RKN. Seven putative HK genes were selected for validation based on high expression level and ease of primer design. The expression of these genes was quantified by qPCR at different developmental stages to capture the entire life cycle of M. incognita which included eggs and naive infective juveniles through 3-wk post inoculation. Two algorithms, geNorm and Normfinder, identified three genes (Disu, Poly, and Skinase) constitutively and uniformly expressed throughout the entire life cycle of RKN. We believe these genes are superior HK genes suitable to be used as internal reference genes at all stages of RKN. Importantly, while we identified Actin, a commonly used HK gene, as a candidate gene within our RNAseq analyses, our qPCR results did not demonstrate stable expression throughout the nematode life cycle of this gene. This study successfully validated suitable HK genes utilizing both RNAseq data and standard qPCR methods across two species of RKN; suitable HK genes are likely applicable to other species of RKN, or even plant-parasitic nematodes. Additional lists of potential HK genes are also provided if the nematode of interest does not have homologues of the three superior reference genes described here. Gene expression studies on RKN should use validated HK genes to ensure accurate representation of transcript abundance.

Root-knot nematodes (RKN; Meloidogyne spp.) are among the most damaging pests to tomato production in the USA and worldwide, with yield losses ranging from 25 to 100%. Host resistance conferred by the Mi gene in tomato is effective against some species of RKN (e.g. M. incognita, M. javanica, and M. arenaria); however, there are virulent species and lines including M. hapla and M. eterolobii that break Mi-mediated resistance. Plant innate immunity is another possible form of defense against pathogen attack and is known to be induced by chemical elicitors. Nicotinamide adenine dinucleotide (NAD) is one such chemical elicitor that regulates plant defense responses to multiple biotic stresses. In this study, we investigated the role of NAD in the context of induced tomato innate immunity and RKN pathogenicity in two tomato cultivars; VFN and Rutgers, with and without Mi, respectively. Single soil drench application of NAD 24 hr before nematode inoculation significantly induced defense response pathways, reduced infective-juveniles penetration, number of galls, and increased plant mass in both cultivars. Importantly, we observed no direct toxic effects of NAD on nematode viability and infectivity. The results presented here suggest that NAD induces resistance against RKN pathogenicity likely through the accumulation of tomato basal defense responses rather than the direct effect on the infective-juveniles behavior.

Root-knot nematodes (Meloidogyne spp.) are obligate endoparasites of a wide range of plant species. The infective stage is attracted strongly to and enters host roots at the zone of elongation, but the compounds responsible for this attraction have not been identified. We developed a simple assay to investigate nematode response to chemical gradients that uses Pluronic F-127, a synthetic block copolymer that, as a 23% aqueous solution, forms a liquid at low temperature and a gel at room temperature. Test chemicals are put into a modified pipette tip, or ‘chemical dispenser,’ and dispensers are inserted into the gel in which nematodes have been dispersed. Meloidogyne hapla is attracted to pH gradients formed by acetic acid and several other Brønsted acids and aggregates between pH 4.5 and 5.4. While this pH range was attractive to all tested root-knot nematode strains and species, the level of aggregation depended on the species/strain assessed. For actively growing roots, the pH at the root surface is most acidic at the zone of elongation. This observation is consistent with the idea that low pH is an attractant for nematodes. Root-knot nematodes have been reported to be attracted to carbon dioxide, but our experiments suggest that the observed attraction may be due to acidification of solutions by dissolved CO2 rather than to CO2 itself. These results suggest that Pluronic F-127 gel will be broadly applicable for examining responses of a range of organisms to chemical gradients or to each other.

