Search

Background: Ruptured pseudoaneurysm of the distal anterior inferior cerebellar artery (AICA) in patients with a history of gamma knife surgery (GKS) for vestibular schwannoma (VS) is rare. Several previous reports have described treatment strategies for radiation-induced pseudoaneurysm in the AICA: either surgical trapping or endovascular parent artery occlusion of the AICA. Methods: We present the first case of endosaccular coil embolization for a ruptured pseudoaneurysm in a large-diameter AICA after GKS for VS, successfully preserving the parent AICA. Results: Major recanalization of the coiled pseudoaneurysm was observed on follow-up imaging 3 months after the initial endovascular treatment. The patient subsequently underwent additional endosaccular coil embolizations for regrowth of the treated pseudoaneurysm buried in the VS. Two years later, another major recanalization was detected, prompting further retreatment. Subsequently, the patient has remained in a stable condition for 4 years. Conclusions: We suggest that endosaccular coil embolization of the distal AICA aneurysm with parent artery preservation might be a safe and feasible treatment option for radiation-induced saccular pseudoaneurysm arising from a large parent artery. However, close and regular follow-up imaging and preparation for potential retreatment are necessary, as pseudoaneurysms coiled within VSs are prone to recanalization.

The analysis of gangliosides and glycosphingolipids is crucial for understanding cellular membrane structure and function as well as to accurately diagnose certain inborn errors of metabolism. GM2-gangliosidosis represents a rare and fatal group of lysosomal storage disorders characterized by accumulation of GM2 gangliosides in various tissues and organs. These disorders arise due to deficiency or functional impairment of the β-hexosaminidase A or B enzymes, which are responsible for degradation of GM2 ganglioside. Deficient enzyme activity primarily leads to the accumulation of GM2 gangliosides within the lysosomes of cells. Accurate and rapid diagnostic methods that detect increased levels of GM2 gangliosides in patients with GM2-gangliosidosis can play a significant role in early diagnosis and appropriate treatment of this condition. To address this need, we developed a multiplexed liquid chromatography-tandem mass spectrometry method targeting 84 species of gangliosides and other glycosphingolipids involved in ganglioside metabolism. Reproducibility, linearity, extraction efficiency, and sample stability were evaluated and proof-of-concept data obtained from analysis of serum samples from confirmed cases of GM2-gangliosidosis. This method has the potential to simultaneously monitor the biosynthesis of gangliosides and the lysosomal catabolic pathway serving as a valuable tool for screening and diagnosing an important group of lysosomal storage disorders., (© 2024. The Author(s).)

Background: In general, venous aneurysm associated with dural arteriovenous fistula (dAVF) is considered to be developed under long standing venous hypertension and manifested as venous ectasia of draining vein itself. However, discrete saccular shaped venous aneurysm without angiographic evidence of venous hypertension arising from the draining vein, like cerebral arterial aneurysm, is quite rare and its pathomechanism remains unclear in patients with dAVF., Case Summary: In this report, we present two cases of ruptured saccular venous aneurysms associated with dAVF without venous hypertension or venous ectasia. In both cases, significant curve or stenosis is observed in draining vein, which is located in just distal portion of the venous aneurysms. These aneurysms were successfully treated with a transarterial embolization. Underlying mechanism of venous aneurysms in these cases is discussed., Conclusion: Although there is little doubt that hemodynamic stress has a critical role in the development of venous aneurysms in patients with dAVF, preceding venous hypertension or venous ectasia is not necessary for development and enlargement of venous aneurysms. Considering the significant risk of rupture, a careful review of draining vein features including tortuosity or stenosis is needed, especially in venous aneurysms without evidence of venous hypertension., Competing Interests: Conflict-of-interest statement: There is no conflict-of-interest to declare., (©The Author(s) 2024. Published by Baishideng Publishing Group Inc. All rights reserved.)

Background: Endovascular therapy (EVT) is the treatment of choice for acute ischemic stroke (AIS) with large vessel occlusion. However, in many patients, successful EVT recanalization does not correspond to a clinical improvement, called futile recanalization (FR). We aimed to identify stroke risk factors and patient characteristics associated with FR in AIS with large core infarct (LCI)., Methods: A total of 137 patients with AIS with LCI treated by EVT at a single stroke center were retrospectively included from January 2016 to June 2023. LCI was defined by Diffusion-Weighted Imaging-Alberta Stroke Program Early Computed Tomography Score (DWI-ASPECT) < 6. Patient age, sex, modified Rankin Scale (mRS), National Institutes of Health Stroke Scale (NIHSS), time to treatment, risk factors, and radiologic findings were collected, and potential associations with FR were analyzed. FR was defined as successful reperfusion with modified Thrombolysis in Cerebral Infarction (mTICI) ≥ 2b but without functional independence at 90 days (mRS ≥ 3). A multivariate logistic regression analysis was conducted on the clinical characteristics of patients, based on the presence or absence of FR, and the factors influencing FR., Results: Of 137 patients, 120 showed successful recanalization (mTICI ≥ 2b). All patients were divided into FR (n = 80) and no FR (n = 40) groups. Older age (odds ratio [OR] 1.052, 95% confidence interval [CI] 1.002-1.105; p = 0.041), the higher the initial NIHSS score (OR 1.181, 95% CI 1.037-1.344; p = 0.012), and prior intravenous plasminogen activator (OR 0.310, 95% CI 0.118-0.813, p = 0.017) were independent influencing factors of FR., Conclusions: The older age, the higher the initial NIHSS, and not receiving intravenous plasminogen activator were independently associated with FR in AIS with LCI. These factors could identify poor responders to EVT recanalization., (© 2024. The Author(s).)

Background: Lung cancer, a leading global cause of cancer-related mortality, necessitates enhanced prognostic markers for improved treatment outcomes. We have previously shown a tumor suppressive role of cytosolic arginine sensor for mTORC1 subunit 1 (CASTOR1), which is targeted for degradation upon phosphorylation at S14 (pCASTOR1) in multiple types of cancer. This study focuses on the predictive value of pCASTOR1 in lung adenocarcinoma (LUAD) patients with KRAS mutations., Results: Employing a newly developed pCASTOR1 specific antibody, we found that tumor cells exhibited significantly elevated pCASTOR1 scores compared to non-tumor cells (P < 0.05). Higher pCASTOR1 scores predicted poorer overall survival (OS) (HR = 3.3, P = 0.0008) and relapse-free survival (RFS) (HR = 3.0, P = 0.0035) in male patients with KRAS mutations. pCASTOR1 remained an independent predictor for OS (HR = 4.1, P = 0.0047) and RFS (HR = 3.5, P = 0.0342) after controlling for other factors. Notably, in early-stage LUAD, elevated pCASTOR1 scores were associated with significantly worse OS (HR = 3.3, P = 0.0176) and RFS (HR = 3.1, P = 0.0277) in male patients with KRAS mutations, akin to late-stage patients., Conclusion: Elevated pCASTOR1 scores serve as biomarkers predicting poorer OS and RFS in male LUAD patients with KRAS mutations, offering potential clinical utility in optimizing treatment strategies for this subgroup., (© 2024. The Author(s).)

Objectives: This study aimed to identify radiologic features that differentiate lymphoma from metastasis manifesting as a solid enhancing mass lacking necrosis in the cerebellum. Methods: Pathologically confirmed 24 primary central nervous system lymphoma (PCNSL) and 32 metastasis patients with solid enhancing cerebellar masses without necrotic or hemorrhagic components were retrospectively analyzed. We evaluated the imaging characteristics using contrast-enhanced magnetic resonance imaging (MRI). The serrate sign was defined as a tumor spreading along white matter with branch-like enhancement or outward spikes. Results: The serrate sign was exclusively identified in the PCNSL group, showing a significant difference compared to the metastasis group (75.0% vs. 0%, p < 0.001). Homogeneous enhancement occurred more frequently in PCNSL than in metastasis (91.7% vs. 21.9%, p < 0.001). Conversely, bulging contour (62.5% vs. 4.2%, p < 0.001) and surface involvement (71.9% vs. 29.2%, p = 0.003) were more prevalent in metastasis than PCNSL. For predicting PCNSL, the serrate sign demonstrated 75.0% sensitivity, 100% specificity, 100% positive predictive value, 84.2% negative predictive value, and 89.3% accuracy. Conclusions: This study found that the serrate sign and homogeneous enhancement are reliable MRI features for differentiating cerebellar PCNSL from metastasis, whereas a bulging contour and surface involvement suggest metastasis. The serrate sign demonstrated diagnostic significance in differentiating PCNSL from metastasis.

