Search

Giraffa giraffa (Boddaert, 1784) Diagnosis Anterior horn rudimentary, shanks coloured and fully spotted, three ES in the C1orf74 intron: 24 A=>T, 33 A=>G, 825 C=> G; three ES in the DHX36 intron: 127 G =>A, 449 dAT, 498 A=>G; one ES in the IGF2B1 intron: 45 G =>A; one ES in the UBN2 intron: 386 dTCT; six ES in the USP33 intron: 267 G =>A, 279 T=>C, 309 dAA, 538 G =>T, 805 A=>G, 928 G =>A. Type material examined Neotype (here designated) NAMIBIA • 1 specimen (mounted skeleton), “Giraffe of Levaillant”; North of the Orange river; MNHN-A7977. Distribution Angola, Botswana, Mozambique, Namibia (neotype), South Africa, Zambia, Zimbabwe. Remarks No concrete holotype specimen assigned, as specimens of the Prince of Orange Museum in The Hague and the giraffe of Vosmaer (1787) from the Naturalis museum in Leiden (Netherlands) are ʻwhereabouts unknownʼ., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Boddaert P. 1784. Camelopardalis giraffa. Elenchus Animalium Vol. 1: Systems Quadrupedia. C. R. Hake, Rotterdam.","Vosmaer A. 1787. Description du chameau-leopard (Camelopardalis). P. Meyer and G. Warners, Amsterdam."]}

Giraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL • 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali.

Giraffa giraffa giraffa (Boddaert, 1784) Camelopardalis australis Swainson, 1835: 284. Camelopardalis capensis Lesson, 1842: 168. Camelopardalis maculata Weinland, 1863: 205, fig. p. 206. Giraffa camelopardalis angolensis Lydekker, 1903: 121, fig. p. 121. Diagnosis One ES in the Cytb gene: 798 T=>C; two ES in the CR: 130 iT, 170 A=>G. Distribution Angola, Botswana, Namibia, Zimbabwe., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Boddaert P. 1784. Camelopardalis giraffa. Elenchus Animalium Vol. 1: Systems Quadrupedia. C. R. Hake, Rotterdam.","Swainson W. 1835. A Treatise on the Geography and Classification of Animals. Green Longman, London. https: // doi. org / 10.5962 / bhl. title. 25975","Lesson R. P. 1842. Nouveau tableau du Regne animal: Mammiferes. Arthus Bertrand, Paris.","Weinland D. F. 1863. Zur Erinnerung an unsere Giraffe. Zoologischer Garten 4: 204 - 207.","Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London."]}

Giraffa camelopardalis peralta Thomas, 1898 Diagnosis Elongated skull, large spatulate nasal opening, vertically upright direction of the ossicones, fawncoloured patch below the ears, white sparsely spotted occipital region; two ES in the Cytb gene: 219 C=>T, 1080 C=>T, and one ES in the CR: 23 A=> G. Type material Holotype NIGERIA • 1 specimen (skull and bones of right fore and left hind limb); Lokoja; NHMUK-1898.2.18.1. Distribution Niger. Remarks The type locality has originally been assigned to the junction between the Niger and Benue rivers in Nigeria, but it was corrected in this study to Lokoja (Nigeria) north of the confluence of the Niger and Benue rivers in accordance with Happold (1969)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on pages 22-23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Thomas O. 1898. On a new subspecies of giraffe from Nigeria. Proceedings Zoological Society London 1898: 39 - 41.","Happold D. C. D. 1969. The present distribution and status of the giraffe in West Africa. Mammalia 33 (3): 516 - 521. https: // doi. org / 10.1515 / mamm. 1969.33.3.516"]}

