Search

Background and Aims: We aimed to assess the associations of exposure to air pollutants and standard and advanced lipoprotein measures, in a nationwide sample representative of the adult population of Spain. Methods: We included 4647 adults (>18 years), participants in the national, cross‐sectional, population‐based di@bet.es study, conducted in 2008–2010. Standard lipid measurements were analysed on an Architect C8000 Analyzer (Abbott Laboratories SA). Lipoprotein analysis was made by an advanced 1H‐NMR lipoprotein test (Liposcale®). Participants were assigned air pollution concentrations for particulate matter <10 μm (PM10), <2.5 μm (PM2.5) and nitrogen dioxide (NO2), corresponding to the health examination year, obtained by modelling combined with measurements taken at air quality stations (CHIMERE chemistry‐transport model). Results: In multivariate linear regression models, each IQR increase in PM10, PM2.5 and NO2 was associated with 3.3%, 3.3% and 3% lower levels of HDL‐c and 1.3%, 1.4% and 1.1% lower HDL particle (HDL‐p) concentrations (p <.001 for all associations). In multivariate logistic regression, there was a significant association between PM10, PM2.5 and NO2 concentrations and the odds of presenting low HDL‐c (<40 mg/dL), low HDL‐p (

Osteopontin (OPN), a senescence‐associated secretory phenotype factor, is increased in patients with nonalcoholic fatty liver disease (NAFLD). Cellular senescence has been associated with age‐dependent hepatosteatosis. Thus, we investigated the role of OPN in the age‐related hepatosteatosis. For this, human serum samples, animal models of aging, and cell lines in which senescence was induced were used. Metabolic fluxes, lipid, and protein concentration were determined. Among individuals with a normal liver, we observed a positive correlation between serum OPN levels and increasing age. This correlation with age, however, was absent in patients with NAFLD. In wild‐type (WT) mice, serum and liver OPN were increased at 10 months old (m) along with liver p53 levels and remained elevated at 20m. Markers of liver senescence increased in association with synthesis and concentration of triglycerides (TG) in 10m OPN‐deficient (KO) hepatocytes when compared to WT hepatocytes. These changes in senescence and lipid metabolism in 10m OPN‐KO mice liver were associated with the decrease of 78 kDa glucose‐regulated protein (GRP78), induction of ER stress, and the increase in fatty acid synthase and CD36 levels. OPN deficiency in senescent cells also diminished GRP78, the accumulation of intracellular TG, and the increase in CD36 levels. In 20m mice, OPN loss led to increased liver fibrosis. Finally, we showed that OPN expression in vitro and in vivo was regulated by p53. In conclusion, OPN deficiency leads to earlier cellular senescence, ER stress, and TG accumulation during aging. The p53‐OPN axis is required to inhibit the onset of age‐related hepatosteatosis. [ABSTRACT FROM AUTHOR]

Background Pegvisomant is an effective treatment for acromegaly. Objective To investigate escape (loss of biochemical control in patients previously controlled) and lipodystrophy in acromegalic patients treated with pegvisomant and to evaluate possible associations with clinical features. Patients and methods Multicentre retrospective study involving 19 Spanish centres. Results Ninety-seven patients were included (59% women, mean age at diagnosis 42 ± 13 years, 80% macroadenomas); mean follow-up on pegvisomant was 5 ± 2·5 years, and 89 (92%) achieved normal IGF-1. Escape was reported in 30/89 (34%) of responders, after a mean treatment duration of 25 ± 21 months. The mean initial dose of pegvisomant was 11 ± 5 mg/day, and mean dose at escape was 14 ± 7 mg/day. Most patients (26/30, 87%) achieved control with dose increase (57%), additional medical treatment (3%) or both (27%). Mean new dose that controlled IGF-1 after escape was 20 ± 7 mg/day. Treatments associated were somatostatin analogues ( SSA in 47%), cabergoline ( CAB in 47%) and both (6%). Lipodystrophy was observed in 15 patients (13 females), mild in six, moderate in six, severe in three and persistent in four. Among patients with lipodystrophy, three escaped and three were nonresponders to pegvisomant. Four patients discontinued the drug, and four had dose reductions because of lipodystrophy. It tended to be more frequent in females ( P = 0·06) and in patients treated with triple association SSA+ CAB+ PEG ( P = 0·018). No relationship between escape and clinical variables was found, except prior CAB ( P = 0·04) and metformin treatment (0·02) and grade of lipodystrophy ( P = 0·02). Conclusions A significant proportion of patients treated with pegvisomant escaped (34%); however, the majority (87%) was easily controlled with either dose increase, further medical treatment or both. Lipodystrophy developed in 15%, mostly females, and influenced the response to treatment. [ABSTRACT FROM AUTHOR]

Eur J Clin Invest 2012 Abstract Background Although high-sensitivity C-reactive protein (hs-CRP) is currently used as a risk marker of cardiovascular disease, it has been suggested that genetic, clinical, biochemical or environmental factors could modify hs-CRP levels. The aim of this study was to investigate sources of interindividual hs-CRP variability in the Spanish population. Materials and methods A representative sample of the Spanish population within the di@bet.es study was used. Study variables included a clinical and demographic structured survey, a lifestyle survey, a physical examination, plasmatic hs-CRP and other biochemical parameters. Results Median and interquartile range of plasma hs-CRP values were 1·73 ± 2·75 mg/dL. Thirty per cent of the study population had hs-CRP levels above 3 mg/dL and 38% from 1 to 3 mg/dL. Body mass index was the strongest factor associated with moderate and high hs-CRP levels. Age, sex, waist-to-hip ratio, weight increase, plasma lipid levels, glucose metabolism (HOMA-IR and abnormal glucose regulation categories), pharmacological treatment (lipid-lowering agents, psychotropic drugs and levothyroxine), smoking, physical activity, different dietary patterns, quality of life and educational level were all significantly associated with hs-CRP levels. Interactions were observed between variables. These interactions modulated the effect of previously described factors on hs-CRP. Conclusions Thirty per cent of the Spanish population have hs-CRP levels considered to represent a cardiovascular risk. Different clinical, anthropometric, biochemical and environmental variables modulate hs-CRP levels. In addition, multiple interactions between variables complicate the interpretation of hs-CRP values. [ABSTRACT FROM AUTHOR]

Summary Context Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. Objective The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. Results A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Conclusions Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested. [ABSTRACT FROM AUTHOR]

Community-based research often brings investigators from different disciplinary backgrounds together with community representatives to conduct research on topics of mutual concern. This paper describes a case example that illustrates an interdisciplinary/intersectoral study of depression and barriers to mental health care among older adults and illustrate the factors central to implementing a successful research partnership. It will address the following conditions that facilitate and challenge interdisciplinary/intersectoral research: (1) achieving commonality of purpose in study design and research and referral approaches; (2) ensuring the ability to develop, field-test and implement psychometrically rigorous and culturally and qualitatively appropriate instruments; (3) building effective management structures for interdisciplinary/intersectoral research partnerships; and (4) identifying, training and supporting qualified researchers to carry out a mental health study with older ethnically diverse adults. The paper concludes with strengths and limitations of the approach. [ABSTRACT FROM AUTHOR]