Background: The inflammatory bowel disease (IBD), comprising Crohn's disease (CD) and ulcerative colitis (UC) is a complex disease with multifactorial etiology. The intestinal dysbiosis have been investigated to play an important role in IBD pathogenesis and disease activity. The aim of our study was to analyze the intestinal microbiota composition in IBD across different severity levels and the impact of biologic therapy on microbiota modulation., Methods: In this study, 27 IBD patients were recruited, including 14 patients undergoing biologic therapy for moderate to severe disease activity and 13 controls with inactive disease. The gut microbial composition was determined by 16 S ribosomal RNA gene sequencing of stool samples., Results: Biologic therapy led to significant clinical improvement in IBD disease activity after 48 weeks. About species richness, community alpha diversity was significant lower in active CD patients and enriched gradually after biologic therapy. The beta-diversity regard to the difference of bacterial community composition showed significant difference between patients in biologic and control group. A decrease in Firmicutes and increase in Bacteroidetes abundance were observed in patients with active disease, both in CD and UC. Biologic treatment induced shifts in gut microbiota, with increased Firmicutes and decreased Bacteroidetes, as well as improved F/B ratio gradually after treatment, correlating with disease activity., Conclusions: Our study suggested that gut microbiota differences changed after biologic therapies among IBD with different disease activity, and a rising Firmicutes/Bacteroidetes ratio could be a potential predictor for disease activity and treatment response monitoring., Competing Interests: Declaration of competing interest All authors declared there was no conflict of interests., (Copyright © 2024. Published by Elsevier B.V.)

Adventitial cystic disease (ACD), a rare vascular disease characterized by mucus accumulation in the adventitia of blood vessels, typically affects the popliteal artery. We present the case of a 61-year-old female diagnosed with ACD in 2018 who was initially treated with endovascular stenting and percutaneous aspiration of the cyst. The patient, who had been asymptomatic for 5 years, developed a stent fracture and pseudoaneurysm requiring surgical intervention. Despite initial successful treatment, complications such as stent fracture and recurrence can occur; therefore, surgical treatment is recommended to optimize outcomes in patients with ACD. Endovascular treatment and cyst aspiration should only be considered in cases with high surgical risk. After treatment, long-term follow-up and individualized management strategies are important to monitor ACD recurrence.

Variability between human pluripotent stem cell (hPSC) lines remains a challenge and opportunity in biomedicine. In this study, hPSC lines from multiple donors were differentiated toward neuroectoderm and mesendoderm lineages. We revealed dynamic transcriptomic patterns that delineate the emergence of these lineages, which were conserved across lines, along with individual line-specific transcriptional signatures that were invariant throughout differentiation. These transcriptomic signatures predicted an antagonism between SOX21-driven forebrain fates and retinoic acid-induced hindbrain fates. Replicate lines and paired adult tissue demonstrated the stability of these line-specific transcriptomic traits. We show that this transcriptomic variation in lineage bias had both genetic and epigenetic origins, aligned with the anterior-to-posterior structure of early mammalian development, and was present across a large collection of hPSC lines. These findings contribute to developing systematic analyses of PSCs to define the origin and consequences of variation in the early events orchestrating individual human development., Competing Interests: Declaration of interests The authors declare no competing interests., (Copyright © 2024 The Author(s). Published by Elsevier Inc. All rights reserved.)

Burn injuries, affecting local skin disruption as well as inducing systemic inflammatory responses, are presented as a global public health problem. To enhance the effects of burn wound healing, treatment must simultaneously regulate both re-epithelialization and hyperinflammation. Extracts of Sargassum horneri ( S. horneri ) have shown a potential to enhance skin wound healing through antioxidative properties, immune enhancement, and modulation of inflammatory responses. However, despite its promising application for burn wound healing, specific investigation into S. horneri -derived compounds for enhancing wound healing has not yet been conducted. In this research, we investigated the burn wound-healing effect of the low-temperature pulverization-specific S. horneri extract (LPSHE), which could not be detected using the room-temperature grinding method. In a mouse burn model with third-degree burn injuries, LPSHE accelerated re-epithelialization by promoting the increase in F-actin formation and reduced burn-induced ROS levels. Additionally, LPSHE significantly regulated hyperinflammation by reducing pro-inflammatory cytokines. Further investigation into molecular mechanisms using HaCaT keratinocytes also demonstrated beneficial effects on burn wound healing. Taken together, our findings suggested that LPSHE is a promising therapeutic candidate for enhancing burn wound healing. Furthermore, this research underscored the importance of low-temperature pulverization in discovering novel natural compounds from marine organisms., Competing Interests: No potential conflict of interest was reported by the author(s)., (© 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group.)

Obesity is the one of the most important components of metabolic syndrome. Because obesity related hypertension accounts for two thirds of essential hypertension, managing obesity and metabolic syndrome is a crucial task in the management of hypertension. However, the current non-pharmacological therapies have limitations for achieving or maintaining ideal body weight. Recently, glucagon-like peptide-1 receptor agonists (GLP1-RAs) have demonstrated excellent weight control effects, accompanied by corresponding reductions in blood pressure. GLP1-RAs have shown cardiovascular and renal protective effects in cardiovascular outcome trials both in primary and secondary prevention. In this document, the Korean Society of Hypertension intends to remark the current clinical results of GLP1-RAs and recommend the government and health-policy makers to define obesity as a disease and to establish forward-looking policies for GLP1-RA treatment for obesity treatment, including active reimbursement policies., (© 2024. The Author(s).)

This study investigated whether differences in survival rates and clinical outcomes exist in patients undergoing TKA by insurance type: National Health Insurance (NHI) vs. Medical Aid Program (MAP). This study conducted a retrospective analysis of 762 TKAs (NHI, n = 505; MAP, n = 257) with a mean follow-up of 8.4 ± 1.8 years. Patient-reported outcomes (PROMs) were evaluated using the American Knee Society's (AKS) score at the final follow-up. The survival rate of each group was analyzed using Kaplan-Meier survival analysis. Any postoperative complications and readmissions within 90 days of discharge were recorded and compared between the groups. There were no between-group differences in pre- to postoperative improvement in AKS scores. The estimated 10-year survival rates were 98.5% in the NHI group and 96.9% in the MAP group, respectively, with no significant differences ( p = 0.48). However, the length of hospital stay (LOS) was significantly longer in the MAP group than in the NHI group (13.4 days vs. 13.1 days, p = 0.03), and the transfer rate to other departments was significantly higher in the MAP group than in the NHI group (3.9% vs. 1.4%, p = 0.04). Readmission rates for orthopedic complications for 90 days were 3.0% in the NHI group and 3.5% in the MAP group, respectively ( p = 0.67). Patients' insurance type showed similar survival rates and clinical outcomes to those of primary TKA at a mean follow-up of 8.4 years, but the LOS and rate of transfer to other departments during hospitalization were influenced by insurance type.

Background: High-dose dual therapy (HDDT) using proton-pump inhibitors (PPI) and amoxicillin attracted attention for its simplicity and lower adverse event profile. Besides, vonoprazan is not available worldwide. This real-world study aims to compare the efficacy of esomeprazole-based and rabeprazole-based HDDT regimens and to identify clinical factors influencing outcomes., Methods: A retrospective study enrolled 346 Helicobacter pylori-infected naïve patients from January 2016 to August 2023. Patients were assigned to either a 14-day esomeprazole-based HDDT (EA-14; esomeprazole 40 mg t.i.d. and amoxicillin 750 mg q.i.d. for 14 days, n = 173) or a 14-day rabeprazole-based HDDT (RA-14; rabeprazole 20 mg and amoxicillin 750 mg q.i.d. for 14 days, n = 173)., Results: Five patients from the EA-14 group and 10 from the RA-14 group were lost to follow-up, resulting in 168 and 163 patients for the per-protocol (PP) analysis, respectively. Eradication rates for the EA-14 and RA-14 groups were 90.2% and 80.9% (P = 0.014) in intention-to-treat (ITT) analysis; and 92.9% and 85.9% (P = 0.039) in PP analysis. Adverse event rates were similar between the two groups (11.9% vs 11.7%, P = 0.944). In multiple logistic regression analysis, age≧60 was associated with eradication failure (P = 0.046) and a trend of significance for smoking (P = 0.060) in the EA-14 group but not in the RA-14 group. A trend of significance was also observed for eradication regimens (EA-14 vs RA-14) (P = 0.071). The antibiotic resistance rates were amoxicillin (2.3%), clarithromycin (14.7%), metronidazole (40.3%), and dual resistance to clarithromycin and metronidazole (7.0%)., Conclusions: Esomeprazole-based HDDT achieved over 90% eradication rates but rabeprazole-based HDDT, which failed., Competing Interests: Declaration of competing interest All authors declared there was no conflict of interests., (Copyright © 2024. Published by Elsevier B.V.)