Intensified exploration of sub-Saharan Africa during the 18th and 19th centuries led to many newly described giraffe subspecies. Several populations described at that time are now extinct, which is problematic for a full understanding of giraffe taxonomy. In this study, we provide mitochondrial sequences for 41 giraffes, including 19 museum specimens of high importance to resolve giraffe taxonomy, such as Zarafa from Sennar and two giraffes from Abyssinia (subspecies camelopardalis), three of the first southern individuals collected by Levaillant and Delalande (subspecies capensis), topotypes of the former subspecies congoensis and cottoni, and giraffes from an extinct population in Senegal. Our phylogeographic analysis shows that no representative of the nominate subspecies camelopardalis was included in previous molecular studies, as Zarafa and two other specimens assigned to this taxon are characterized by a divergent haplogroup, that the former subspecies congoensis and cottoni should be treated as synonyms of antiquorum, and that the subspecies angolensis and capensis should be synonymized with giraffa, whereas the subspecies wardi should be rehabilitated. In addition, we found evidence for the existence of a previously unknown subspecies from Senegal (newly described in this study), which is now extinct. Based on these results, we propose a new classification of giraffes recognizing three species and 10 subspecies. According to our molecular dating estimates, the divergence among these taxa has been promoted by Pleistocene climatic changes resulting in either savannah expansion or the development of hydrographical networks (Zambezi, Nile, Lake Chad, Lake Victoria). A correction has been published: Petzold A., Magnant A.-S., Edderai D., Chardonnet B., Rigoulet J., Saint-Jalme M. & Hassanin A. 2020. First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens – Corrigendum. European Journal of Taxonomy 717: 1–2. https://doi.org/10.5852/ejt.2020.717.1093

Giraffa camelopardalis senegalensis Petzold, Magnant & Hassanin, subsp. nov. urn:lsid:zoobank.org:act: 838C1DB1-59BA-49DD-B5AA-F5432F36B112 Diagnosis Beige ground colour covered with dark brown spots following a reticulated pattern separated by narrow lines, skull features detailed in Blainville (1864), one ES in the Cytb gene: 732 A=> G; four ES in the CR: 92 dC, 95 A=>G, 359 C =>T, 463 A=>G. Type material examined Holotype (here designated) SENEGAL ��� 1 specimen (skeleton); Bakel; MNHN-A10617. Past distribution Probably extinct, former range extended over Senegal (holotype) and potentially Gambia, Mauritania and Mali., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["de Blainville H. M. D. 1864. Osteographie: ou, Description iconographique comparee du Squelette et du Systeme dentaire des Mammiferes recents et fossiles pour servir de base a la Zoologie et a la Geologie. Vol. 4: Quaternates. JB Bailliere et fils, Paris."]}

Giraffa giraffa wardi Lydekker, 1904 Giraffa infumata Noack, 1903: 356. Diagnosis Irregular spots, spots on the side of the face restricted to the region below and behind the eyes, two ES in the Cytb gene: 634 C=>T, 705 A=>G. Type material Holotype SOUTH AFRICA • 1 specimen (mounted head and neck); NHMUK-1903.11.18.1. Distribution Botswana, Mozambique, South Africa (holotype), Zambia, Zimbabwe. Remarks The holotype is given by Lydekker (1914) under the collection number NHMUK - 1903.11.18.1, but this catalogue number leads to a fish specimen (Pomatomus telescopus Risso, 1810) on the collection website (https://data.nhm.ac.uk/dataset/collection-specimens/resource/05ff2255-c38a-40c9-b657- 4ccb55ab2feb/record/3124756). However, two other specimens of wardi can be found in the museum collection (NHMUK-1903.11.17.1 and NHMUK-1903.11.17.3), one of which might be considered the neotype if the holotype cannot be found., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 26, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1904. On the Subspecies of Giraffa camelopardalis. Proceedings of the Zoological Society of London 74: 202 - 227. https: // doi. org / 10.1111 / j. 1469 - 7998.1904. tb 08288. x","Lydekker R. 1914. Catalogue of the Ungulate Mammals in the British Museum. British Museum, London."]}

Giraffa tippelskirchi Matschie, 1898 Diagnosis Faint or strongly stellate form of the patches, absence of occipital horns, seven ES in the UBN2 intron: 48 dA, 209 iCATAATATATTTAATATATTTAATATTTAATAA, 243 T=>A, 318 G =>C, 332 T=>G, 504 A=> C, 623 C=>T Type material Lectotype (here designated) TANZANIA • 1 specimen (skull and skin); Lake Eyasi; ZMB-084951. Distribution Kenya, Tanzania (lectotype), Zambia. Remarks Matschie (1898) mentions two different specimens as syntypes, but the second cannot be found in the collection catalogue and might be considered as lost., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669

