Search

Bikeshare, as a convenient transport mode, can address the first- and last-mile travel needs of metro trips while generating many environmental benefits, such as reducing the use of environmentally unfriendly transport modes and lowering the carbon emissions of the urban transportation system. This paper takes bikeshare as a feeder mode of metro stations (BS-FMMS) as the research object and compares the spatial and temporal differences in the carbon emission reduction benefits of BS-FMMS on workdays and non-workdays by using the framework of BS-FMMS carbon reduction benefit analysis and the methods of time-series analysis, spatial aggregation analysis, and box plot analysis. The results show that the carbon emission reduction benefit of bikeshare has obvious morning and evening peaks on workdays, while it tends to be stable without obvious peaks during the day on non-workdays. From the perspective of spatial distribution, the carbon emission reduction benefits of BS-FMMS are more significant in the metro station areas in the south of Baoan district, the west of Nanshan district, the central of Longhua district, and the south of Futian district in Shenzhen city, and the metro stations where the carbon emission reduction benefits of the non-workday are greater than those of the workday are mainly concentrated in Nanshan district, Futian district, and Luohu district. There is a significant positive correlation between BS-FMMS ridership and carbon emission reduction. These findings can provide clear policy implications for the decarbonization development of urban transportation systems. [ABSTRACT FROM AUTHOR]

Dezhou donkey is one of the representative local breeds in China, which is mainly divided into two strains: Sanfen and Wutou. There are obvious differences in coat color between the two strains. The former shows light points around the eyes, around the muzzle and under the belly, while the latter is completely solid black. In this study, genome‐wide association analysis was performed for the differences in coat color traits between the Sanfen (n = 97) and Wutou (n = 108) strains using a novel donkey 40K liquid chip developed based on GenoBaits technology, to identify genomic regions and causal genes that could explain this variation. We also used FST and The cross‐population composite likelihood ratio test (XPCLR) analyses to explore selected regions related to coat color differences. We identified one significant region on chromosome 15, with the most significant SNP located within the agouti signaling protein (ASIP) gene. At the same time, both FST and XPCLR methods detected the same selected region on chromosome 15, and ASIP was the gene with the strongest signal. ASIP and melanocortin 1 receptor (MC1R) control the ratio of eumelanin to pheomelanin through their protein activity. They are deeply involved in the process of melanosome organation and melanogenesis, thus affecting mammals' coat color variation. We used a range of genome‐wide approach to identify the genetic basis of coat color variation in Dezhou donkeys. The results provide a supplement to the color variation study in Chinese donkeys at the genome‐wide level, and preliminarily verified the reliability of the Molbreeding Donkey No. 1 40K liquid chip. [ABSTRACT FROM AUTHOR]

In order to ensure the safe operation of the mine power grid, reduce cable ground accidents, and solve the problems of real-time monitoring of the insulation of coal mine power cables, a new method of cable insulation "quasi real-time monitoring" is proposed.The influence of the range and precision of mutual inductor on proposed algorithm are separately discussed during the load operation and no-load running period.At last, the simulation results are verified by using MATLAB.The results show that:combining with the actual situation of power network in coal mine,a WAMS program is used to control the high-voltage cable for shot term no-load operation and to collect current, voltage value, and calculate insulation resistance of cable to ground.Then the "quasi real-time" monitoring of the cable insulation condition can be accomplished.The method can accurately measure the insulation conductance (resistance) value and tanδ value of the cable within certain range.Therefore, it is feasible to use this method to monitor cable insulation condition.

Food-borne mycotoxins is one of the food safety concerns in the world. At present, nanosensors are widely used in the detection and analysis of mycotoxins due to their high specificity and sensitivity. In nanosensor-based mycotoxindetections, the sensitivity is mainly improved from two aspects. On the one hand, based on the principle of immune response, antigens and antibodies can be modified and developed. Such as single-domain heavy chain antibodies, aptamers, peptides, and antigen mimotopes. On the other hand, improvements and innovations have been made on signal amplification materials, including gold nanoparticles (AuNPs), quantum dots, and graphene, etc. Among them, gold nanoparticles can not only be used as a signal amplification material, but also can be used as carriers for identification elements, which can be used for signal amplification in detection. In this article, we systematically summarized the emerging strategies for enhancing the detection sensitivity of traditional gold nanoparticles-based nanosensors, in terms of recognition elements and signal amplification. Representative examples were selected to illustrate the potential mechanism of each strategy in enhancing the colorimetric signal intensity of AuNP and its potential application in biosensing. Finally, our review suggested the challenges and future prospects of gold particles in detection of mycotoxins. [ABSTRACT FROM AUTHOR]