The implications of the early phases of human telencephalic development, involving neural stem cells (NSCs), in the etiology of cortical disorders remain elusive. Here, we explored the expression dynamics of cortical and neuropsychiatric disorder-associated genes in datasets generated from human NSCs across telencephalic fate transitions in vitro and in vivo. We identified risk genes expressed in brain organizers and sequential gene regulatory networks across corticogenesis revealing disease-specific critical phases, when NSCs are more vulnerable to gene dysfunctions, and converging signaling across multiple diseases. Moreover, we simulated the impact of risk transcription factor (TF) depletions on different neural cell types spanning the developing human neocortex and observed a spatiotemporal-dependent effect for each perturbation. Finally, single-cell transcriptomics of newly generated autism-affected patient-derived NSCs in vitro revealed recurrent alterations of TFs orchestrating brain patterning and NSC lineage commitment. This work opens new perspectives to explore human brain dysfunctions at the early phases of development., Competing Interests: COMPETING INTERESTS The authors declare no conflict of interest.

Background. The aim of the study was to synthesize liposomal nanoparticles loaded with temozolomide and ferucarbotran (LTF) and to evaluate the theranostic effect of LTF in the glioma model. Methods. We synthesized an LTF that could pass through the Blood Brain Barrier (BBB) and localize in brain tumor tissue with the help of magnet guidance. We examined the chemical characteristics. Cellular uptake and cytotoxicity studies were conducted in vitro. A biodistribution and tumor inhibition study was conduted using an in vivo glioma model. Results. The particle size and surface charge of LTF show 108 nm and -38 mV, respectively. Additionally, the presence of ferucarbotran significantly increased the contrast agent effect of glioma compared to the control group in MR imaging. Magnet-guided LTF significantly reduced the tumor size compared to control and other groups. Furthermore, compared to the control group, our results demonstrate a significant inhibition in brain tumor size and an increase in lifespan. Conclusions. These findings suggest that the LTF with magnetic guidance represents a novel approach to address current obstacles, such as BBB penetration of nanoparticles and drug resistance. Magnet-guided LTF is able to enhance therapeutic efficacy in mouse brain glioma.

Background: Statins may reduce the risk of recurrent gallstone disease by decreasing bile cholesterol saturation and pathogenicity. However, limited studies have investigated this issue. This study aimed to assess whether statin doses and serum cholesterol levels were associated with a decreased risk of recurrent biliary stone diseases after the first event index, with a follow-up time of 15 years., Methods: Based on the Chang Gung Research Database (CGRD) between January 1, 2001, and December 31, 2020, we enrolled 68,384 patients with the International Classification of Diseases, Ninth and Tenth Revision codes of choledocholithiasis. After exclusions, 32,696 patients were divided into non-statin (<28 cDDD, cumulative defined daily doses) (n = 27,929) and statin (≥28 cDDD) (n = 4767) user groups for analysis. Serum cholesterol trajectories were estimated using group-based trajectory modeling (n = 8410)., Results: The statin users had higher Charlson Comorbidity Index (CCI) scores than the non-statin users. Time-dependent Cox regression analysis showed that statin use >365 cDDD was associated with a significantly lower risk of recurrent biliary stones (adjusted hazard ratio [aHR] = 0.28, 95% CI, 0.24-0.34; p < 00.0001), acute pancreatitis (aHR = 0.24, 95% CI, 0.17-0.32, p < 00.0001), and cholangitis (aHR = 0.28, 95% CI, 0.25-0.32, p < 00.0001). Cholecystectomy was also a protective factor for recurrent biliary stones (aHR = 0.41, 95% CI, 0.37-0.46; p < 00.0001). The higher trajectory serum cholesterol group (Group 3) had a lower risk trend for recurrent biliary stones (aHR = 0.79, p = 0.0700) and a lower risk of cholangitis (aHR = 0.79, p = 0.0071)., Conclusion: This study supports the potential benefits of statin use and the role of cholecystectomy in reducing the risk of recurrent biliary stone diseases., Competing Interests: Declaration of Competing Interest The authors declared that they have no conflicts of interest., (Copyright © 2024 Formosan Medical Association. Published by Elsevier B.V. All rights reserved.)

Objectives: Genetic factors are a major cause of osteoporosis. The present study evaluated the association of the apolipoprotein E (ApoE) genotype with bone mineral density (BMD) and its response to menopausal hormone therapy (MHT) in postmenopausal Korean women., Methods: This retrospective cohort study included 172 postmenopausal women with no endocrine diseases, medications, or lifestyles that would affect bone metabolism and who were continuously treated with MHT for at least 2 years. BMDs were measured at baseline and periodically., Results: Linear regression analysis demonstrated similar baseline BMDs at the lumbar spine, but significantly lower at the femur neck and total hip in the ApoE ε4 carrier than in the noncarrier group, after controlling for age, body mass index, and history of MHT usage. Overall, the Wilcoxon signed rank test demonstrated that MHT increased the BMD percentage change at all three regions, and the Generalized Estimating Equation (GEE) demonstrated significant time trends at the lumbar spine and femur neck. ApoE ε4 noncarriers exhibited a significant time trend in BMD changes at the femur neck, whereas ε4 carriers exhibited a time trend at the lumbar spine. However, BMD changes at each time point were comparable at all regions between the groups. Notably, GEE adjusted for baseline characteristics and BMD revealed a significant interaction effect of time and ApoE ε4 allele in BMD changes at the femur neck., Conclusions: Postmenopausal Korean women carrying the ApoE ε4 allele demonstrated a lower hip BMD compared with ε4 noncarriers. Furthermore, the ε4 allele may modulate hip BMD responses to MHT., Competing Interests: No potential conflict of interest relevant to this article was reported., (Copyright © by The Korean Society of Menopause.)

Background & Aims: Metabolomic and lipidomic analyses provide an opportunity for novel biological insights. Cholangiocarcinoma (CCA) remains a highly lethal cancer with limited response to systemic, targeted, and immunotherapeutic approaches. Using a global metabolomics and lipidomics platform, this study aimed to discover and characterize metabolomic variations and associated pathway derangements in patients with CCA., Methods: Leveraging a biospecimen collection, including samples from patients with digestive diseases and normal controls, global serum metabolomic and lipidomic profiling was performed on 213 patients with CCA and 98 healthy controls. The CCA cohort of patients included representation of intrahepatic, perihilar, and distal CCA tumours. Metabolome-wide association studies utilizing multivariable linear regression were used to perform case-control comparisons, followed by pathway enrichment analysis, CCA subtype analysis, and disease stage analysis. The impact of biliary obstruction was evaluated by repeating analyses in subsets of patients only with normal bilirubin levels., Results: Of the 420 metabolites that discriminated patients with CCA from controls, decreased abundance of cysteine-glutathione disulfide was most closely associated with CCA. Additional conjugated bile acid species were found in increased abundance even in the absence of clinically relevant biliary obstruction denoted by elevated serum bilirubin levels. Pathway enrichment analysis also revealed alterations in caffeine metabolism and mitochondrial redox-associated pathways in the serum of patients with CCA., Conclusions: The presented metabolomic and lipidomic profiling demonstrated multiple alterations in the serum of patients with CCA. These exploratory data highlight novel metabolic pathways in CCA and support future work in therapeutic targeting of these pathways and the development of a precision biomarker panel for diagnosis., Impact and Implications: Cholangiocarcinoma (CCA) is a highly lethal hepatobiliary cancer with limited treatment response, highlighting the need for a better understanding of the disease biology. Using a global metabolomics and lipidomics platform, we characterized distinct changes in the serum of 213 patients with CCA compared with healthy controls. The results of this study elucidate novel metabolic pathways in CCA. These findings benefit stakeholders in both the clinical and research realms by providing a foundation for improved disease diagnostics and identifying novel targets for therapeutic design., Competing Interests: The authors have no relevant conflicts of interest. Please refer to the accompanying ICMJE disclosure forms for further details., (© 2024 The Author(s).)