Essential oils of medicinal and aromatic plants are important and promissing to manage the nematological problems in agriculture. In this study, five of the plants including Origanum onites, Salvia officinalis, Lippia citriodora, Mentha spicata and Mentha longifolia for egg hatching inhibition and four of the plants including Mentha piperita, Foeniculum vulgare, Coriandrum sativum and Ocimum basilicum for juvenile mortality were tested on Meloidogyne hapla under laboratory conditions. The oils were achieved by using water distillation method with a Clevenger apparatus. As the results of egg hatching trial, the highest egg hatching inhibition rate was found as 54% for O. onites. In addition, the other inhibition rates varied as 31.4%, 21.6%, 23.8%, 25.7% for the other plants, S. officinalis, M. longifolia, M. spicata and L. citriodora, respectively. Essential oil of each plant components were determined by gas chromatography (GC). Carvacrol was found as the main component (68.8%) of O. onites followed by Thujone 27.7% for S. officinalis, I-Menthone 76.9% for M. longifolia, Carvone 27.1% for M. spicata and Citral 19.3% for L. citriodora. For the juveile mortality, Mentha piperita showed the highest mortality rate as 93.2% and was followed by F. vulgare 72.9%, C. sativum 69.3% and O. basilicum 64.9%. The main component of the used plants were Carvone 39.3%, Anethole 40.2%, Linalool 81.3% and Linalool 54.6%, respectively. Keywords: Essential oil, Medicinal and aromatic plants, Meloidogyne hapla

Meloidogyne spp. are serious pests on many economically important plants, including food crops, vegetables, ornamental trees, and shrubs. Galled roots of Paulownia tomentosa Steud were collected from a plantation in the 2018 growing season in Poland. Morphological, morphometric, and molecular studies revealed the presence of Meloidogyne hapla in root systems and root zones of empress trees. To our knowledge, this is the first record of the occurrence of this nematode species on Paulownia tomentosa in Poland, as well as in Europe.

Essential oils of medicinal and aromatic plants are important and promissing to manage the nematological problems in agriculture. In this study, five of the plants including Origanum onites, Salvia officinalis, Lippia citriodora, Mentha spicata and Mentha longifolia for egg hatching inhibition and four of the plants including Mentha piperita, Foeniculum vulgare, Coriandrum sativum and Ocimum basilicum for juvenile mortality were tested on Meloidogyne hapla under laboratory conditions. The oils were achieved by using water distillation method with a Clevenger apparatus. As the results of egg hatching trial, the highest egg hatching inhibition rate was found as 54% for O. onites. In addition, the other inhibition rates varied as 31.4%, 21.6%, 23.8%, 25.7% for the other plants, S. officinalis, M. longifolia, M. spicata and L. citriodora, respectively. Essential oil of each plant components were determined by gas chromatography (GC). Carvacrol was found as the main component (68.8%) of O. onites followed by Thujone 27.7% for S. officinalis, I-Menthone 76.9% for M. longifolia, Carvone 27.1% for M. spicata and Citral 19.3% for L. citriodora. For the juveile mortality, Mentha piperita showed the highest mortality rate as 93.2% and was followed by F. vulgare 72.9%, C. sativum 69.3% and O. basilicum 64.9%. The main component of the used plants were Carvone 39.3%, Anethole 40.2%, Linalool 81.3% and Linalool 54.6%, respectively. [ABSTRACT FROM AUTHOR]

Root-knot nematodes (RKN; Meloidogyne spp.) are among the most damaging pests to tomato production in the USA and worldwide, with yield losses ranging from 25 to 100%. Host resistance conferred by the Mi gene in tomato is effective against some species of RKN (e.g. M. incognita, M. javanica, and M. arenaria); however, there are virulent species and lines including M. hapla and M. eterolobii that break Mimediated resistance. Plant innate immunity is another possible form of defense against pathogen attack and is known to be induced by chemical elicitors. Nicotinamide adenine dinucleotide (NAD) is one such chemical elicitor that regulates plant defense responses to multiple biotic stresses. In this study, we investigated the role of NAD in the context of induced tomato innate immunity and RKN pathogenicity in two tomato cultivars; VFN and Rutgers, with and without Mi, respectively. Single soil drench application of NAD 24 hr before nematode inoculation significantly induced defense response pathways, reduced infective-juveniles penetration, number of galls, and increased plant mass in both cultivars. Importantly, we observed no direct toxic effects of NAD on nematode viability and infectivity. The results presented here suggest that NAD induces resistance against RKN pathogenicity likely through the accumulation of tomato basal defense responses rather than the direct effect on the infective-juveniles behavior. [ABSTRACT FROM AUTHOR]

