Search

A new sodium ion image sensor containing a CCD-type semiconductor and a plasticized PVC sodium ion selective membrane was developed. The output potential slope was linear for sodium ion concentrations from 10−1 to 10−5 M. The optimum membrane possessed a near Nernstian response and high selectivity to sodium ions. The sensor can take sodium ion images with a fast response, 0.2 s per image, allowing it to easily monitor the ion-exchange reactions of a single Na-type cation-exchange resin bead. It was found that Na+-Ba2+ ion-exchange was faster than Na+-Ca2+ ion-exchange in the initial period.

Summary Nicotianamine (NA), a metal chelator ubiquitous in higher plants, serves as an antihypertensive substance in humans. To engineer a novel antihypertensive rice that contains larger amounts of NA, the barley NA synthase gene, HvNAS1, was introduced into rice via Agrobacterium-mediated transformation. The introduced HvNAS1 was driven by pGluB-1, which induces strong gene expression in the endosperm of rice seeds. The NA content in transgenic rice seeds was up to fourfold greater than that in non-transgenic rice seeds. The Cre/loxP DNA excision (CLX) system was used to remove the selectable marker gene for antibiotic resistance. Furthermore, the transgenic rice was crossed with a cleistogamous mutant to prevent gene transfer via pollen dispersal. These two modifications may minimize public concern with regard to the use of this transgenic rice.

Iron (Fe) deficiency is a major abiotic stress in crop production. Although responses to Fe deficiency in graminaceous plants, such as increased production and secretion of mugineic acid family phytosiderophores (MAs), have been described, the gene regulation mechanisms related to these responses are largely unknown. To elucidate the regulation mechanisms of the genes related to Fe acquisition in graminaceous plants, we characterized the Fe-deficiency-inducible basic helix-loop-helix transcription factor OsIRO2 in rice. In yeast cells, OsIRO2 functioned as a transcriptional activator. In rice, overexpression of OsIRO2 resulted in increased MAs secretion, whereas repression of OsIRO2 resulted in lower MAs secretion and hypersensitivity to Fe deficiency. Northern blots revealed that the expression of the genes involved in the Fe(III)-MAs transport system was dependent on OsIRO2. The expression of the genes for nicotianamine synthase, a key enzyme in MAs synthesis, was notably affected by the level of OsIRO2 expression. Microarray analysis demonstrated that OsIRO2 regulates 59 Fe-deficiency-induced genes in roots. Some of these genes, including two transcription factors upregulated by Fe deficiency, possessed the OsIRO2 binding sequence in their upstream regions. OsIRO2 possesses a homologous sequence of the Fe-deficiency-responsive cis-acting elements (IDEs) in its upstream region. We propose a novel gene regulation network for Fe-deficiency responses, including OsIRO2, IDEs and the two transcription factors.

Mugineic acid family phytosiderophores (MAs) are metal chelators that are produced in graminaceous plants in response to iron (Fe) deficiency, but current evidence regarding secretion of MAs during zinc (Zn) deficiency is contradictory. Our studies using HPLC analysis showed that Zn deficiency induces the synthesis and secretion of MAs in barley plants. The levels of the HvNAS1, HvNAAT-A, HvNAAT-B, HvIDS2 and HvIDS3 transcripts, which encode the enzymes involved in the synthesis of MAs, were increased in Zn-deficient roots. Studies of the genes involved in the methionine cycle using microarray analysis showed that the transcripts of these genes were increased in both Zn-deficient and Fe-deficient barley roots, probably allowing the plant to meet its demand for methionine, a precursor in the synthesis of MAs. In addition, HvNAAT-B transcripts were detected in Zn-deficient shoots, but not in those that were deficient in Fe. Increased synthesis of MAs in Zn-deficient barley was not due to a deficiency of Fe, because Zn-deficient barley accumulated more Fe than did the control plants, ferritin transcripts were increased in Zn-deficient plants, and Zn deficiency promoted Fe transport from root to shoot. Moreover, analysis using the positron-emitting tracer imaging system (PETIS) confirmed that more 62Zn(II)-MAs than 62Zn2+ were absorbed by the roots of Zn-deficient barley plants. These data suggest that the increased biosynthesis and secretion of MAs arising from a shortage of Zn are not due to an induced Fe deficiency, and that secreted MAs are effective in absorbing Zn from the soil.