Alzheimer's disease (AD) is a progressive disease leading to cognitive decline, and to prevent it, researchers seek to diagnose mild cognitive impairment (MCI) early. Particularly, non-amnestic MCI (naMCI) is often mistaken for normal aging as the representative symptom of AD, memory decline, is absent. Subjective cognitive decline (SCD), an intermediate step between normal aging and MCI, is crucial for prediction or early detection of MCI, which determines the presence of AD spectrum pathology. We developed a computer-based cognitive task to classify the presence or absence of AD pathology and stage within the AD spectrum, and attempted to perform multi-stage classification through electroencephalography (EEG) during resting and memory encoding state. The resting and memory-encoding states of 58 patients (20 with SCD, 10 with naMCI, 18 with aMCI, and 10 with AD) were measured and classified into four groups. We extracted features that could reflect the phase, spectral, and temporal characteristics of the resting and memory-encoding states. For the classification, we compared nine machine learning models and three deep learning models using Leave-one-subject-out strategy. Significant correlations were found between the existing neurophysiological test scores and performance of our computer-based cognitive task for all cognitive domains. In all models used, the memory-encoding states realized a higher classification performance than resting states. The best model for the 4-class classification was cKNN. The highest accuracy using resting state data was 67.24%, while it was 93.10% using memory encoding state data. This study involving participants with SCD, naMCI, aMCI, and AD focused on early Alzheimer's diagnosis. The research used EEG data during resting and memory encoding states to classify these groups, demonstrating the significance of cognitive process-related brain waves for diagnosis. The computer-based cognitive task introduced in the study offers a time-efficient alternative to traditional neuropsychological tests, showing a strong correlation with their results and serving as a valuable tool to assess cognitive impairment with reduced bias., (© 2024. The Author(s).)

Background: Pancreaticobiliary maljunction (PBM) is a known risk factor for biliary tract cancer. However, its association with carcinoma of the papilla of Vater (PVca) remains unknown. We report a case with PVca that was thought to be caused by the hyperplasia-dysplasia-carcinoma sequence, which is considered a mechanism underlying PBM-induced biliary tract cancer., Case Presentation: A 70-year-old woman presented with white stool and had a history of cholecystectomy for the diagnosis of a non-dilated biliary tract with PBM. Esophagogastroduodenoscopy revealed a tumor in the papilla of Vater, and PVca was histologically proven by biopsy. We finally diagnosed her with PVca concurrent with non-biliary dilated PBM (cT1aN0M0, cStage IA, according to the Union for International Cancer Control, 8th edition), and subsequently performed subtotal stomach-preserving pancreaticoduodenectomy. Pathological findings of the resected specimen revealed no adenomas and dysplastic and hyperplastic mucosae in the common channel slightly upstream of the main tumor, suggesting a PBM related carcinogenic pathway with hyperplasia-dysplasia-carcinoma sequence. Immunostaining revealed positivity for CEA. CK7 positivity, CK20 negativity, and MUC2 negativity indicated that this PVca was of the pancreatobiliary type. Genetic mutations were exclusively detected in tumors and not in normal tissues, and bile ducts from formalin-fixed paraffin-embedded samples included mutated-ERBB2 (Mutant allele frequency, 81.95%). Moreover, of the cell-free deoxyribonucleic acid (cfDNA) extracted from liquid biopsy mutated-ERBB2 was considered the circulating-tumor deoxyribonucleic acid (ctDNA) of this tumor., Conclusions: Herein, we report the first case of PVca with PBM potentially caused by a "hyperplasia-dysplasia-carcinoma sequence" detected using immunostaining and next-generation sequencing. Careful follow-up is required if pancreaticobiliary reflux persists, considering the possible development of PVca., (© 2024. The Author(s).)

Advanced molecular and cellular technologies provide promising tools for wildlife and biodiversity conservation. Induced pluripotent stem cell (iPSC) technology offers an easily accessible and infinite source of pluripotent stem cells, and have been derived from many threatened wildlife species. This paper describes the first successful integration-free reprogramming of adult somatic cells to iPSCs, and their differentiation, from three endangered Southeast Asian primates: the Celebes Crested Macaque (Macaca nigra), the Lar Gibbon (Hylobates lar), and the Siamang (Symphalangus syndactylus). iPSCs were also generated from the Proboscis Monkey (Nasalis larvatus). Differences in mechanisms could elicit new discoveries regarding primate evolution and development. iPSCs from endangered species provides a safety net in conservation efforts and allows for sustainable sampling for research and conservation, all while providing a platform for the development of further in vitro models of disease., (© 2024. The Author(s).)

Introduction: The heterogeneity of depressive and anxiety disorders complicates clinical management as it may account for differences in trajectory and treatment response. Self-schemas, which can be determined by Self-Referential Judgements (SRJs), are heterogeneous yet stable. SRJs have been used to characterize personality in the general population and shown to be prognostic in depressive and anxiety disorders., Methods: In this study, we used SRJs from a Self-Referential Encoding Task (SRET) to identify clusters from a clinical sample of 119 patients recruited from the Institute of Mental Health presenting with depressive or anxiety symptoms and a non-clinical sample of 115 healthy adults. The generated clusters were examined in terms of most endorsed words, cross-sample correspondence, association with depressive symptoms and the Depressive Experiences Questionnaire and diagnostic category., Results: We identify a 5-cluster solution in each sample and a 7-cluster solution in the combined sample. When perturbed, metrics such as optimum cluster number, criterion value, likelihood, DBI and CHI remained stable and cluster centers appeared stable when using BIC or ICL as criteria. Top endorsed words in clusters were meaningful across theoretical frameworks from personality, psychodynamic concepts of relatedness and self-definition, and valence in self-referential processing. The clinical clusters were labeled "Neurotic" (C1), "Extraverted" (C2), "Anxious to please" (C3), "Self-critical" (C4), "Conscientious" (C5). The non-clinical clusters were labeled "Self-confident" (N1), "Low endorsement" (N2), "Non-neurotic" (N3), "Neurotic" (N4), "High endorsement" (N5). The combined clusters were labeled "Self-confident" (NC1), "Externalising" (NC2), "Neurotic" (NC3), "Secure" (NC4), "Low endorsement" (NC5), "High endorsement" (NC6), "Self-critical" (NC7). Cluster differences were observed in endorsement of positive and negative words, latency biases, recall biases, depressive symptoms, frequency of depressive disorders and self-criticism., Discussion: Overall, clusters endorsing more negative words tended to endorse fewer positive words, showed more negative biases in reaction time and negative recall bias, reported more severe depressive symptoms and a higher frequency of depressive disorders and more self-criticism in the clinical population. SRJ-based clustering represents a novel transdiagnostic framework for subgrouping patients with depressive and anxiety symptoms that may support the future translation of the science of self-referential processing, personality and psychodynamic concepts of self-definition to clinical applications., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Tan, Wang, Tan, Ong, Ooi, Lee, Rane, Tey, Chua, Goh, Lam, Chakraborty, Yew, Ong, Kee, Lim, Hashim, Lu, Meany, Tolomeo, Lee, Tan and Keppo.)

Our study retrospectively investigated differential patterns of the functional connectivity (FC) of core brain regions synchronous with morphometric changes associated with sexual dysfunction in menopausal women, and their correlations with sexual hormones. Twenty-three premenopausal women (mean age: 41.52 ± 7.38 years) and 21 menopausal women (mean age: 55.52 ± 2.80 years) underwent sex hormone level measurements with high-resolution T1 and functional magnetic resonance imaging (MRI) during rest, neutral, and sexual arousal conditions. Analysis of covariance adjusted for age was used to compare the FC and gray matter (GM) volume between the two groups. Menopausal women showed lower GM volumes in the superior frontal gyrus (SFG), superior temporal pole, parahippocampal gyrus (PHG), hippocampus (Hip), amygdala (Amg), and cerebellum (Cb) compared to premenopausal women ( p < 0.05). In addition, compared to premenopausal women, menopausal women showed decreased FC of seed regions involved in the SFG, frontal eye fields, and Amg, as well as target regions involved in the PHG, Hip, inferior frontal gyrus, Cb, and vermis ( p < 0.005). Furthermore, the FC between the right Amg and right Cb and between the left Amg and right Cb during sexual arousal in both groups was positively correlated with total estrogen and estradiol levels, respectively ( p < 0.01). The GM volume values in the right Amg and right Cb were positively correlated with total estrogen and estradiol levels ( p < 0.05). Our study demonstrated an association between menopause-related differential FC and GM volume variations and fluctuating sex hormones. Our findings highlight that overlapping brain regions with functional alterations and morphometric changes are closely linked with menopausal symptom-related decreases in sexual arousal and hormone levels.