Gene expression studies often require reliable housekeeping (HK) genes to accurately capture gene expression levels under given conditions. This is especially true for root-knot nematodes (RKN, Meloidogyne spp.), whose drastic developmental changes are strongly dependent upon their environment. Here we utilized a publicly available M. hapla RNAseq database to identify putative HK genes throughout the nematode lifecycle. We then validated these candidate HK genes on M. incognita in order to develop a small library of suitable HK genes for RKN. Seven putative HK genes were selected for validation based on high expression level and ease of primer design. The expression of these genes was quantified by qPCR at different developmental stages to capture the entire life cycle of M. incognita which included eggs and naive infective juveniles through 3-wk post inoculation. Two algorithms, geNorm and Normfinder, identified three genes (Disu, Poly, and Skinase) constitutively and uniformly expressed throughout the entire life cycle of RKN. We believe these genes are superior HK genes suitable to be used as internal reference genes at all stages of RKN. Importantly, while we identified Actin, a commonly used HK gene, as a candidate gene within our RNAseq analyses, our qPCR results did not demonstrate stable expression throughout the nematode life cycle of this gene. This study successfully validated suitable HK genes utilizing both RNAseq data and standard qPCR methods across two species of RKN; suitable HK genes are likely applicable to other species of RKN, or even plant-parasitic nematodes. Additional lists of potential HK genes are also provided if the nematode of interest does not have homologues of the three superior reference genes described here. Gene expression studies on RKN should use validated HK genes to ensure accurate representation of transcript abundance. [ABSTRACT FROM AUTHOR]

ABSTRACT: In recent years "redness" has increasingly appeared in strawberry plants with leaves taking on a reddish color. No causal agent has been associated with plants. Since strawberries presented problems due to the incidence of nematodes, the purpose of this study was to look at the relationship between production, resistance to the Meloidogyne hapla nematode and the "redness" symptom in strawberry cultivars. Two experiments were performed, both with the 'Camino Real', 'Festival', 'Oso Grande', 'Albion' and 'Camarosa' cultivars. The first experiment was performed in the field, where the following were evaluated: strawberry production, fruit quality, macro and micronutrient contents in fruit and leaves, percentage of plant survival, incidence of nematodes, quantity of eggs in the roots and juveniles in the soil, and the incidence of Botrytis cinerea . In the second experiment, the strawberries were transplanted into pots and filled with pinus bark-based commercial substrate. Half the pots were inocculated with Meloidogyne hapla . Cultivars presented differences in fruit production and also in the incidence of "redness". Lowest performance in production was related to the high incidence of the nematode Meloidogyne hapla. 'Oso Grande' and 'Albion' presented nematode-resistant behavior. It was possible find a relationship between the incidence of the Meloidogyne hapla nematode, and the incidence of "redness" only 'Camino Real' cultivar.

Drosomycin-type antifungal peptides (DTAFPs) are natural effectors of the innate immune system, which are restrictedly distributed in plants and ecdysozoans. Mehamycin is a bi-domain DTAFP (abbreviated as bDTAFP) firstly found in the Northern root-knot nematode Meloidogyne hapla . Here, we report its structural and functional features and the evolution of bDTAFPs in nematodes. Different from classical DTAFPs, mehamycin contains an insertion, called single Disulfide Bridge-linked Domain (abbreviated as sDBD), located in a loop region of the drosomycin scaffold. Despite this, recombinant mehamycin likely adopts a similar fold to drosomycin, as revealed by the circular dichroism spectral analysis. Functionally, it showed some weak activity against three species of fungi but relatively stronger activity against seven species of Gram-positive bacteria, indicative of functional diversification between mehamycin and classical DTAFPs. By computational data mining of the nematode databases, we identified polymorphic genes encoding mehamycin and a new multigene family of bDTAFPs (named roremycins) from Rotylenchulus reniformis . A combination of data suggests that the origination of sDBDs from M. hapla and R. reniformis is a consequence of convergent evolution, in which some probably suffered positive selection during evolution. Our study may be valuable in understanding the role of these unique antimicrobial peptides in the innate immunity of nematodes. [ABSTRACT FROM AUTHOR]