Giraffa camelopardalis rothschildi Lydekker, 1903 Diagnosis Lower parts of the legs pure white and unspotted, spots show a tendency to split up into stars, occipital pair of ossicones, one ES in the CR: 129 T=> C. Type material Holotype KENYA • 1 specimen (mounted skin); Guasin-gisha Plateau east of Mount Elgon; NHMUK-1903.4.15.1. Distribution Western Ethiopia, Kenya (holotype), Uganda, South Sudan., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 23, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London."]}

Giraffa tippelskirchi tippelskirchi Matschie, 1898 Giraffa schillingsi Matschie, 1898: 79. Diagnosis Stellate formed spots, shanks olive-coloured and spotted down to the hoofs, anterior horn less developed, one ES in the Cytb gene: 1033 C=>T. Distribution Southern Kenya, Tanzania., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 24, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669

Giraffa camelopardalis (Linnaeus, 1758) Diagnosis Shanks white, presence of occipital horns, five ES in the Cytb gene: 186 A=> G, 288 G =>A, 333 A=>G, 597 C=>T, 924 C=>T; one ES in the CR: 462 A=>G; two ES in the CTAGE5 intron: 570 T=> C, 705 C=> G; two ES in the CWF19L1 intron: 263 T=> G, 264 T=> G; one ES in the DDX1 intron: 268 dACAT; one ES in the DHX36 intron: 50 iGTT; two ES in the SOS1 intron: 103 T=>C, 118 G=>A. Type material examined Neotype (here designated) ETHIOPIA • 1 specimen (skin and complete skeleton); Abyssinia; MHNT-1996.121.2. Other specimens ETHIOPIA • 1 specimen (skull and skeleton parts); Abyssinia; MNHN-A8012. SUDAN • 1 specimen (skull), “Zarafa”; Sennar; MNHN-1845-211. Distribution Niger, Chad, Cameroon, Central African Republic, Democratic Republic of Congo, South Sudan (holotype), Uganda, Somalia, Ethiopia (neotype), Kenya. Remarks The holotype designation was based on a living giraffe illustrated by Belon du Mans (1553), which was not sampled for a museum collection. The neotype herein designated represents the most complete specimen (skin and complete skeleton) and has been the first giraffe to be dissected, providing several anatomical drawings (see Joly & Lavocat 1845)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on pages 21-22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Linnaeus C. 1758. Systema Naturae per Regna Tria Naturae. Editio decima reformata, Tomus I. Regnum Animale. Laurentius Salvius, Stockholm.","Belon du Mans P. 1553. Les Observations de plusieurs Singularitez et Choses memorables trouvees en Grece, Asie, Iudee, Egypte, Arabie et autres Pays estranges. Corrozet et Canellat, Paris. https: // doi. org / 10.5962 / bhl. title. 127374","Joly N. & Lavocat A. 1845. Recherches historiques, zoologiques, anatomiques et paleontologiques sur la Giraffe (Camelopardalis giraffa, Gmelin). V. Berger-Levrault, Boulogne-Billancourt."]}

Giraffa tippelskirchi thornicrofti Lydekker, 1911 Diagnosis Low and conical anterior horn, grey colour and scattered spotting of the sides of the face, fawn shanks, three ES in the CR: 39 A=>G, 272 T=>C, 336 T=>A; two ES in the IGF2B1 intron: 60 C=>T, 304 G =>A. Type material Holotype ZAMBIA • 1 specimen (skin); Petauke district; NHMUK-1910.10.17.1. Distribution Luangwa Valley in Zambia., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 25, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Lydekker R. 1911. Two undescribed giraffes. Nature 87: 484. https: // doi. org / 10.1038 / 087484 c 0"]}