Hybrid therapy is a recommended first-line anti- H. pylori treatment option in the American College of Gastroenterology guidelines, the Bangkok Consensus Report on H. pylori management, and the Taiwan H. pylori Consensus Report. However, the cure rates of eradication therapy in some countries are suboptimal, and the factors affecting the treatment efficacy of hybrid therapy remain unclear. The aim of this study is to identify the independent risk factors predicting eradication failure of hybrid therapy in the first-line treatment of H. pylori infection. A retrospective cohort study was conducted on 589 H. pylori -infected patients who received 14-day hybrid therapy between September 2008 and December 2021 in ten hospitals in Taiwan. The patients received a hybrid therapy containing a dual regimen with a proton pump inhibitor (PPI) plus amoxicillin for an initial 7 days and a quadruple regimen with a PPI plus amoxicillin, metronidazole and clarithromycin for a final 7 days. Post-treatment H. pylori status was assessed at least 4 weeks after completion of treatment. The relationships between eradication rate and 13 host and bacterial factors were investigated via univariate and multivariate analyses. In total, 589 patients infected with H. pylori infection were included in the study. The eradication rates of hybrid therapy were determined as 93.0% (95% confidence interval (CI): 90.9-95.1%), 94.4% (95% CI: 93.8-97.2%) and 95.5%% (95% CI: 93.8-97.2%) by intention-to-treat, modified intention-to-treat and per-protocol analyses, respectively. Univariate analysis showed that the eradication rate of clarithromycin-resistant strains was lower than that of clarithromcyin-susceptible strains (83.3% (45/54) vs. 97.6%% (280/287); p < 0.001). Subjects with poor drug adherence had a lower cure rate than those with good adherence (73.3% (11/15) vs. 95.5% (534/559); p = 0.005). Other factors such as smoking, alcohol drinking, coffee consumption, tea consumption and type of PPI were not significantly associated with cure rate. Multivariate analysis revealed that clarithromcyin resistance of H. pylori and poor drug adherence were independent risk factors related to eradication failure of hybrid therapy with odds ratios of 4.8 (95% CI: 1.5 to 16.1; p = 0.009) and 8.2 (95% CI: 1.5 to 43.5; p = 0.013), respectively. A 14-day hybrid therapy has a high eradication rate for H. pylori infection in Taiwan, while clarithromycin resistance of H. pylori and poor drug adherence are independent risk factors predicting eradication failure of hybrid therapy.

To investigate the incidence and impact of superior cerebellar artery (SCA) occlusion remaining after thrombectomy for acute basilar artery occlusion (BAO). We retrospectively analyzed data from 116 patients who underwent thrombectomy for BAO. The patency of SCA was assessed on final angiograms. Clinical and radiologic data of the patients were retrieved from a prospectively collected database and analyzed. All patients underwent pretreatment and follow-up DWI to detect new infarctions in SCA territory. Ten patients (8.6%) had SCA occlusions on final angiograms. Of these, two patients had bilateral occlusions. A new infarction with a diameter ranged from 4 to 11 mm in corresponding SCA territory occurred in 5 of 10 patients. No patients with SCA occlusions experienced symptomatic cerebellar hemorrhage or malignant cerebellar infarction. Nine of 12 SCA occlusions showed spontaneous recanalization on follow-up CT angiography. Four of 10 patients showed 90-day favorable outcome (mRS 0-3) and 90-day mortality occurred in one patient. SCA occlusions remaining after thrombectomy for acute BAO had a benign clinical course. Most of these lesions recanalized spontaneously. Our study suggests that attempts to recanalize remnant SCA occlusion may be unnecessary after basilar artery thrombectomy., (© 2023. The Author(s).)

Meningiomas are common primary brain tumors, and their accurate preoperative grading is crucial for treatment planning. This study aimed to evaluate the value of radiomics and clinical imaging features in predicting the histologic grade of meningiomas from preoperative MRI. We retrospectively reviewed patients with intracranial meningiomas from two hospitals. Preoperative MRIs were analyzed for tumor and edema volumes, enhancement patterns, margins, and tumor-brain interfaces. Radiomics features were extracted, and machine learning models were employed to predict meningioma grades. A total of 212 patients were included. In the training group (Hospital 1), significant differences were observed between low-grade and high-grade meningiomas in terms of tumor volume ( p = 0.012), edema volume ( p = 0.004), enhancement ( p = 0.001), margin ( p < 0.001), and tumor-brain interface ( p < 0.001). Five radiomics features were selected for model development. The prediction model for radiomics features demonstrated an average validation accuracy of 0.74, while the model for clinical imaging features showed an average validation accuracy of 0.69. When applied to external test data (Hospital 2), the radiomics model achieved an area under the receiver operating characteristics curve (AUC) of 0.72 and accuracy of 0.69, while the clinical imaging model achieved an AUC of 0.82 and accuracy of 0.81. An improved performance was obtained from the model constructed by combining radiomics and clinical imaging features. In the combined model, the AUC and accuracy for meningioma grading were 0.86 and 0.73, respectively. In conclusion, this study demonstrates the potential value of radiomics and clinical imaging features in predicting the histologic grade of meningiomas. The combination of both radiomics and clinical imaging features achieved the highest AUC among the models. Therefore, the combined model of radiomics and clinical imaging features may offer a more effective tool for predicting clinical outcomes in meningioma patients.

Periodontitis is a severe gum infection leading to chronic inflammation in the gums, damage of tissues around teeth, and destruction of alveolar bones. Porphyromonas gingivalis is the major causative pathogen that induces periodontitis. Numerous probiotic bacteria are reported to produce antibacterial substances against pathogens especially oral pathogens, and these are proposed as preventive measures for periodontitis. In this study, Lacticaseibacillus paracasei LMT18-32 was evaluated and its antibacterial activity against P. gingivalis, and antioxidant activity in vitro were established. In addition, when L. paracasei LMT18-32 was administered to periodontitis induced mice, it successfully alleviated the alveolar bone loss and suppressed induced expression of proinflammatory and tissue destruction related genes in the gingival tissue. In conclusion, L. paracasei LMT18-32 is proposed as a potential probiotics to prevent periodontitis., Competing Interests: Conflict of interestAll authors are or were employees of Medytox Inc., Republic of Korea., (© The Korean Society of Food Science and Technology 2023. Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.)

Background: KRAS mutation positive lung cancer is known to be clinically characterized by older age, males, and smokers. It is reported to be more common in mucinous adenocarcinoma, but all reports are based on analysis of tissue samples. Recently, blood samples have become available for analysis, suggesting a low detection rate of circulating tumor DNA in histological types, especially mucinous adenocarcinoma. In this study, we investigated the clinical characteristics of KRAS mutation-positive cases in the analysis of blood specimens, as these remain unclear., Methods: The clinical background of patients with KRAS mutation among those who underwent next-generation sequencing (NGS) analysis using blood samples was evaluated., Results: NGS analysis was performed on 214 blood samples. KRAS mutations were detected in blood samples in 33 cases (15.4%), of which 31 cases (14.5%) had a histological pathology diagnosis. Mucinous adenocarcinoma accounted for 28.6% of cases with positive blood and tissue specimens, 10.0% of cases with positive blood specimens only, and 57.1% of cases with positive tissue specimens only. Mucinous adenocarcinoma tended to be less common in cases with positive blood specimens. In KRAS-positive patients with lung metastasis only, only one nonmucinous adenocarcinoma had a positive blood sample, and the others all had mucinous adenocarcinomas with positive tissue samples only., Conclusion: The results showed that the detection rate of KRAS-positive lung cancers detected by blood and tissue samples differs, and that the detection rate of blood samples may be poor, especially in the case of mucinous adenocarcinoma with lung metastases only., (© 2023 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.)