Histiocytoid breast carcinoma (HBC) is a rare type of breast carcinoma with morphologic characteristics resembling those of histiocytes. Described herein are cytological and histological findings in a case of HBC. Fine-needle aspiration cytology revealed numerous loosely cohesive tumor cells with abundant foamy to granular cytoplasm and bland-appearing nuclei. The resected tumor exhibited a solid growth pattern instead of classic invasive lobular patterns observed in most reported cases of HBC. However, distinct intracytoplasmic lumina and Pagetoid extension to ducts suggested that this tumor was a variant of invasive lobular carcinoma. To determine the cause of the loose cellular cohesiveness of this HBC, its expression of the epithelium-related cell adhesion molecules E-cadherin and CD44v8-10 (CD44 epithelial variant) was examined. Immunohistochemically, E-cadherin was not detected, similar to most lobular carcinomas. Furthermore, competitive reverse transcription-polymerase chain reaction (RT-PCR) analyses among alternatively spliced variants of CD44 revealed that the ratio of expression of CD44v8-10 to that of CD44v10 (dominant variant in leukocytes) was lower than that for the reference breast carcinoma samples. It is concluded that the present case of HBC was a solid variant of invasive lobular carcinoma exhibiting foamy to granular cytoplasmic change. Decreased expression of both E-cadherin and CD44 epithelial variant may be responsible for the loose cellular cohesiveness observed in HBC.

*† Summary We identified 18 putative yellow stripe 1 (YS1)-like genes (OsYSLs) in the rice genome that exhibited 36–76% sequence similarity to maize iron(III)-phytosiderophore transporter YS1. Of particular interest was OsYSL2, the transcripts of which were not detected in the roots of either iron-sufficient or iron-deficient plants, but dramatic expression was induced in the leaves by iron deficiency. Based on the nucleotide sequence, OsYSL2 was predicted to encode a polypeptide of 674 amino acids containing 14 putative transmembrane domains. OsYSL2:green fluorescent protein (GFP) was localized in the plasma membrane of onion epidermal cells. Promoter:b-glucuronidase (GUS) analysis revealed that OsYSL2 was expressed in companion cells in ironsufficient roots. GUS activity was increased in companion cells, but no GUS staining was observed in epidermal or cortex cells, even in iron-deficient roots. In the leaves and leaf sheaths of iron-sufficient rice, GUS staining was observed in phloem cells of the vascular bundles. In iron-deficient leaves, the OsYSL2 promoter was active in all tissues with particularly strong GUS activity evident in companion cells. The phloem-specific expression of the OsYSL2 promoter suggests that OsYSL2 is involved in the phloem transport of iron. Strong OsYSL2 promoter activity was also detected in developing seeds. Electrophysiological measurements using Xenopus laevis oocytes showed that OsYSL2 transported iron(II)-nicotianamine (NA) and manganese(II)-NA, but did not transport iron(III)-phyosiderophore. These results suggest that OsYSL2 is a rice metal-NA transporter that is responsible for the phloem transport of iron and manganese, including the translocation of iron and manganese into the grain.