Giraffa camelopardalis camelopardalis (Linnaeus, 1758) Camelopardalis aethiopicus Ogilby, 1837: 134. Camelopardalis biturigum Duvernoy, 1844: 12, fig. 4. Giraffa camelopardalis typica Bryden, 1899: 489, plate XIV. Diagnosis Front of the face sparsely and sides fully spotted, similar pattern to reticulata but with chestnut or sandy patches. Past distribution Probably extinct, former range between the Blue Nile and Tekezé /Atbara rivers in southeastern Sudan (eastern Sennar) and northern Ethiopia (Abyssinia)., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Linnaeus C. 1758. Systema Naturae per Regna Tria Naturae. Editio decima reformata, Tomus I. Regnum Animale. Laurentius Salvius, Stockholm.","Ogilby W. 1837. On the generic characters of ruminants. Proceedings of the Zoological Society of London 1836: 131 - 139.","Duvernoy M. 1844. Sur une machoire de girafe fossile decouverte a Issoudun. Notes communiques au L'Academie de Science, 1843.","Bryden H. A. 1899. Great and Small Game of Africa: An Account of the Distribution, Habits, and Natural History of the Sporting Mammals, with Personal Hunting Experiences. R. Ward, London."]}

Giraffa camelopardalis antiquorum (Jardine, 1835) Giraffa camelopardalis sennaariensis Trouessart, 1898: p.902. Giraffa camelopardalis congoensis Lydekker, 1903: 386. Giraffa camelopardalis cottoni Lydekker, 1904: 207, fig. 1. Diagnosis Spots on the upper part of the fore-limbs and the thighs broken up in a number of very small and irregular ones. Type material Holotype SUDAN • 1 ♂ (skull and tanned skin of a male giraffe); South of Darfur; SMF-498. Paratype SUDAN • 1 ♀ (skull and tanned skin of a female giraffe); South of Darfur; SMF-497. Distribution Cameroon, Chad, Central African Republic, Democratic Republic of Congo, South Sudan (holotype). Remarks The holotype designation was based on the information provided by Rüppel (1826), who collected two specimens in North Africa. Both specimens can be meanwhile found in the collection of the Senckenberg Museum Frankfurt (Germany) listed as SMF-498 (skull and tanned skin, male): unspecified type and SMF-497 (skull and tanned skin, female): paratype., Published as part of Petzold, Alice, Magnant, Anne-Sophie, Edderai, David, Chardonnet, Bertrand, Rigoulet, Jacques, Saint-Jalme, Michel & Hassanin, Alexandre, 2020, First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens, pp. 1-33 in European Journal of Taxonomy 703 on page 22, DOI: 10.5852/ejt.2020.703, http://zenodo.org/record/3989669, {"references":["Jardine W. 1835. The Natural History of the Ruminating Animals, containing Deer, Antilopes, Camels & c. W. H. Lizars, Edinburgh. https: // doi. org / 10.5962 / bhl. title. 131528","Trouessart L. 1898. Catalogus Mammalium tam viventium quam fossilium. Vol. 4: Tillodontia et Ungulata. Freidlander, Berlin. https: // doi. org / 10.5962 / bhl. title. 130824","Lydekker R. 1903. Local variation in the Giraffe. In: Animal Life and the World of Nature. Vol. 2: 78 - 84. Hutchinson & Co, London.","Lydekker R. 1904. On the Subspecies of Giraffa camelopardalis. Proceedings of the Zoological Society of London 74: 202 - 227. https: // doi. org / 10.1111 / j. 1469 - 7998.1904. tb 08288. x"]}

Traditionally, one giraffe species and up to eleven subspecies have been recognized [1]; however, nine subspecies are commonly accepted [2]. Even after a century of research, the distinctness of each giraffe subspecies remains unclear, and the genetic variation across their distribution range has been incompletely explored. Recent genetic studies on mtDNA have shown reciprocal monophyly of the matrilines among seven of the nine assumed subspecies [3, 4]. Moreover, until now, genetic analyses have not been applied to biparentally inherited sequence data and did not include data from all nine giraffe subspecies. We sampled natural giraffe populations from across their range in Africa, and for the first time individuals from the nominate subspecies, the Nubian giraffe, Giraffa camelopardalis camelopardalis Linnaeus 1758 [5], were included in a genetic analysis. Coalescence-based multi-locus and population genetic analyses identify at least four separate and monophyletic clades, which should be recognized as four distinct giraffe species under the genetic isolation criterion. Analyses of 190 individuals from maternal and biparental markers support these findings and further suggest subsuming Rothschild's giraffe into the Nubian giraffe, as well as Thornicroft's giraffe into the Masai giraffe [6]. A giraffe survey genome produced valuable data from microsatellites, mobile genetic elements, and accurate divergence time estimates. Our findings provide the most inclusive analysis of giraffe relationships to date and show that their genetic complexity has been underestimated, highlighting the need for greater conservation efforts for the world's tallest mammal.