Background: Vaccinating adolescents is a vital strategy to enhance population protection without imposing overly restrictive measures on our daily lives during the COVID-19 pandemic. As teenagers gain more independence, their willingness to get vaccinated may depend on their own understanding of the pandemic, vaccines, and mental well-being, as well as that of their caregivers. Our study aimed to examine how Taiwanese adolescents and their caregivers perceive COVID-19 vaccination and assess their mental health status., Methods: We invited a total of 138 vaccinated adolescents and their caregivers to complete several questionnaires, including the Drivers of COVID-19 Vaccination Acceptance Scale (DrVac-COVID19S), Impact of Event Scale (IES), and Chinese Health Questionnaire (CHQ)., Results: Among the adolescents, 76.8% considered the BNT162b2 vaccine (Pfizer-BioNTech) as the ideal option for COVID-19 vaccination, while 27.5% of caregivers expressed acceptance of any available vaccine. Adolescents scored higher than caregivers in terms of vaccine value (p<0.001) and autonomy (p<0.001), but lower in knowledge (p<0.001), as assessed by the DrVac-COVID19S subscales. The adolescents' intention to get vaccinated against COVID-19 (DrVac-COVID19S total score) showed a positive correlation with their perception of the pandemic's impact (IES scores, r=0.214, p=0.012) and their caregivers' vaccination intention (r=0.371, p<0.001). Furthermore, adolescents' mental health demonstrated a positive association with the mental health of their caregiver (CHQ total scores, r=0.481, p<0.001)., Conclusion: During the COVID-19 outbreak, caregivers have encountered heightened levels of mental stress, and this stress has been found to be positively correlated with the mental stress experienced by adolescents and their intentions regarding vaccination. These findings can serve as crucial references for healthcare providers and governments when formulating vaccination policies for adolescents in the future., Competing Interests: The authors report no conflicts of interest in this work., (© 2023 Hwang et al.)

Tacrolimus intra-patient variability (IPV) is a novel predictive marker for long-term kidney transplantation outcomes. We examined the association between IPV and calcineurin inhibitor (CNI) nephrotoxicity and the impact of pharmacogenes on CNI nephrotoxicity and IPV. Among kidney transplant recipients at our hospital between January 2013 and December 2015, the records of 80 patients who underwent 1-year protocol renal allograft biopsy and agreed to donate blood samples for genetic analysis were retrospectively reviewed. The cohort was divided into the low and high IPV groups based on a coefficient variability cutoff value (26.5%). In multivariate analysis, the IPV group was involved in determining CNI nephrotoxicity (HR 4.55; 95% CI 0.05-0.95; p = 0.043). The 5-year graft survival was superior in the low IPV group than in the high IPV group (100% vs 92.4% respectively, p = 0.044). Analysis of the time above therapeutic range (TATR) showed higher CNI nephrotoxicity in the high IPV with high TATR group than in the low IPV with low TATR group (35.7% versus 6.7%, p = 0.003). Genetic analysis discovered that CYP3A4 polymorphism (rs2837159) was associated with CNI nephrotoxicity (HR 28.23; 95% CI 2.2-355.9; p = 0.01). In conclusion, high IPV and CYP3A4 polymorphisms (rs2837159) are associated with CNI nephrotoxicity., (© 2023. Springer Nature Limited.)

Background: Endoscopic Retrograde Cholangiopancreatography (ERCP), used for choledocholithiasis treatment, carries a risk of pyogenic liver abscess (PLA) due to communication between the biliary system and bowel contents. However, limited data exists on this issue. This study aims to identify the risk factors pertaining to liver abscesses following ERCP lithotomy., Methods: We conducted a retrospective case series across multiple centers to evaluate patients who developed PLA after ERCP for choledocholithiasis. Data was obtained from the Chung Gung Research Database (January 2001 to December 2018). Out of 220 enrolled patients, 195 were categorized in the endoscopic sphincterotomy (ES) group, while 25 were in the non-ES group for further analysis., Results: The non-ES group had significantly higher total bilirubin levels compared to the ES group (4.3 ± 5.8 vs 1.9 ± 2.0, p<0.001). Abscess size, location, and distribution (single or multiple) were similar between the two groups. The most common pathogens were Klebsiella pneumoniae and Escherichia coli . Pseudomonas infection was significantly less prevalent in the ES group compared to the non-ES group (3.6% vs 16.7%, p=0.007). Patients with concurrent malignancies (HR: 9.529, 95% CI: 2.667-34.048, p=0.001), elevated total bilirubin levels (HR: 1.246, 95% CI: 1.062-1.461, p=0.007), multiple abscess lesions (HR: 5.146, 95% CI: 1.777-14.903, p=0.003), and growth of enterococcus pathogens (HR: 4.518, 95% CI: 1.290-15.823, p=0.001) faced a significantly higher risk of in-hospital mortality., Conclusion: PLA incidence was higher in the ES group compared to the non-ES group following ERCP for choledocholithiasis. Attention should be given to significant risk factors, including concurrent malignancies, elevated total bilirubin levels, multiple abscess lesions, and growth of enterococcus pathogens, to reduce in-hospital mortality., Competing Interests: The authors declared that they have no conflicts of interest in this work. All authors have no commercial association, such as consultancies, stock ownership or other equity interests or patent-licensing arrangements., (© 2023 Liu et al.)

A standard bismuth quadruple therapy, a fluoroquinolone-containing triple (or quadruple) therapy or a proton pump inhibitor (PPI)-amoxicillin high-dose dual therapy has been recommended as a second-line treatment for Helicobacter pylori infection by the Maastricht VI/Florence Consensus Report. The major shortcoming of levofloxacin-amoxicillin triple therapy is low cure rate for eradicating levofloxacin-resistant strains. With the rising prevalence of levofloxacin-resistant strains, levofloxacin-amoxicillin triple therapy cannot reliably achieve a high eradication rate for second-line treatment of H. pylori infection in most countries now. The present article aims to review current second-line eradication regimens with a per-protocol eradication rate exceeding 85% in most geographic areas. Recently, a novel tetracycline-levofloxacin quadruple therapy consisting of a PPI, bismuth, tetracycline, and levofloxacin for rescue treatment of H. pylori infection has been developed. The new therapy achieved a higher per-protocol eradication rate than levofloxacin-amoxicillin triple treatment in a randomized controlled trial (98% versus 69%). Additionally, the tetracycline-levofloxacin quadruple therapy also exhibits a higher eradication rate than amoxicillin-levofloxacin quadruple therapy. High-dose dual PPI-amoxicillin therapy is another novel second-line treatment for H. pylori infection. The new therapy can achieve an eradication rate of 89% by per-protocol analysis for the second-line treatment in Taiwan. Recently, levofloxacin-based sequential quadruple therapy and potassium-competitive acid blocker have also been applied in the second-line treatment of H. pylori infection. A meta-analysis revealed that a vonoprazan-based regimen has significant superiority over a PPI-based regimen for second-line H. pylori eradication therapy. In conclusion, the eradication rate of levofloxacin-amoxicillin triple therapy is suboptimal in the second-line treatment of H. pylori infection now. Currently, a standard bismuth quadruple therapy (tetracycline-metronidazole quadruple therapy), a tetracycline-levofloxacin quadruple therapy, an amoxicillin-levofloxacin quadruple therapy, a levofloxacin-based sequential quadruple therapy or a high-dose PPI-amoxicillin dual therapy is recommended for the second-line treatment of H. pylori infection., Competing Interests: The authors declare that there is no conflict of interest., (© The Author(s), 2023.)

Radical nephrectomy with tumor thrombectomy for advanced renal cell carcinoma is an oncologically relevant approach that can achieve long-term survival even in the presence of distant metastases. However, the surgical techniques pose significant challenges. The objective of this clinical review was to present technical recommendations for tumor thrombectomy in the vena cava to facilitate surgical treatment. Transesophageal echocardiography is required to prepare for this procedure. Cardiopulmonary bypass should be considered when the tumor thrombus has invaded the cardiac chamber and clamping is not feasible because of the inability to milk the intracardiac chamber thrombus in the caudal direction. Prior to performing a cavotomy, it is crucial to clamp the contralateral renal vein and infrarenal and suprahepatic inferior vena cava (IVC). If the suprahepatic IVC is separated from the surrounding tissue, it can be gently pulled down toward the patient's leg until the lower margin of the atrium becomes visible. Subsequently, the tumor thrombus should be carefully pulled downward to a position where it can be clamped. Implementing the Pringle maneuver to reduce blood flow from the hepatic veins to the IVC during IVC cavotomy is simpler than clamping the hepatic veins. Sequential clamping is a two-stage method of dividing thrombectomy by clamping the IVC twice, first suprahepatically and then midretrohepatically. This sequential clamping technique helps minimize hypotension status and the Pringle maneuver time compared to single clamping. Additionally, a spiral cavotomy can decrease the degree of primary closure narrowing. The oncological prognoses of patients can be improved by incorporating these technical recommendations.

Atypical variceal bleeding, which primarily stems from extrahepatic portal vein obstruction (EHPVO), is a severe complication of pancreatic hepatobiliary surgery. This review provides insights into this condition's incidence, diagnosis, and management strategies. The treatment modalities for atypical variceal bleeding resulting from EHPVO range from endoscopic intervention to surgical procedures, including direct variceal ligation and shunt surgery. Here, we discuss the efficacy and potential limitations of each treatment approach. Additionally, we explored the utility and therapeutic advantages of the meso-Rex shunt, a particularly promising surgical technique for mitigating the hemodynamic and metabolic impacts of EHPVO.