Effects of long-term suppression of bone remodeling by bisphosphonate were investigated in cortical bone of dog rib. Although microdamage was accumulated, BMD was increased without increasing cortical bone area. Consequently, the intrinsic material properties were not reduced. Introduction: Recently, we have reported that long-term suppression of bone remodeling increases microdamage accumulation but is not necessarily associated with vertebral fragility because of compensated increase of bone mass and improved microarchitecture. This study aimed to investigate the effect of long-term suppression of bone remodeling by bisphosphonate on the degree of mineralization, accumulation of microdamage, and mechanical properties of cortical bone in the same dogs. Materials and Methods: Twenty-nine 1-year-old beagles (15 males, 14 females) were divided into three groups and treated daily with vehicle (CNT) or with incadronate at a dose of 0.3 (LOW) or 0.6 mg/kg/day (HIGH) orally for 3 years. After death, pQCT, histomorphometry, microdamage measurements, and three-point bending mechanical test were performed using the ninth rib. Results: Cortical BMD was increased in the incadronate-treated groups. Cortical activation frequency was suppressed by 82% and 70% in HIGH and LOW, respectively, compared with CNT, without impairment of mineralization. Microdamage accumulation was increased in both incadronate-treated groups. Although there were no significant differences in total and cortical area among the three groups, structural mechanical properties were significantly increased after incadronate treatment while intrinsic material properties were not changed in the incadronate-treated groups. Conclusion: This study suggests that long-term suppression of bone remodeling by bisphosphonate increases microdamage accumulation. However, this was not necessarily associated with a reduction of intrinsic material properties probably because of an increased degree of mineralization.

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.

To determine the responses of plants to deficiencies of multiple metals, tobacco plants (Nicotiana tabacum L.) were subjected to treatments that were deficient in combinations of Fe and two other micronutrients, Zn and Mn. The response was measured using macro indices, including plant appearance, FW, chlorophyll concentration, and mineral concentrations, and with a molecular index, the barley (Hordeum vulgare L.) Ids2 promoter/GUS fusion gene system (Yoshihara et al. 2003, Plant Biotech 20: 33-41). Tobacco plants grown in medium with combined deficiencies grew better and had higher chlorophyll concentrations than did plants grown on medium deficient in Fe only, although the measured Fe concentrations in the plant tissues were essentially the same. The 1ds2/GUS expression responded to Fe deficiency, but not to Mn or Zn deficiencies in tobacco plants when Fe was present. Tobacco plants grown in medium with combined deficiencies had clearly detectable GUS activity, but the response was significantly lower than that in tobacco plants deficient in Fe only. The Fed-deficiency symptoms were mitigated at both the visible and molecular levels. Although more precise experimental evidence is needed to explain the mitigation mechanism, the balance of minerals was shown to be an important parameter to consider when estimating iron deficiency based on tobacco plant responses.

In the development of the CNS, radial glial cells are among the first cells derived from neuroepithelial cells. Recent studies have reported that radial glia possess properties of neural stem cells. We analyzed the antigen expression and distribution of radial glia after spinal cord injury (SCI). Sprague-Dawley rats had a laminectomy at Th11-12, and spinal cord contusion was created by compression with 30g of force for 10 min. In the injury group, rats were examined at 24 h and 1, 4, and 12 weeks after injury. Frozen sections of 20-μm thickness were prepared from regions 5 and 10 mm rostral and caudal to the injury epicenter. Immunohistochemical staining was performed using antibodies to 3CB2 (a specific marker for radial glia), nestin, and glial fibrillary acidic protein (GFAP). At 1 week after injury, radial glia that bound anti-3CB2 MAb had spread throughout the white matter from below the pial surface. From 4 weeks after injury, 3CB2 expression was also observed in the gray matter around the central canal, and was especially strong around the ependymal cells and around blood vessels. In double-immunohistochemical assays for 3CB2 and GFAP or 3CB2 and nestin, coexpression was observed in subpial structures that extended into the white matter as arborizing processes and around blood vessels in the gray matter. The present study demonstrated the emergence of radial glia after SCI in adult mammals. Radial glia derived from subpial astrocytes most likely play an important role in neural repair and regeneration after SCI. GLIA 42:172–183, 2003. © 2003 Wiley-Liss, Inc.