(4) northern giraffe (G. camelopardalis), which includes Nubian giraffe (G. c. camelopardalis) and its new synonym, Rothschild���s giraffe (G. c. rothschildi), with Kordofan giraffe (G. c. antiquorum) and West African giraffe (G. c. peralta) as distinct subspecies. In the face of small population sizes, especially for the West African giraffe (Table 1), concerted conservation efforts are necessary for preserving these genetically differentiated subspecies., Published as part of Julian Fenessy, Tobias Bidon, Friederike Reuss, Vikas Kumar, Paul Elkan, Maria A. Nilsson, Melita Vamberger, Uwe Fritz & Axel Janke, 2016, Multi-locus analyses reveal four giraffe species instead of one, pp. 1-7 in Current Biology 2016 on page 3, DOI: 10.1016/j.cub.2016.07.036, http://zenodo.org/record/269823

(2) Masai giraffe (G. tippelskirchi), which includes the formerly recognized Thornicroft���s giraffe, Published as part of Julian Fenessy, Tobias Bidon, Friederike Reuss, Vikas Kumar, Paul Elkan, Maria A. Nilsson, Melita Vamberger, Uwe Fritz & Axel Janke, 2016, Multi-locus analyses reveal four giraffe species instead of one, pp. 1-7 in Current Biology 2016 on page 3, DOI: 10.1016/j.cub.2016.07.036, http://zenodo.org/record/269823

(1) southern giraffe (G. giraffa), comprising two distinct subspecies, Angolan giraffe (G. g. angolensis) and South African giraffe (G. g. giraffa), Published as part of Julian Fenessy, Tobias Bidon, Friederike Reuss, Vikas Kumar, Paul Elkan, Maria A. Nilsson, Melita Vamberger, Uwe Fritz & Axel Janke, 2016, Multi-locus analyses reveal four giraffe species instead of one, pp. 1-7 in Current Biology 2016 on page 3, DOI: 10.1016/j.cub.2016.07.036, http://zenodo.org/record/269823

(3) reticulated giraffe (G. reticulata); and, Published as part of Julian Fenessy, Tobias Bidon, Friederike Reuss, Vikas Kumar, Paul Elkan, Maria A. Nilsson, Melita Vamberger, Uwe Fritz & Axel Janke, 2016, Multi-locus analyses reveal four giraffe species instead of one, pp. 1-7 in Current Biology 2016 on page 3, DOI: 10.1016/j.cub.2016.07.036, http://zenodo.org/record/269823