Background: Gastroesophageal reflux disease (GERD) affects a significant proportion of individuals, with life stress being a contributing factor. This study aimed to investigate the correlation between psychosomatic evaluations, heart rate variability (HRV), and GERD in a cohort of individuals. Additionally, the study aimed to analyze the sequencing changes following proton pump inhibitor (PPI) treatment and identify predictive factors associated with refractory GERD., Methods: A prospective cohort of 105 individuals with reflux esophagitis and a control group of 50 participants without acid reflux symptoms were enrolled. Psychosomatic evaluations, including GERDQ, GERDQLQ, RSI, BAI, BDI, and SSS-8, were assessed at baseline and during treatment. HRV parameters were also evaluated. Multivariate analysis was used to identify predictive factors for refractory GERD. PPIs were administered regularly for the initial 2 months and then used on-demand. Refractory GERD was defined as less than 50% improvement in symptom relief or GERDQLQ score ≥ 20 after 8 weeks of PPI treatment., Results: The GERD group had higher scores in all psychosomatic evaluations compared to the control group (all p -values < 0.001). There were no significant changes in any parameters of HRV before and after treatment in the GERD group. Strong and consistent correlations were observed between GERD symptoms and psychological scores (BAI, BDI, and SSS-8) across all time points (W0, W4, and W8). Sequential reductions in GERD symptom scores and psychosomatic evaluations were observed during the initial eight weeks of treatment. Higher GERDQ (≥10) and SSS-8 (≥12) scores were predictive of refractory GERD ( p = 0.004 and p = 0.009, respectively)., Conclusions: This study emphasizes the importance of considering physiological and psychological factors in the management of GERD. Psychosomatic evaluations provide valuable insights for assessing and treating GERD patients. Integrating stress management and comprehensive assessments into personalized treatment strategies is crucial.

The duplication of the peripheral myelin protein 22 (PMP22) gene causes a demyelinating type of neuropathy, commonly known as Charcot-Marie-Tooth disease type 1A (CMT1A). Development of effective drugs for CMT1A still remains as an unmet medical need. In the present study, we assessed the role of the transforming growth factor beta 4 (TGFβ4)/Nodal axis in the pathogenesis of CMT1A. First, we identified PMP22 overexpression-induced Nodal expression in Schwann cells, which might be one of the downstream effectors in CMT1A. Administration of Nodal protein at the developmental stage of peripheral nerves induced the demyelinating phenotype in vivo. Second, we further isolated TGFβ4 as an antagonist that could abolish Nodal-induced demyelination. Finally, we developed a recombinant TGFβ4-fragment crystallizable (Fc) fusion protein, CX201, and demonstrated that its application had promyelinating efficacy in Schwann cells. CX201 administration improved the demyelinating phenotypes of CMT1A mouse models at both pre-symptomatic and post-symptomatic stages. These results suggest that the TGFβ4/Nodal axis plays a crucial role in the pathogenesis of CMT1A and might be a potential therapeutic target for CMT1A., (© The Author(s) 2023. Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.)

Recent studies have reported the impact of previous COVID-19 infection on the early clinical outcome after total knee arthroplasty (TKA). However, the timing of infection before the surgery was not constant and a study on patients with COVID-19 infection within 1 week after TKA is lacking. This study aimed to determine the effect of COVID-19 infection within one week after TKA on the postoperative outcomes and to compare the early clinical outcomes to those who were not infected with COVID-19 before and after surgery. No significant differences were observed between the two groups in terms of clinical outcomes or complications. The length of the hospital stay (LOS) was significantly longer for the COVID-19 group than for the non-COVID-19 group ( p < 0.05). The erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) levels were higher for the study group on postoperative days 9 and 12 than for those in the control group ( p < 0.05). However, D-dimer levels were not significantly different between the two groups. We should cautiously consider that COVID-19 infection within 1 week after TKA may be associated with increased ESR, CRP levels, and length of hospital stay, but they are not associated with the worsening of early clinical outcomes or the occurrence of complications.

Lipids play crucial biological roles in health and disease, including in cancers. The phosphatidylinositol 3-kinase (PI3K) signaling pathway is a pivotal promoter of cell growth and proliferation in various types of cancer. The somatic mutations in PIK3CA , the gene coding for the catalytic subunit p110α of PI3K, are frequently present in cancer cells, including breast cancer. Although the most prominent mutants, represented by single amino acid substitutions in the helical domain in exon 9 (E545K) and the kinase domain in exon 20 (H1047R) are known to cause a gain of PI3K function, activate AKT signaling and induce oncogenic transformation, the effect of these mutations on cellular lipid profiles has not been studied. We carried out untargeted lipidomics using liquid chromatography-tandem mass spectrometry to detect the lipid alterations in mammary gland epithelial MCF10A cells with isogenic knockin of these mutations. A total of 536 species of lipids were analyzed. We found that the levels of monosialogangliosides, signaling molecules known to enhance cell motility through PI3K/AKT pathway, were significantly higher in both mutants. In addition, triglycerides and ceramides, lipid molecules known to be involved in promoting lipid droplet production, cancer cell migration and invasion, were increased, whereas lysophosphatidylcholines and phosphatidylcholines that are known to inhibit cancer cell motility were decreased in both mutants. Our results provide novel insights into a potential link between altered lipid profile and carcinogenesis caused by the PIK3CA hotspot mutations. In addition, we suggest untargeted lipidomics offers prospects for precision/personalized medicine by unpacking new molecular substrates of cancer biology.

Introduction: This study evaluates the effectiveness of a hospital-based return to work (RTW) programme in facilitating injured workers to RTW earlier through personalised case management. Factors associated with programme effectiveness are also examined., Method: This was a quasi-experimental study comparing 81 participants who underwent conventional treatment before the RTW programme with 108 participants who directly received the RTW intervention. Analyses included time to RTW and the factors associated with dropout. Stratified analysis and multivariate logistic regression were used to mitigate potential selection bias from the additional recruitment process for the intervention group., Results: Participants in the intervention group returned to work 59.5 days earlier, with 84% able to RTW 6 months post injury compared with the control (63%; P<0.01). Stratified analysis found the intervention to be associated with better RTW outcomes among males, younger workers, non-residents, blue-collared workers, workers from the construction, marine, manufacturing and metalworking industries, and workers having lower Work Ability score (WAS), while light-duty provision was a possible confounder. The better outcomes in the intervention group were also independent of company size and injury severity. After adjusting for the above factors, the intervention group had 2.2 times higher odds of RTW at 6 months (95% confidence interval 0.84&ndash;5.90). Lower WAS and longer delay in initial RTW assessment were associated with delayed RTW within the intervention group. Migrant workers experienced higher dropout rates, thus being identified as a vulnerable group., Conclusion: The RTW coordination model of care is effective in facilitating RTW, with early programme referral being an important facilitator and WAS as a useful screening tool for delayed RTW., Competing Interests: The authors declare no affiliations or financial involvement with any commercial organisation having a direct financial interest in the subject or materials discussed in the article.

Introduction: Cannabis has consistently been the third most commonly abused drug among drug arrestees in Singapore over the past few years. Accordingly, this study aimed to understand the profile of cannabis users in Singapore and explore the effects of cannabis use on drug progression., Methods: A total of 450 participants who had used cannabis at least once in their lifetime were recruited from the National Addictions Management Service, prisons, the Community Rehabilitation Centre and halfway houses from August 2017 to May 2018. A face-to-face questionnaire was administered and descriptive analyses were conducted., Results: The mean participant age was 40.9 ± 14.51 years, and 93.1% of them were male. The participants generally initiated cannabis use during adolescence, at a mean onset age of 16.5 ± 4.46 years. Most (89.6%) were introduced to cannabis by peers. Approximately half of them (46.9%) had used cannabis before other illicit drugs and 42.1% of them had used heroin as the succeeding drug., Conclusion: In Singapore, cannabis use is often initiated during adolescence, largely under peer influence. Cannabis users may progress to other illicit drugs, particularly heroin, later in life., Competing Interests: None

Background: Psoriasis imposes a substantial burden on patients' social, emotional, physical, and family life. Although psoriasis has no complete cure, various treatments are available to control its symptoms and improve a patients' quality of life., Objective: We aimed to compare the effectiveness of biologic versus non-biologic treatments on health-related quality of life among patients with psoriasis in Malaysia., Methods: This retrospective cross-sectional study evaluated data of adult patients diagnosed with psoriasis during 2007-18 from the Malaysian Psoriasis Registry. Baseline demographics, disease, and treatment characteristics were described. For a subset of patients treated with biologics and non-biologics who had baseline and 6-month follow-up data available, changes in the mean Dermatology Life Quality Index scores and the proportion of patients with a clinically relevant improvement (≥ 4 points) post-treatment were assessed., Results: Overall, 15,238 adult patients with psoriasis from the Malaysian Psoriasis Registry were included in the analysis. Patients receiving biologics showed a statistically significant reduction in the mean Dermatology Life Quality Index scores after 6 months compared with those receiving non-biologic treatment (- 5.7 vs - 0.8%; p < 0.001). The proportion of patients who achieved a ≥ 4-point improvement in Dermatology Life Quality Index scores was approximately two times greater in the biologic-treated group versus the non-biologic-treated group (56.4 vs 27.7%)., Conclusions: Biologic treatment showed a greater reduction in the Dermatology Life Quality Index scores of patients with psoriasis versus non-biologic treatment. These results highlight the importance of early treatment with more efficacious treatment options, such as biologic therapies, to improve the overall health-related quality of life of patients with psoriasis., (© 2023. The Author(s).)