This study aimed to investigate the effect of long-term suppression of bone resorption by bisphosphonate on the microstructure, accumulation of microdamage, and mechanical properties of trabecular bone. Twenty-nine 1-year-old beagles (15 males, 14 females) were divided into three groups. The control group (CNT) was treated daily with vehicle, and the other two groups were treated with incadronate at a dose of 0.3 mg/kg/day (LOW) or 0.6 mg/kg/day (HIGH) orally for 3 years. After death, the second thoracic vertebra was scanned with microcomputed tomography (micro-CT) and assigned to histomorphometric and microdamage measurements. The fourth lumbar vertebra was mechanically tested by compression. Incadronate concentration in bone was measured in the 11th thoracic vertebra. Micro-CT analysis demonstrated a platelike trabecular structure and increased concave surface of trabeculae in the thoracic vertebra of incadronate-treated groups. Three-year incadronate treatment significantly suppressed trabecular activation rates by 56% in LOW and 67% in HIGH without impairment of mineralization, and increased microdamage accumulation in both incadronate-treated groups. Trabecular bone volume was significantly increased in both LOW and HIGH groups, and vertebral strength was significantly increased in the HIGH group compared with the CNT group. However, intrinsic material properties such as normalized ultimate stress and normalized toughness were reduced in incadronate-treated groups. Incadronate concentration in bone was dose-dependent. This study suggests that long-term suppression of bone remodeling increases microdamage accumulation, but this is not necessarily associated with vertebral fragility because of compensated increase of bone mass and improved microarchitecture.

We investigated the effects of inhibitors of bone resorption (estrogen, raloxifene, and alendronate) on the processes of fracture repair in ovariectomized (OVX) rats. One hundred forty female Sprague-Dawley rats at 3 months of age were either OVX or sham-operated and divided into five groups: sham control, OVX control, estrogen (17alpha-ethynyl estradiol [EE2], 0.1 mg/kg), raloxifene (Rlx, 1.0 mg/kg), and alendronate (Aln, 0.01 mg/kg) groups. Treatment began immediately after the surgery. Four weeks postovariectomy, prefracture controls were killed and bilateral osteotomies were performed on the femoral midshafts and fixed with intramedullary wires. Treatment was continued and fracture calluses were excised at 6 weeks and 16 weeks postfracture for evaluation by X-ray radiography, quantitative computed tomography (QCT,) biomechanical testing, and histomorphometry. At 6 weeks postfracture, Aln and OVX had larger calluses than other groups. Sham and OVX had higher ultimate load than EE2 and Rlx, with Aln not different from either control. Aln calluses also contained more mineral (bone mineral content [BMC]) than all other groups. By 16 weeks postfracture, OVX calluses were smaller than at 6 weeks and the dimensions for Aln had not changed. Aln had higher BMC and ultimate load than OVX, EE2, and Rlx. EE2 and Rlx had similar biomechanical properties, which were similar to sham. Interestingly, OVX and Aln animals were heavier than other groups at all time points; therefore, ultimate load was normalized by body weight to show no significant differences in strength of the whole callus between groups at either 6 weeks or 16 weeks postfracture. However, Aln strongly suppressed remodeling of the callus, resulting in the highest content of woven bone, persistent visibility of the original fracture line, and lowest content of lamellar bone, compared with other groups. Therefore, the larger Aln callus appeared to be a remarkable, morphological adaptation to secure the fracture with inferior material. In conclusion, OVX-stimulated bone turnover resulted in the fastest progression of fracture repair that was most delayed with Aln treatment, consistent with marked suppression of bone resorption and formation activity. Estrogen and Rlx had similar effects that were generally similar to sham, indicating that mild suppression of bone turnover with these agents has insignificant effects on the progression of fracture repair.

To acquire Fe from soil, graminaceous plants secrete mugineic acid family phytosiderophores (MAs) from their roots. The secretion of MAs increases in response to Fe deficiency, and shows a distinct diurnal rhythm. We used a microarray that included 8987 cDNAs of rice EST clones to examine gene expression profiles in barley roots during Fe-deficiency stress. Approximately 200 clones were identified as Fe-deficiency-inducible genes, of which seven had been identified previously. In order to meet the increased demand for methionine to produce MAs, Fe-deficiency enhances the expression of genes that participate in methionine synthesis, as well as recycling methionine through the Yang cycle. Of these 200 genes, approximately 50 exhibited different transcription levels in Fe-deficient roots at noon and at night. Northern blot analysis of time course experiments confirmed that five of these genes exhibited a diurnal change in their level of expression. The diurnal changes in the expression of these genes suggest that polar vesicle transport is involved in the diurnal secretion of MAs.