In 2009, a novel H1N1 influenza virus caused the first influenza pandemic of the 21st century. Studies have shown that the influenza M gene played important roles in the pathogenicity and transmissibility of the 2009 H1N1 pandemic ((H1N1)pdm09), whilst the underlying mechanism remains unclear. The influenza M gene encodes two proteins, matrix protein 1 and matrix protein 2, which play important roles in viral replication and assembly. In this study, it is found that the M2 protein of the (H1N1)pdm09 virus showed a lower mobility rate than the North America triple-reassortant influenza M2 protein in Polyacrylamide Gel Electrophoresis (PAGE). The site-directed mutations of the amino acids of (H1N1)pdm09 M2 revealed that E79 is responsible for the mobility rate change. Further animal studies showed that the (H1N1)pdm09 containing a single M2-E79K was significantly attenuated compared with the wild-type virus in mice and induced lower proinflammatory cytokines and IFNs in mouse lungs. Further in vitro studies indicated that this mutation also affected NLRP3 inflammasome activation. To reveal the reason why they have different mobility rates, a circular dichroism spectra assay was employed and showed that the two M2 proteins displayed different secondary structures. Overall, our findings suggest that M2 E79 is important for the virus replication and pathogenicity of (H1N1)pdm09 through NLRP3 inflammasome and proinflammatory response. [ABSTRACT FROM AUTHOR]

Species within the genus Equus are valued for their draft ability. Skeletal muscle forms the foundation of the draft ability of Equus species; however, skeletal muscle development-related conserved genes and their target miRNAs are rarely reported for Equus. In this study, a comparative genomics analysis was performed among five species (horse, donkey, zebra, cattle, and goat), and the results showed that a total of 15,262 (47.43%) genes formed the core gene set of the five species. Only nine chromosomes (Chr01, Chr02, Chr03, Chr06, Chr10, Chr18, Chr22, Chr27, Chr29, and Chr30) exhibited a good collinearity relationship among Equus species. The micro-synteny analysis results showed that TPM3 was evolutionarily conserved in chromosome 1 in Equus. Furthermore, donkeys were used as the model species for Equus to investigate the genetic role of TPM3 in muscle development. Interestingly, the results of comparative transcriptomics showed that the TPM3 gene was differentially expressed in donkey skeletal muscle S1 (2 months old) and S2 (24 months old), as verified via RT-PCR. Dual-luciferase test analysis showed that the TPM3 gene was targeted by differentially expressed miRNA (eca-miR-1). Furthermore, a total of 17 TPM3 gene family members were identified in the whole genome of donkey, and a heatmap analysis showed that EaTPM3-5 was a key member of the TPM3 gene family, which is involved in skeletal muscle development. In conclusion, the TPM3 gene was conserved in Equus, and EaTPM3-5 was targeted by eca-miR-1, which is involved in skeletal muscle development in donkeys. [ABSTRACT FROM AUTHOR]

Organic rectorite (OREC) can significantly improve the resistance of asphalt to deformation and aging, but it tends to cause low-temperature cracking. To solve this defect, a novel idea that develops an OREC and polyurethane (PU) composite-modified asphalt binder has been put forward in this work. Various modified asphalt binder systems containing different combinations of OREC and PU contents were prepared by the melt blending method. The storage stability of the OREC/PU-modified asphalt binders was studied. The high- and low-temperature properties of binders were investigated by dynamic shear rheometer and bending beam rheometer tests. The microstructure and modification mechanism of the binders were characterized by gel permeation chromatography, differential scanning calorimetry, and Fourier transforms infrared spectroscopy. The results showed that the OREC/PU-modified asphalt binder displayed good high-temperature storage stability. However, excessively high content of OREC will adversely affect the storage stability of asphalt. In the 2% by weight OREC/9% by weight PU modified asphalt system, OREC and PU exhibited excellent synergistic effects. And the high- and low-temperature properties of the asphalt were significantly improved. The introduction of OREC/PU reduces the Tg of the asphalt binder and the enthalpy during temperature change. The modified asphalt has good low-temperature flexibility through the physical and chemical interaction between polyurethane and asphalt during the modification process. PU can intercalate OREC and react with active hydrogens in asphalt to generate cross-linked structures to enhance the high- and low-temperature properties of the asphalt binder. [ABSTRACT FROM AUTHOR]