Purpose: To investigate the utility of preoperative multiparametric magnetic resonance imaging (mpMRI)-based clinical-radiomic analysis combined with machine learning (ML) algorithms in predicting the expression of the Ki-67 proliferative index and p53 tumor suppressor protein in patients with meningioma., Methods: This multicenter retrospective study included 483 and 93 patients from two centers. The Ki-67 index was classified into high (Ki-67≥5%) and low (Ki-67<5%)-expressed groups, and the p53 index was classified into positive (p53≥5%) and negative (p53<5%)-expressed groups. Clinical and radiological features were analyzed using univariate and multivariate statistical analyses. Six ML models were performed with different types of classifiers to predict Ki-67 and p53 status., Results: In the multivariate analysis, larger tumor volumes (p<0.001), irregular tumor margin (p<0.001), and unclear tumor-brain interface (p<0.001) were independently associated with a high Ki-67 status, whereas the presence of both necrosis (p=0.003) and the dural tail sign (p=0.026) were independently associated with a positive p53 status. A relatively better performance was yielded from the model constructed by combined clinical and radiological features. The area under the curve (AUC) and accuracy of high Ki-67 were 0.820 and 0.867 in the internal test, and 0.666 and 0.773 in the external test, respectively. Regarding p53 positivity, the AUC and accuracy were 0.858 and 0.857 in the internal test, and 0.684 and 0.718 in the external test., Conclusion: The present study developed clinical-radiomic ML models to non-invasively predict Ki-67 and p53 expression in meningioma using mpMRI features, and provides a novel non-invasive strategy for assessing cell proliferation., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Moon, Lee, Kim, Yoon, Baek, Park, Heo, Shin and Kim.)

Purpose: To develop and validate deep learning-based automatic brain segmentation for East Asians with comparison to data for healthy controls from Freesurfer based on a ground truth., Methods: A total of 30 healthy participants were enrolled and underwent T1-weighted magnetic resonance imaging (MRI) using a 3-tesla MRI system. Our Neuro I software was developed based on a three-dimensional convolutional neural networks (CNNs)-based, deep-learning algorithm, which was trained using data for 776 healthy Koreans with normal cognition. Dice coefficient (D) was calculated for each brain segment and compared with control data by paired t -test. The inter-method reliability was assessed by intraclass correlation coefficient (ICC) and effect size. Pearson correlation analysis was applied to assess the relationship between D values for each method and participant ages., Results: The D values obtained from Freesurfer (ver6.0) were significantly lower than those from Neuro I. The histogram of the Freesurfer results showed remarkable differences in the distribution of D values from Neuro I. Overall, D values obtained by Freesurfer and Neuro I showed positive correlations, but the slopes and intercepts were significantly different. It was showed the largest effect sizes ranged 1.07-3.22, and ICC also showed significantly poor to moderate correlations between the two methods (0.498 ≤ ICC ≤ 0.688). For Neuro I, D values resulted in reduced residuals when fitting data to a line of best fit, and indicated consistent values corresponding to each age, even in young and older adults., Conclusion: Freesurfer and Neuro I were not equivalent when compared to a ground truth, where Neuro I exhibited higher performance. We suggest that Neuro I is a useful alternative for the assessment of the brain volume., Competing Interests: K-EH was employed by Neurozen Inc. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2023 Moon, Lee, Hyeong, Yoon, Baek, Heo, Shin and Kim.)

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus , family Tombusviridae ), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat ( Triticum aestivum ) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat ( Avena fatua , n=3) and brome grass ( Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Aging process is associated with gradual change of liver function and structure. The goal of this study was to evaluate age-related hemodynamic changes in the portal vein (PV) using four-dimensional (4D) flow MRI in healthy adults. A total of 120 healthy subjects were enrolled and categorized into groups A (n = 25, 30-39 years), B (n = 31, 40-49 years), C (n = 34, 50-59 years), and D (n = 30, 60-69 years). All subjects underwent 4D flow data acquisition using a 3-T MRI system to measure the hemodynamic parameters in the main PV. The clinical characteristics and 4D flow parameters were compared among the groups using analysis of variance and analysis of covariance after controlling for significant covariates, accordingly. The outcome metric applying the age-related quadratic model to estimate the age at which 4D flow parameters are the highest (the peak age) as well as the rates of age-related 4D flow changes was estimated. The average area, average through-plane velocity, peak velocity magnitude, average net flow, peak flow, and net forward volume in group D were significantly lower than those in groups A, B and C (P < 0.05). Group C showed significantly lower values of the average through-plane velocity and peak velocity magnitude than those of group B (P < 0.05). The peak age computed was approximately 43-44 years of age for all 4D flow parameters. The rates of age-related 4D flow changes for all 4D flow parameters were negatively correlated with age (P < 0.05). The volume and velocity of the blood flow through the PV peaked at approximately 43-44 years of age and decreased significantly after 60 years of age., (© 2023. The Author(s).)

Introduction: High-dose dual therapy (HDDT) can attain acceptable eradication rates provided that the optimal doses, timing and treatment duration are applied. The existing evidence still shows inconsistent reports (< 90%) on HDDT therapy except in some Asian countries. We aimed to assess and compare the efficacy of 14-day HDDT by comparing it to 14-day rabeprazole-containing hybrid therapy (HT) and to investigate the host and bacterial factors predicting the treatment outcomes of eradication therapies., Methods: In this open-label, randomized controlled trial, we recruited 243 naïve Helicobacter pylori-infected patients from September 1, 2018, to November 30, 2021. They were randomly allocated (1:1) to the HDDT group (rabeprazole 20 mg and amoxicillin 750 mg q.i.d for 14 days, n = 122) and the HT group (rabeprazole 20 mg and amoxicillin 1 g b.i.d. for 7 days, followed by rabeprazole 20 mg, amoxicillin 1 g, clarithromycin 500 mg and metronidazole 500 mg b.i.d. for 7 days, n = 121). Twelve patients were absent during follow-up in the HDDT group and 4 in the HT group, resulting in 110 for the HDDT group and 117 for HT group in the per protocol (PP) study. The outcome was determined by urea breath tests 8 weeks later., Results: The eradication rates for the HDDT and HT groups were 77.0% (95% confidence interval [CI]: 68.5% to 84.1%) and 94.2% (95% CI: 88.4% to 97.6%) (P < 0.001) in intention-to-treat analysis; 85.5% (95% CI: 77.5% to 91.5%) and 97.4% [95% CI: 92.6% to 99.5%] (P = 0.001) in per protocol analysis. The adverse event rates were 7.3% in the HDDT group and 14.5% in the HT group (P = 0.081). The habit of coffee drinking was the dependent factor for eradication failure in the HDDT group (88.2% vs. 68.8%, P = 0.040), but had no influence in the HT group (97.9% versus 95.0%, P = 0.449) in the univariate analysis., Conclusion: This study demonstrated that 14-day rabeprazole-containing HDDT did not achieve > 90% eradication rates for first-line H. pylori eradication as 14-day rabeprazole-containing HT did. HDDT is a potentially beneficial combination, which involves only two drugs with mild adverse effects; more precise studies are urged to find answers regarding these failures. This clinical trial was registered retrospectively on 28 November, 2021, as ClinicalTrials.gov identifier: NCT05152004., (© 2023. The Author(s).)