Water (H 2 15 O) translocation from the roots to the top of rice plants (Oryza saliva L. cv. Nipponbare) was visualized over time by a positron-emitting tracer imaging system (PETIS). H 2 15 O flow was activated 8 min after plants were exposed to bright light (1500 μmol m -2 s -1 ). When the light was subsequently removed, the flow gradually slowed and completely stopped after 12 min. In plants exposed to low light (500 μmol m -2 s -1 ), H 2 15 O flow was activated more slowly, and a higher translocation rate of H 2 15 O was observed in the same low light at the end of the next dark period. NaCI (80 mM) and methylmercury (1 mM) directly suppressed absorption of H 2 15 O by the roots, while methionine sulfoximine (1 mM), abscisic acid (10 pM) and carbonyl cyanide m-chlorophenylhydrazone (10 mM) were transported to the leaves and enhanced stomatal closure, reducing H 2 15 O translocation.

The formation of multinucleated giant cells (MGCs) from monocytes/macrophages is controlled by various cytokines, the roles of which are not fully understood. Both interleukin (IL)-4 and 1alpha,25(OH)(2) vitamin D(3) (D(3)) are known to induce MGC formation from monocytes/macrophages. D(3) is also known as a stimulator of osteoclast formation in the presence of stroma cells, and IL-4 as an inhibitor. Previously, we showed that IL-4-induced MGCs from monocytes/macrophages expressed tartrate resistant acid phosphatase (TRAP) activity and hydroxyapatite-resorptive activity in the presence of M-CSF without stroma cells. In this study, we examined the effects of D(3) and/or IL-4 on MGC formation and the characteristics of these MGCs using a monoblastic cell line (UG3), to elucidate the involvement of these factors in osteoclast development without stroma cells. D(3)-induced MGCs showed none of the markers of osteoclasts, such as TRAP activity, calcitonin receptor (cal-R) expression, hydroxyapatite-resorptive activity, and bone-resorptive activity. A low concentration of D(3) synergistically stimulated IL-4-induced TRAP-positive MGC formation, whereas a high concentration of D(3) inhibited it. When IL-4 was added on day 7 of the 2-week culture with D(3), TRAP positivity reached maximum. On the other hand, delayed addition of D(3) on day 7 of culture did not increase the TRAP positivity. Although the fusion rate increased during the first week of the 2-week culture in the presence of D(3), it increased further in the second week following the addition of IL-4 on day 7. Furthermore, IL-4-induced, or IL-4- and D(3)-induced MGCs differentiated into functional osteoclasts with bone-resorptive activity following coculture with osteoblastic cells, whereas D(3)-induced MGCs did not acquire bone-resorptive activity even after coculture with osteoblastic cells in the presence of D(3). These findings suggest that IL-4 initiates osteoclast development of UG3 cells, although stroma cells were necessary for development of functional osteoclasts. On the other hand, D(3) had only a "supportive" effect on this differentiation. IL-4 and direct contact with stroma cells may regulate different stages in the multistep process of osteoclastogenesis of UG3 cells.

The effect of zinc nutritional status on the time course of phytosiderophore release, and uptake of iron and translocation of iron to the shoot, was studied in nutrient solution cultures for two cultivars of wheat (Triticum aestivum. cv. Aroona: T. durum, cv. Duratit) differing in their susceptibility to zinc deficiency. In the zinc-efficient cultivar Aroona, under zinc deficiency translocation of iron from roots to shoot was significantly decreased in 13- and 15-day-old plants, whereas release of phytosiderophores was enhanced when the plants were 16 days old. As zinc deficiency became more severe in older plains, translocation of iron to the shoot was further decreased and release of phytosiderophores was further enhanced. Resupplying zinc in nutrient solution to zinc-deficient plants significantly increased the translocation of iron to the shoot after 48 and 72 h. Concomitantly the release of phytosiderophores was repressed. The other cultivar Durati classified as zinc-inefficient in field observations differed from cv. Aroona by showing a lower rate of phytosiderophore release under Zinc deficiency, and a less impaired translocation of iron to the shoot. Foliar application of iron citrate to zinc-deficient Aroona plants repressed the release of phytosiderophores and increased iron concentrations in shoot and roots. Application of 55Fe to the leaves demonstrated that retranslocation of iron from the shoot to the roots was not affected by the zinc nutritional status. It is concluded that enhanced release of phytosiderophores in zinc-deficient wheat plants was induced primarily by impaired trans-location of iron lo the shoot.