1. Girafte Giraffa camelopardalis French: Girafe / German: Giraffe / Spanish: Jirafa Other common names: Nubian Giraffe (camelopardalis), Kordofan Giraffe (antiquorum), Masai Giraffe (tippelskirchi), Reticulated/ Somali Giraffe (reticulata), Rothschild Giraffe (rothschildi), Smoky/Angolan Giraffe (angolensis), South African Giraffe (giraffa), Thornicroft/Rhodesian Giraffe (thornicrofti), West African/Nigerian Giraffe (peralta) Taxonomy. Cervus camelopardalis Linnaeus, 1758, Sennar, Sudan. It appears from genetic studies that Giraffes fall into three groups: West African Giraffes (peralta); North African Giraffes (antiguorum, reticulata, rothschildi, thornicrofti, and probably camelopardalis); and southern African Giraffes (angolensis and guraffa). The “Masai Giraffe,” tippelskirchi, exhibits similarities with both the southern and the northern groups. Genetic differences, ranging from 0-15% to 6-9%, are below those required for the establishment of distinct species. Nine regional variants are currently recognized as subspecies, all of which interbreed. Subspecies and Distribution. G.c.camelopardalisLinnaeus,1758—ESudanandWEthiopia. G.c.angolensisLydekkcr,1903-NNamibia,SZambia,NBotswana,andNWZimbabwe. G.c.antiquorumJardine,1835-SChad,Genua]AfricanRepublic,andNEDRCongo. G.c.giraffaSchreber.1784-SWMozambique,SZimbabwe,andSouthAfrica. G.c.peraltaThomas,1898-WAfrica. G.c.reticulataDeWinton,1899-SEthiopia,SWSomalia,andNKenya. G.c.rothschildiLydekker,1903-SSudan.NUganda,andWKenya. G.c.tippelskirchiMatschie,1898-SKenyaandTanzania. G. c. thornicrofti Lydekker, 1911 -Zambia (Luangwa Valley). Descriptive notes. Head-body 350-480 cm,tail 76-110 cm, height to the crown 450-600 cm; weight 1800-1930 kg (males) and 450-1180 kg (females). Adult males are larger than females. Colored hair patches are separated by yellow-white bands and vary in the regional variants. Patches contain large active sweat glands and a unique arrangement of blood vessels, suggesting they act as thermal windows through which to dissipate heat. Pigmentation of the skin is uniformly dark gray. The extraordinary shape results from elongation of the neck skeleton and of the lower leg bones. Elongation of the legs is associated with thickening of the bone wall to provide strength and of the neck by uniform lengthening of all seven cervical vertebrae. Elongation of the skeleton is rapid and demands the accumulation of large amounts of calcium and phosphorus. Giraffe anatomy has necessitated physiological adaptations; e.g. systemic blood pressure is twice that for similar sized mammals. The cells of the left ventricular and interventricular walls of the heart are enlarged, their thickness linearly related to neck length. Simultaneous enlargement of artery and arteriole walls provides resistance to blood flow. This appears to be a coordinated reflex response that maintains blood flow to the brain to protect Giraffes from fainting when they raise their heads after drinking, and to prevent peripheral oedema in the legs. Valves in the jugular vein prevent regurgitation of blood returning to the heart into the jugular vein. The long trachea is significantly narrower than in similar-sized mammals, limiting increases in dead space. Giraffe skulls feature paired subconical ossicones, which resemble short, blunt horns, arising from the top of the brain case. Female skulls are smoother and lighter than those of males. Bulls may have another median horn, which is a male secondary sexual characteristic, arising from the forehead between the eyes. Habitat. Giraffes are thought to have coevolved with acacia trees in savanna biomes throughout Africa but their occurrence is now discontinuous. They have never occurred in the tropical rain forest of the Congo River Basin. Food and Feeding. Exclusively browsers of dicotyledons, their preferred browse is mainly various species of Acacia. Four species of Acacia and four species of Combretum predominate in their diet, as these are rich in protein and calcium to support growth of their large skeleton. Bulls browse at higher levels than cows. Giraffes are water dependent but can survive for long periods without drinking water, obtaining their daily water needs from succulent browse. Giraffids are foliovores, selecting succulent foliage, and have an efficient digestive system compared to that of grazers, which eat monocotiyledons. The Giraffe stomach is half the size of that of African buffalo (Syncerus sp.). Breeding. Giraffes are aseasonal breeders. Females become sexually mature at 4-5 years of age. Gestation lasts about 450 days; birth mass is around 100 kg. At birth shoulder height is 1-50-1-80 m. Calves are precocial, seeking the first suckle within an hour of birth. Calves lie isolated for up to three weeks. Lactation lasts for around twelve months. Calf mortality rate is up to 75% in the first year. In captivity Giraffes can live to 36 years of age. Bulls reach sexual maturity at 2-5—4 years of age but need to pass a behavioral threshold in the wild to compete with mature bulls. Activity patterns. Giraffes rest in the shade during the hottest time of day. Males orient their bodies towards the sun depending on whether they need to reduce or gain radiant heat, but females and calves select shade. They bend their heads backwards towards the body during deep sleep. They gallop in an ungainly manner, swinging the two legs on each side in unison. Movements, Home range and Social organization. Giraffes are mainly diurnal, and most active hours are spent feeding. Their gait is unusual in that both legs on one side swing in unison making their walk ungainly. Their maximum speed is about 56 km /h, and they can jump fences 1-5 m high. Giraffes are not territorial and home ranges vary from 25 km? to 160 km?. Major rivers are barriers, as Giraffes cannot swim and do not easily cross flowing rivers. Strong social bonds are lacking, and herds, mostly of females and their young, rarely consist of the same individuals for more than a few days. Status and Conservation. Classified as Least Concern on The IUCN Red List. Giraffes were provisionally classified as not threatened by IUCN, as the population in the wild consisted of at least 100,000 individuals and their distribution was widespread. However the West African subspecies peralta is now classified as Endangered, its numbers and range having fallen sharply. Previously its range was from Senegal to Lake Chad, but currently the only viable surviving population in this entire area consists ofless than 200 individuals in south-western Niger, with a range of about 15,000 km? Recent population estimates indicate a downward trend in numbers, which might eventually result in a different category. Some populations remain stable, some are increasing, and others are decreasing. Further studies aimed at resolving the taxonomic status of the various subspecies and populations will also allow better assessment of conservation status. In southern Africa, Giraffe has been reintroduced to many parts of the range from which they were previously eliminated, and it has been introduced into Swaziland. Bibliography. Aschaffenburg et al. (1962), Badlangana et al. (2009), Berry (1978), Bigalke (1951), Bond & Loffell (2001), Bredin et al. (2008), Brown et al. (2007), Cameron & Du Toit (2005, 2007), Cerling et al. (2004), Ciofolo & Pendu (1998), Dagg (1962, 1971), Dagg & Foster (1976, 1982), Fennessy & Brown (2010), Fennessy et al. (2001), Foster & Dagg, (1972), Gallagher et al. (1994), Hall-Martin & Skinner (1978), Hall-Martin, Skinner & Hopkins (1978), Hall-Martin, Skinner & Smith (1977), Hamilton (1973), Harris (1976), Hugh-Jones et al. (1978), Jacobson et al. (1986), Kidd (1900), Kok (1982), Kok & Opperman (1980), Kuntsch & Nel (1990), Langman (1977, 1978), Langman et al. (1982), Le Pendu et al. (2000), Leuthold (1979) Leuthold & Leuthold (1972, 1978), Lightfoot (1978), Lydekker (1904), Madden & Young (1982), Miller (1994, 1996), Mitchell (2009), Mitchell & Hattingh (1993), Mitchell & Skinner (1993, 2003, 2004, 2009), Mitchell, Bobbitt & Devries (2008), Mitchell, Maloney et al. (2006), Mitchell, van Schalkwyk & Skinner (2005), Mitchell, van Sittert & Skinner (2009a, 2009b), Pellew (1983a, 1983b, 1984a, 1984b), Pienaar (1969), Pilgrim (1911), Pratt & Anderson (1982), Ridewood (1904), Robin et al. (1960), Scheepers (1992), Shortridge (1934), Simmons & Scheepers (1996), Singer & Boné (1960), Skinner & Chimimba (2005), Skinner & Hall-Martin (1975) Skinner & Smithers (1990), Solounias (1999), Spinage (1968, 1993), Van Aarde (1976), Van Sittert et al. (2010), Van Schalkwyk et al. (2004), Von Linnaeus (1758), Wyatt (1971), Young & Okello (1998)., Published as part of Don E. Wilson & Russell A. Mittermeier, 2011, Giraffidae, pp. 788-802 in Handbook of the Mammals of the World – Volume 2 Hoofed Mammals, Barcelona :Lynx Edicions on page 801, DOI: 10.5281/zenodo.5719821