This study investigated the modification mechanism of polyurethane (PU) on the high- and low-temperature properties of asphalt based on experimental and molecular dynamics (MD) simulations. PU-modified asphalt was prepared using an in situ polymerization method. The high- and low-temperature properties of asphalt containing various PU contents were investigated via a series of laboratory tests. The asphalt molecular model, the PU molecular model, and the PU–asphalt mixes system were modeled using software. Based on reasonable models, the influence of PU content on the physical modulus and molecular motion of asphalt at high temperatures was researched using MD simulations. The glass transition temperature of PU-modified asphalt with different contents was obtained using software, and the free volume theory and molecular diffusion movement were used to interpret the improvement mechanism of PU content on the low-temperature performance of asphalt. The results indicate that PU effectively can improve the high- and low-temperature properties of asphalt. PU has a significant positive effect on the physical modulus of asphalt, and the effect becomes more significant with the increase of PU content. In addition, PU can form a tight structure with asphalt and increase the stability of the asphalt system. The free volume ensures the free movement of PU molecules in the asphalt, allowing PU to be dispersed homogeneously in the asphalt. However, the free volume decreases when the PU content exceeds 15% by weight, which limits the improvement of the low-temperature performance of asphalt. The results of molecular simulation can explain the enhancement mechanism of PU, providing a reference for the performance enhancement of PU-modified asphalt. [ABSTRACT FROM AUTHOR]

Simple Summary: Streptococcus suis has been receiving increasing attention due to its involvement in severe human infections worldwide. However, there is currently no licensed vaccine against S. suis. Therefore, vaccine development is very essential to eliminate the threat of this human pathogen. Herein, we contrived a multi-epitope subunit vaccine against S. suis isolates of multiple serotypes using immunoinformatics. Further, the characteristics of the designed vaccine were evaluated using several analyses, including antigenicity, allergenicity, toxicity, and tertiary structure analyses and molecular docking; the results indicated that it could be an effective universal vaccine against S. suis infections. Streptococcus suis is a significant zoonotic pathogen that is a great threat not only to the swine industry but also to human health, causing arthritis, meningitis, and even streptococcal toxic shock-like syndrome. Owing to its many serotypes and high geographic variability, an efficacious cross-protective S. suis vaccine is not readily available. Therefore, this study aimed to design a universal multi-epitope vaccine (MVHP6) that involved three highly immunogenic proteins of S. suis, namely, the surface antigen containing a glycosaminoglycan binding domain (HP0197), endopeptidase (PepO), and 6-phosphogluconate dehydrogenase (6PGD). Forecasted T-cell and B-cell epitopes with high antigenic properties and a suitable adjuvant were linked to construct a multi-epitope vaccine. In silico analysis showed that the selected epitopes were conserved in highly susceptible serotypes for humans. Thereafter, we evaluated the different parameters of MVHP6 and showed that MVHP6 was highly antigenic, non-toxic, and non-allergenic. To verify whether the vaccine could display appropriate epitopes and maintain high stability, the MVHP6 tertiary structure was modeled, refined, and validated. Molecular docking studies revealed a strong binding interaction between the vaccine and the toll-like receptor (TLR4), whereas molecular dynamics simulations demonstrated the vaccine's compatibility, binding stability, and structural compactness. Moreover, the in silico analysis showed that MVHP6 could evoke strong immune responses and enable worldwide population coverage. Moreover, MVHP6 was cloned into the pET28a (+) vector in silico to ensure the credibility, validation, and proper expression of the vaccine construct. The findings suggested that the proposed multi-epitope vaccine can provide cross-protection against S. suis infections. [ABSTRACT FROM AUTHOR]

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey. [ABSTRACT FROM AUTHOR]