The purpose of this work is to use dynamic histomorphometry to evaluate the basic biological mechanisms by which hydroxyapatite/tricalcium phosphate (HA/TCP) implant coatings accelerate bone formation rates. Twenty-five rabbits had an HA/TCP coated cylindrical titanium fiber metal mesh implant surgically placed in the subchondral bone of the proximal tibia and a noncoated implant placed in the contralateral tibia. Twenty-two of these animals had HA/TCP coated cylindrical solid titanium implants placed in the distal femur and an uncoated implant placed in the contralateral femur. The animals were double labeled with vital stains, and sacrificed at 3, 6, 16, or 26 weeks after surgery. Histomorphometric analyses were done of the bone implant interfaces. Both static and dynamic histomorphometric parameters indicate that HA/TCP coatings stimulate faster bone ingrowth to coated fiber metal implants through the early production of woven bone and by subsequent rapid lamellar bone formation rates. Coated fiber metal implants demonstrated significantly more bone ingrowth than noncoated implants through 16 weeks postimplantation, but not by 26 weeks. In solid implants, the differences between coated and noncoated implants are less pronounced and not statistically significant, although there is a trend toward increased bone apposition to the surface of the implants over the first 16 weeks following implantation. The clinical significance of these results is that coated implants may allow earlier return to normal weightbearing.

The facile synthesis of phenyl-substituted and condenced 5-azaazulene ring systems was accomplished by the reaction of 2-formyl-6-dimethylaminofulvene with several phenyl-substituted (vinylimino)phosphoranes in one-flask operation.

A short new synthesis of phenyl-substituted and annulated 5-azaazulene (cyclopenta[c]azepine) derivatives 15–18 consists of the reaction of [(1-phenylvinyl)imino]- and benz-annulated [(cycloalkenyl)imino]-phosphoranes 8–11 with 5-(dimethylaminomethylene)cyclopenta-1,3-dienecarbaldehyde 1 in an enamine alkylation (Michael addition) process, subsequent proton migration–ketonization, and condensation of the formyl group with the iminophosphorane moiety (aza-Wittig reaction). On the other hand, reactions of aldehyde 1 with (vinylimino)phosphoranes12–14, which have no phenyl group at the α-position relative to the nitrogen atom, consist of a intramolecular aza-Wittig reaction or a substitution reaction of aldehyde 1 with phosphoranes 12–14 and subsequent hydrolysis to afford 5-(aminomethylene)cyclopenta-1,3-dienecarbaldehyde 19 and its derivatives 20 and 21, respectively. In the context of selectivity observed in the reaction of phosphoranes 8–11 and 12–14 with aldehyde 1, respectively, MNDO calculations on compounds 1 and 12A, 12B as well as on model compounds 8C–12C were performed to gain insight via a theoretical interpretation based upon frontier molecular orbital theory (FMO): the former reaction, giving 5-azaazulene derivatives, would be an FMO-controlIed reaction, while the latter is a charge-controlled reaction. Several spectral and chemical properties of heterocycles of 16–18 are analysed.

Forms of iron in leaves of wild-type tomato (Lycopersicon esculentum Mill. cv. Bonner Beste) and of the nicotianamine-free mutant, chloronerva, were analysed by X-ray absorption near-edge structure (XANES). The XANES spectra of the wild-type leaf veins and of the interveinal areas of leaves of both wild-type and chloronerva had a lower edge energy than the spectrum of the chloronerva leaf veins. This decrease may be caused by the presence of ferrous iron. Thus nicotianamine may play an important role in maintaining iron in the ferrous form in the veins of tomato leaves. Copyright © 2000 John Wiley & Sons, Ltd.