Giraffidae (Mammalia) from the late Neogene of the Republic of Macedonia (FYROM). Excavations undertaken in several sites of the Republic of Macedonia (FYROM) during the last decades have yielded rich mammalian faunas, including some significant giraffid specimens. An almost complete and uncrushed skull from the upper Miocene of Kirokuçuk is the best known specimen of Bohlinia attica; it confirms that this taxon is closely related to Giraffa, even though it is more primitive than the African forms of the latter genus. Helladotherium is represented by cranial and limb-bone remains. The association of these two genera is also found in Bulgaria and at Pikermi in Greece. Cranial elements, including most of a posterior horn, are assigned to a new species of Sivatherium, probably of Pliocene age, and characterized by its huge posterior horns. Its presence implies faunal connections between Southern Europe, Southern Asia and Africa at that time., Les fouilles menées dans plusieurs gisements de la République de Macédoine (ARYM) au cours des dernières décennies ont mis au jour de riches faunes mammaliennes, parmi lesquelles quelques pièces significatives de Giraffidae. Un crâne presque complet et non déformé du Miocène supérieur de Kirokuçuk est le meilleur spécimen connu de Bohlinia attica ; il confirme la proche parenté de ce taxon et de Giraffa, même s'il est plus primitif que les formes africaines de ce dernier genre. Helladotherium est représenté par des éléments de crânes et os des membres. On retrouve cette association de taxons en Bulgarie et à Pikermi en Grèce. Des éléments d'un crâne, incluant la plus grande partie d'une corne postérieure, d'âge probablement pliocène, sont attribués à une nouvelle espèce de Sivatherium, caractérisée par ses cornes postérieures gigantesques, impliquant des échanges fauniques entre l'Europe du Sud, l'Afrique et l'Asie du Sud à cette époque.