We examined the efficacy of a bacterium for biocontrol of the root-knot nematode (RKN) Meloidogyne hapla in carrot (Daucus carota subsp. sativus) and tomato (Solanum lycopersicum). Among 542 bacterial isolates from various soils and plants, the highest nematode mortality was observed for treatments with isolate C1-7, which was identified as Bacillus cereus based on cultural and morphological characteristics, the Biolog program, and 16S rRNA sequencing analyses. The population density and the nematicidal activity of B. cereus C1-7 remained high until the end of culture in brain heart infusion broth, suggesting that it may have sustainable biocontrol potential. In pot experiments, the biocontrol efficacy of B. cereus C1-7 was high, showing complete inhibition of root gall or egg mass formation by RKN in carrot and tomato plants, and subsequently reducing RKN damage and suppressing nematode population growth, respectively. Light microscopy of RKN-infected carrot root tissues treated with C1-7 showed reduced formation of gall cells and fully developed giant cells, while extensive gall cells and fully mature giant cells with prominent cell wall ingrowths formed in the untreated control plants infected with RKNs. These histopathological characteristics may be the result of residual or systemic biocontrol activity of the bacterium, which may coincide with the biocontrol efficacies of nematodes in pots. These results suggest that B. cereus C1-7 can be used as a biocontrol agent for M. hapla.

These studies were employed to compare the potential of the nematophagous fungus Lecanicillium muscarium and the chemical nematicides Vydate and Basamid (G) with the fertilizer calcium cyanamide in the control of root knot nematode, Meloidogyne hapla, through soil application under greenhouse conditions. A significant (P=0.05) reduction in the number of galls and egg masses, eggs and juveniles (J2), and the reproduction factor (Rf=Pf/Pi) was observed in the plants treated with L. muscarium compared to the control. However, all chemical nematicides were also effective in reducing the nematode infestation significantly (P=0.05) in soil compared to the control, but there was no significant difference (P=0.05) among them. Plant growth was significantly (P=0.05) improved in the plants treated with L. muscarium. [ABSTRACT FROM AUTHOR]

Kiwifruit (Actinidia deliciosa [A. Chev.] C.F. Liang et A.R. Ferguson, Actinidiaceae) is an important commercial temperate fruit crop grown in different parts of the world. Root-knot nematodes (Meloidogyne spp.), are one of the most damaging plant-parasitic nematodes in kiwifruit growing regions. Among them, M. arenaria and M., hapla are both important root-knot nematode species of kiwifruit. Northern root-knot nematode, M. hapla, is one of the most damaging plant-parasitic nematodes in temperate regions. During the 2016 kiwi growing season, root-knot nematode-infested kiwi roots were obtained from one kiwi orchard located in the district of Altınordu, Ordu, Turkey. The identification of Meloidogyne species was confirmed by morphological, morphometric, and molecular characters based on amplification of two mitochondrial DNA regions that span the spacer and part of the adjacent large subunit rRNA (lrDNA) gene. The size of the intergenic spacer and sequence polymorphisms in the lrDNA that were revealed following digestion with the restriction enzymes HinfI and MnlI were used to assign haplotypes. The causal pests were identified as M. hapla and M. arenaria. This is the first record of M. hapla and M. arenaria infecting kiwi plants in Turkey. [ABSTRACT FROM AUTHOR]

Meloidogyne spp. are serious pests on many economically important plants, including food crops, vegetables, ornamental trees, and shrubs. Galled roots of Paulownia tomentosa Steud were collected from a plantation in the 2018 growing season in Poland. Morphological, morphometric, and molecular studies revealed the presence of Meloidogyne hapla in root systems and root zones of empress trees. To our knowledge, this is the first record of the occurrence of this nematode species on Paulownia tomentosa in Poland, as well as in Europe. [ABSTRACT FROM AUTHOR]