Testicular development and spermatogenesis are tightly regulated by the number of genes and noncoding genes, and mRNAs and lncRNAs play vital roles in regulating posttranscriptional gene expression. However, mRNAs and lncRNAs have not been systematically identified in the testes of donkeys. In this study, mRNA and lncRNA expression profiles in the testes of DeZhou donkeys between 2 months and 2 years of age were comprehensively analysed by RNA sequencing. We identified 56,605 lncRNAs and 61,857 mRNAs by gene expression analysis, and 21,845 lncRNAs (p <.05) and 14,109 mRNAs (p <.05) were differentially expressed in the immature (2‐month‐old, n = 3, noADGW) and mature (2‐year‐old, n = 3, ADGW) stages. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the predicted target genes were enriched in the adherens junction, cell cycle, propanoate metabolism and cell adhesion molecule pathways. This study identified and analysed a comprehensive catalogue of lncRNAs and mRNAs in donkey testes, which provides a useful resource for further investigation of biological function in donkey lncRNAs. [ABSTRACT FROM AUTHOR]

Simple Summary: This study developed an indirect ELISA (GMD-ELISA) to detect the Streptococcus suis (S. suis) antibody. The antigen—antibody response was optimized using checkerboard titration. This method has strong specificity and can detect the main epidemic strains of S. suis in China—type 2, type 7, and type 9—compared with using the commercial Streptococcus suis ELISA type 2 kit. The GMD-ELISA method has high sensitivity and good repeatability. The novel GMD-ELISA method provides technical support for rapid diagnosis and epidemiological investigation. S. suis is an important zoonotic pathogen from sick and recessive carrier pigs that poses a serious threat to animal husbandry production and public health. It usually causes horizontal transmission among pigs. The morbidity and mortality of this disease are very high. Human infection is caused through direct or indirect contact with sick pigs. The two large-scale outbreaks in China were due to the outbreak of S. suis on pig farms, which spread to human infection; thus, detecting S. suis in pig herds is crucial. At present, the commercial S. suis ELISA type 2 kits on the market can only detect single serotypes, high probabilities of interaction reactions, and biosafety risks when using inactivated S. suis as an antigen. Phosphate-3-glyceraldehyde dehydrogenase (GAPDH), muramidase-released protein (MRP), and dihydrolipoamide dehydrogenase (DLDH) are important S. suis type 2, S. suis type 7, and S. suis type 9 protective antigens. This study purified the GMD protein (B-cell-dominant epitopes of GAPDH, MRP, and DLDH antigens) and used a diverse combination of dominant epitopes of the multiple different antigens as coated antigens, improving the sensitivity and safety of the indirect ELISA experiments. An indirect ELISA method (GMD-ELISA) was developed for detecting S. suis antibodies. The antigen—antibody response was optimized using checkerboard titration. The results of testing using ELISA for Salmonella enterica (S. enterica), Escherichia coli (E. coli), Staphylococcus aureus (SA), and Streptococcus pyogenes (S. pyogenes) were all negative, indicating that this method had strong specificity. The results were still positive when the dilution ratio of S. suis-positive serum reached 1:6, 400, thus indicating that the method had high sensitivity. The results of the reproducibility assay for indirect ELISA showed that the intra-assay coefficient of variation and the inter-assay coefficient of variation were less than 10%, indicating that the method had good repeatability. We investigated the seroprevalence of S. suis in 167 serum samples collected in East China, and 33.5% of the samples were positive for antibodies against S. suis, indicating that the prevalence of S. suis is high in pig farms in Eastern China. The novel GMD-ELISA is a convenient, sensitive, and specific diagnostic method that provides technical support for rapid diagnosis and epidemiological investigation. [ABSTRACT FROM AUTHOR]