Giraffa Brünnich, 1771. Zool. Fundamenta, p. 36. TYPE SPECIES: Cervus camelopardalis Linnaeus, 1758. SYNONYMS: Camelopardalis, Orasius, Trachelotherium., Published as part of Peter Grubb, 1993, Order Artiodactyla, pp. 377-414 in Mammal Species of the World (2 nd Edition), Washington and London :Smithsonian Institution Press on page 383, DOI: 10.5281/zenodo.7359189, {"references":["Linnaeus, C. 1758. Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth ed. Vol. 1. Laurentii Salvii, Stockholm, 824 pp."]}

Giraffa camelopardalis (Linnaeus, 1758). Syst. Nat., 10th ed., 1:66. TYPE LOCALITY: "AEthiopia et Sennar", restricted to Sudan, Sennar, by Harper (1940:322). DISTRIBUTION: Formerly, Gambia and Senegal to Ethiopia and Somalia, south to Central African Republic, NE Zaire, Uganda and Tanzania; E and SW Zambia; S Angola, Zimbabwe and S Mozambique to South Africa, mostly north of the Orange River. Distribution now much restricted; in W Africa still present at least until recently in Mali, Burkina Faso, Niger, NE Nigeria and N Cameroon; in southern Africa, now ranging no further south than N Namibia, Botswana and E Transvaal (South Africa). SYNONYMS: aethiopica, angolensis, antiquorum, australis, biturigum, capensis, congoensis, cottoni, giraffa, hagenbecki, infumata, maculata, nigrescens, peralta, renatae, reticulata, rothschildi, schillingsi, senaariensis, thornicrofti, tippelskirchi, wardi. COMMENTS: Reviewed by Dagg (1971, Mammalian Species, 5)., Published as part of Peter Grubb, 1993, Order Artiodactyla, pp. 377-414 in Mammal Species of the World (2 nd Edition), Washington and London :Smithsonian Institution Press on page 383, DOI: 10.5281/zenodo.7359189, {"references":["Harper, F. 1940. The nomenclature and type localities of certain Old World mammals. Journal of Mammalogy, 2 l: 191 - 203; 322 - 332.","Dagg, A. I. 1971. Giraffa camelopardalis. Mammalian Species, 5: 1 - 8."]}

Giraffa Brunnich, 1772. Zool. Fundamenta, p. 36. ed., p. 12, 37. ISIS NUMBER: 5301419007001000000., Published as part of James H. Honacki, Kenneth E. Kinman & James W. Koeppl, 1982, Order Artiodactyla, pp. 315-343 in Mammal Species of the World (1 st Edition), Lawrence, Kansas, USA :Alien Press, Inc. & The Association of Systematics Collections on page 325, DOI: 10.5281/zenodo.7352976

Giraffa camelopardalis (Linnaeus, 1758). Syst. Nat., 10th ed., 1:66. TYPE LOCALITY: Ethiopia, Sennar. DISTRIBUTION: Senegal to Somalia to South Africa to S. Angola. COMMENT: Includes reticulata; reviewed by Dagg, 1971, Mamm. Species, 5:1 -8. ISIS NUMBER: 5301419007001001001., Published as part of James H. Honacki, Kenneth E. Kinman & James W. Koeppl, 1982, Order Artiodactyla, pp. 315-343 in Mammal Species of the World (1 st Edition), Lawrence, Kansas, USA :Alien Press, Inc. & The Association of Systematics Collections on page 325, DOI: 10.5281/zenodo.7352976, {"references":["Dagg, A. I. 1971. Giraffa camelopardalis. Mammalian Species, 5: 1 - 8."]}