In recent years "redness" has increasingly appeared in strawberry plants with leaves taking on a reddish color. No causal agent has been associated with plants. Since strawberries presented problems due to the incidence of nematodes, the purpose of this study was to look at the relationship between production, resistance to the Meloidogyne hapla nematode and the "redness" symptom in strawberry cultivars. Two experiments were performed, both with the 'Camino Real', 'Festival', 'Oso Grande', 'Albion' and 'Camarosa' cultivars. The first experiment was performed in the field, where the following were evaluated: strawberry production, fruit quality, macro and micronutrient contents in fruit and leaves, percentage of plant survival, incidence of nematodes, quantity of eggs in the roots and juveniles in the soil, and the incidence of Botrytis cinerea. In the second experiment, the strawberries were transplanted into pots and filled with pinus bark-based commercial substrate. Half the pots were inocculated with Meloidogyne hapla. Cultivars presented differences in fruit production and also in the incidence of "redness". Lowest performance in production was related to the high incidence of the nematode Meloidogyne hapla. 'Oso Grande' and 'Albion' presented nematode-resistant behavior. It was possible find a relationship between the incidence of the Meloidogyne hapla nematode, and the incidence of "redness" only 'Camino Real' cultivar. [ABSTRACT FROM AUTHOR]

Root knot nematodes (RKN) can infect most of the world’s agricultural crop species and are among the most important of all plant pathogens. As yet however we have little understanding of their origins or the genomic basis of their extreme polyphagy. The most damaging pathogens reproduce by obligatory mitotic parthenogenesis and it has been suggested that these species originated from interspecific hybridizations between unknown parental taxa. We have sequenced the genome of the diploid meiotic parthenogen Meloidogyne floridensis, and use a comparative genomic approach to test the hypothesis that this species was involved in the hybrid origin of the tropical mitotic parthenogen Meloidogyne incognita. Phylogenomic analysis of gene families from M. floridensis, M. incognita and an outgroup species Meloidogyne hapla was carried out to trace the evolutionary history of these species’ genomes, and we demonstrate that M. floridensis was one of the parental species in the hybrid origins of M. incognita. Analysis of the M. floridensis genome itself revealed many gene loci present in divergent copies, as they are in M. incognita, indicating that it too had a hybrid origin. The triploid M. incognita is shown to be a complex double-hybrid between M. floridensis and a third, unidentified, parent. The agriculturally important RKN have very complex origins involving the mixing of several parental genomes by hybridization and their extreme polyphagy and success in agricultural environments may be related to this hybridization, producing transgressive variation on which natural selection can act. It is now clear that studying RKN variation via individual marker loci may fail due to the species’ convoluted origins, and multi-species population genomics is essential to understand the hybrid diversity and adaptive variation of this important species complex. This comparative genomic analysis provides a compelling example of the importance and complexity of hybridization in generating animal species diversity more generally.

Root-knot nematodes (RKN), Meloidogyne spp., were reported as the cause of carrot branched tuber on several vegetable production areas in Central and East Java. Species identification by molecular approach was conducted using infected carrot tubers from Agropolitan Cianjur, West Java. DNA was extracted from female nematodes and amplified using PCR with species specific primers (Fjav/Rjav for M. javanica, Far/Rar for M. arenaria, and Finc/Rinc for M. incognita) and multiplex primer (M. hapla, M. chitwoodi, and M. fallax). PCR product were sequenced without cloning. Based on nucleotide sequences, two species RKN were found associated with branched tuber disease of carrot in Agropolitan Cianjur, i.e M. javanica and M. hapla. Phylogenetic analysis showed that M. javanica from Cianjur was closely related to RKN from China with the homology level of 91.9%, whereas nucleotide sequence of M. hapla from Cianjur had high homology level (99.4% to 100%) with isolates from Swiss, USA, UK, and China. Key words: Meloidogyne hapla, M. javanica, phylogenetic, root-knot nematode

Growth of the Chinese herbal medicine industry has resulted in several new pests and diseases. China is one of the world largest producers of monkshood ( Aconitum carmichaelii Debx.), but an unidentified root-knot nematode has become a significant pest in the southwestern provinces of Yunnan and Sichuan. Morphological characteristics and the ribosomal DNA-internal transcribed spacer and D2-D3 region of the 28S ribosomal RNA gene sequences were used to identify the nematode as Meloidogyne hapla. Through investigation, this is the first report of M. hapla infecting monkshood in Yunnan and Sichuan Provinces.