To improve the inferior stability in high‐viscosity asphalt prepared using styrene‐butadiene‐styrene block copolymer (SBS) and to simplify the preparation process, a novel high‐viscosity modifier (STP) was prepared with SBS, terpene‐styrene resin (TSR) and plasticizer. Its inherent properties, optimal dosage, and modification effect were investigated. The results show that STP has lower component melting temperature and stronger polarity, combined with good thermal stability, ensuring that STP possesses a better modification effect on asphalt. 14.5–17.6 wt% was determined as the appropriate content of STP. The incorporation of STP improved the rutting resistance and elasticity percentage of the asphalt. The zero shear viscosity (ZSV) of asphalt fitted by the Carreau model showed that STP increased the cohesion of the asphalt system and improved the high‐temperature deformation resistance. The small non‐recoverable creep compliance value proves that the STP high‐viscosity asphalt (STP‐HVA) exhibits excellent resistance to permanent deformation at high‐temperatures while displaying low‐stress sensitivity and achieving an extremely heavy traffic rating. STP confers greater flexibility to asphalt to eliminate low‐temperature cracking phenomenon. Smaller CMAI and PAAI values demonstrate that STP‐HVA exhibits outstanding aging resistance. TSR effectively improves the compatibility of SBS and base asphalt, and STP particles are finely dispersed and uniform. The preparation process is mainly physical modification, accompanied by chemical reactions. [ABSTRACT FROM AUTHOR]

Sperm cryopreservation technology has laid the foundation for promoting the popularity of artificial insemination in donkey reproduction, but the freeze–thaw process can cause sperm damage, and the viability of frozen sperm is greatly reduced, resulting in low insemination ability. Sperm metabolites play an important role in the freezing process of spermatozoa and have a major influence on the freezability of spermatozoa. The aim of this study was to explore the differential metabolites in donkey spermatozoa before and after cryopreservation by liquid chromatography–tandem mass spectrometry (LC–MS/MS). We analysed ejaculate samples from male donkeys obtained before and after freezing and identified 1323 metabolites. Compared with fresh sperm (F), the metabolites of cryopreserved sperm (CRY) were significantly changed, and 570 metabolites were significantly different between the two groups (p <.05). Among them, 277 metabolites were higher in frozen sperm, while the opposite was true for 293 metabolites. These metabolites mainly include phospholipids, lysophospholipids and amino acids., most of which are associated with oxidative stress and sperm capacitation. We describe significantly different metabolites before and after freezing that are significantly associated with decreased sperm motility post‐freezing and can be used as biomarkers of decreased sperm motility post‐freezing. [ABSTRACT FROM AUTHOR]

Introduction: To examine the in vitro and in vivo antimicrobial activities of ceftazidime/avibactam (CZA) alone or in combination with aztreonam (ATM) against KPC-, NDM-, IMP-, KPC+IMP-, KPC+NDM-producing strains. Methods: A total of 67 clinical non-repetitive carbapenem-resistant Enterobacterales (CRE) strains were selected for the microdilution broth method that was performed to analyze the minimal inhibitory concentration (MIC) and the combination antimicrobial susceptibility test using checkerboard titration method. The fractional inhibitory concentration (FIC) was calculated to determine the antimicrobial effect. The time-kill assays and the mouse infection model were used to study the bactericidal effect and therapeutic effect of CZA alone or in combination with ATM. Results: The CZA minimal inhibitory concentration (MIC) values of CZA revealed that 29 KPC-producing strains and 1 OXA-producing strain were ≤ 4μg/mL. The CZA MIC values of 37 metal-β-lactamase (MBLs)-producing strains such as NDM-, IMP-, KPC+IMP-, KPC+NDM-producing strains were ≥ 128μg/mL, after combining with ATM, the FIC values were all below 0.51. The time-kill assays revealed that CZA at various concentrations of 2, 4 and 8 MIC showed significant bactericidal efficiency to the KPC-producing strains. For NDM-, IMP-producing strains, no colony growth was detected after 8 hours of incubation with CZA in combination with ATM. Six percent of the mice in the treatment group and 58% of the mice in the infection group died within 3 days. Conclusion: Our in vitro results showed that CZA had a good antimicrobial effect on the KPC-producing and OXA-producing strains. CZA combined with ATM showed synergistic bacteriostatic or bactericidal activity against NDM-, IMP-, KPC+IMP-, KPC+NDM-producing strains. The combination of CZA and ATM reduced mortality and prolonged lifespan of mice infected with NDM-, IMP-, KPC+IMP-, and KPC+NDM-producing strains, which provides fundamental knowledge for improving treatment strategies and initializing clinical trials. [ABSTRACT FROM AUTHOR]