Background Nematode-trapping fungi are soil-living fungi that capture and kill nematodes using special hyphal structures called traps. They display a large diversity of trapping mechanisms and differ in their host preferences. To provide insights into the genetic basis for this variation, we compared the transcriptome expressed by three species of nematode-trapping fungi (Arthrobotrys oligospora, Monacrosporium cionopagum and Arthrobotrys dactyloides, which use adhesive nets, adhesive branches or constricting rings, respectively, to trap nematodes) during infection of two different plant-pathogenic nematode hosts (the root knot nematode Meloidogyne hapla and the sugar beet cyst nematode Heterodera schachtii). Results The divergence in gene expression between the fungi was significantly larger than that related to the nematode species being infected. Transcripts predicted to encode secreted proteins and proteins with unknown function (orphans) were overrepresented among the highly expressed transcripts in all fungi. Genes that were highly expressed in all fungi encoded endopeptidases, such as subtilisins and aspartic proteases; cell-surface proteins containing the carbohydrate-binding domain WSC; stress response proteins; membrane transporters; transcription factors; and transcripts containing the Ricin-B lectin domain. Differentially expressed transcripts among the fungal species encoded various lectins, such as the fungal fruit-body lectin and the D-mannose binding lectin; transcription factors; cellsignaling components; proteins containing a WSC domain; and proteins containing a DUF3129 domain. A small set of transcripts were differentially expressed in infections of different host nematodes, including peptidases, WSC domain proteins, tyrosinases, and small secreted proteins with unknown function. Conclusions This is the first study on the variation of infection-related gene expression patterns in nematode-trapping fungi infecting different host species. A better understanding of these patterns will facilitate the improvements of these fungi in biological control programs, by providing molecular markers for screening programs and candidates for genetic manipulations of virulence and host preferences. [ABSTRACT FROM AUTHOR]

As high-throughput cDNA sequencing (RNA-Seq) is increasingly applied to hypothesis-driven biological studies, the prediction of protein coding genes based on these data are usurping strictly in silico approaches. Compared with computationally derived gene predictions, structural annotation is more accurate when based on biological evidence, particularly RNA-Seq data. Here, we refine the current genome annotation for the Meloidogyne hapla genome utilizing RNA-Seq data. Published structural annotation defines 14 420 protein-coding genes in the M. hapla genome. Of these, 25% (3751) were found to exhibit some incongruence with RNA-Seq data. Manual annotation enabled these discrepancies to be resolved. Our analysis revealed 544 new gene models that were missing from the prior annotation. Additionally, 1457 transcribed regions were newly identified on the ends of as-yet-unjoined contigs. We also searched for trans-spliced leaders, and based on RNA-Seq data, identified genes that appear to be trans-spliced. Four 22-bp trans-spliced leaders were identified using our pipeline, including the known trans-spliced leader, which is the M. hapla ortholog of SL1. In silico predictions of trans-splicing were validated by comparison with earlier results derived from an independent cDNA library constructed to capture trans-spliced transcripts. The new annotation, which we term HapPep5, is publically available at www.hapla.org. [ABSTRACT FROM AUTHOR]

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 μm (578.75 - 902.65 μm), maximum body width (W) = 471.97 ± 70.95 μm (318.7 - 586.3 μm), stylet length = 15.18 ± 0.96 μm (13.52 - 17.04 μm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 μm (2.60 - 3.80μm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 μm (375.3 - 552.5 μm), stylet length =12.59 ± 1.39 μm (10.5 - 16.8 μm), tail length= 53.35 ± 1.55 μm (51.8 - 54.9 μm), hyaline tail terminus =11.45 ± 0.65 μm (10.2 - 12.1 μm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.