Search

Aims Xp11 rearrangement in renal cell carcinoma (RCC) typically involves gene fusion to the gene encoding transcription factor E3 (TFE3), a member of the microphthalmia-associated transcription factor family on chromosome Xp11.2. Dual-colour break-apart fluorescence in-situ hybridisation (FISH) is recommended to confirm histological diagnoses. Recently, RNA-binding motif protein 10 (RBM10), encoded by a gene on chromosome Xp11.3, was identified as a chimeric partner of TFE3; thus, RBM10-TFE3 fusion results from paracentric inversion. RBM10-TFE3 RCC may yield a false-negative result in FISH analysis of TFE3 expression. The aim of the present study was to investigate the clinicopathological features of RBM10-TFE3 RCC. Methods and results Ten patients with RBM10-TFE3 RCC aged 31-71 years were investigated. Histological analysis, immunostaining, dual-colour break-apart FISH for TFE3, reverse transcription polymerase chain reaction and sequencing analysis were performed. No patient had a history of exposure to chemotherapy. Two of these patients died of RCC, and three were alive but developed metastases. Microscopically, the tumours were composed of a mixed architecture of tubulocystic and papillary patterns with scattered psammoma bodies. The tumours showed strong nuclear immunoreactivity for TFE3. FISH showed consistent closely spaced split signals in the RCCs of four patients, and polysomic signals with occasional closely spaced split signals in the RCCs of six patients. Of the latter six patients, five had renal failure, and four developed tumours in kidneys subjected to haemodialysis. Conclusions The present study suggests that the carcinogenesis of RBM10-TFE3 RCC in some, but not all, patients may be associated with chronic kidney disease. The aggressive nature of RBM10-TFE3 RCC should be considered, as five patients experienced metastases.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Aims Denosumab, a human monoclonal antibody directed against the receptor activator of nuclear factor-κB ligand (RANKL), is a therapeutic agent for giant cell tumour of bone (GCTB). Although some studies have reported that denosumab shrinks tumours and induces bone formation, the actual effects of RANKL suppression on GCTB remain unclear. A mutation in the H3 histone family member 3A gene (H3F3A) was recently identified as a genetic signature for GCTB. The aim of this study was to investigate the histopathological features and H3F3A mutation status of GCTBs treated with denosumab. Methods and results Nine biopsy-diagnosed patients with GCTB, who underwent curettage after neoadjuvant denosumab therapy, were reviewed. Immunohistochemistry for NFATc1 (an osteoclast marker), RUNX2 (an osteoblast marker) and histone H3.3 G34W (G34W, a GCTB marker) was performed; furthermore, H3F3A mutation status was examined with direct sequencing. Before therapy, GCTBs comprised NFATc1+ and RUNX2+ cells. All cases were G34W+ and contained H3F3A mutations. After therapy, the osteoclast-like giant cells disappeared. Areas of slender spindle cell proliferation and reticular woven bone that were NFATc1- and RUNX2+ replaced the lesions in various proportions. However, all post-therapy lesions still contained many G34W+ cells and harboured H3F3A mutations. Immunofluorescence double staining revealed that RUNX2+ mononuclear cells coexpressed G34W in pre-therapy and post-therapy lesions. Two patients experienced radiologically detected local recurrence within 2 years. Conclusions Denosumab therapy effectively decreases the number of osteoclastic cells in GCTBs. However, the neoplastic cells with H3F3A mutation survive denosumab treatment and undergo dramatic histological changes in response to this agent.

Two novel rearranged limonoids, guianolactones A (1) and B (2), were isolated from Carapa guianensis Aubl. (Meliaceae) seeds. The structures of 1 and 2 with their absolute configurations were elucidated in detailed examinations using single-crystal X-ray diffraction analyses and 2D NMR spectra. Guianolactone A (1) has a novel 5/6/6/6/6 pentacyclic core including two δ-lactone and a tetrahydropyran ring, while guianolactone B (2) is a novel limonoid with a 6/6/5/6/6 pentacyclic core featuring a δ-lactone and a tetrahydrofuran ring.

Birt-Hogg-Dube syndrome (BHD) is a rare genetic disorder characterized by fibrofolliculomas, pulmonary cysts and renal cell carcinomas (RCCs). The affected individuals inherit germline mutations in the folliculin gene (FLCN). We investigated the mutation spectrum and clinicopathologic findings of 312 patients from 120 different families (119 Japanese and 1 Taiwanese). A total of 31 different FLCN sequence variants were identified. The majority were c.1285dupC (n = 34), c.1533_1536delGATG (n = 25), and c.1347_1353dupCCACCCT (n = 19). Almost all patients presented with pulmonary cysts. The incidence of RCCs in FLCN mutation carriers over the age of 40 was 34.8% (40/115). Fifty-five RCC lesions were surgically resected; most were either chromophobe RCC (n = 24; 43.6%) or hybrid oncocytic/chromophobe tumors (19; 34.5%). Seventy-six of 156 FLCN mutation carriers (120 probands and 36 sibs, 48.7%) had skin papules; however, cutaneous manifestations were so subtle that only one patient voluntarily consulted dermatologists. Japanese Asian BHD families have three FLCN mutational hotspots. Recurrent episodes of pneumothoraces are the major symptoms suggestive of a BHD diagnosis in our cohort. Characteristic features of lung and kidney lesions may be more informative than fibrofolliculomas as diagnostic criteria for BHD in the Japanese Asian population.

A new rearranged ergostane-type steroid, named eringiacetal A (1), together with known compound 2, were isolated from the fruiting bodies of Pleurotus eryngii (Pleurotaceae). Its structure was fully elucidated by NMR spectroscopy and X-ray crystallography. Eringiacetal A (1) features an unprecedented 5,6-seco-(5S,6R,7R,9S)-5,6:5,7:6,9-triepoxyergosta-8(14),22-diene-3β,7β-diol. This is the first report of a 5,6-seco-ergostane-type steroid. A plausible biogenetic pathway of 1 from 2 is also described. Furthermore, isolated compounds were evaluated for inhibitory effects on nitric oxide (NO) production induced by lipopolysaccharide in macrophages. Compound 1 exhibited inhibitory activity on NO production (IC50 = 19.9 μM) accompanied by modest cytotoxicity (IC50 = 25.6 μM). Compound 2 did not have inhibitory effects on NO production or cytotoxicity (IC50 > 100 μM each).

Birt-Hogg-Dube syndrome (BHD) is an autosomal dominant disorder associated with a germline mutation of folliculin (FLCN). The affected families are at a high risk for developing multiple renal cell carcinomas (RCC). Little is known about the immunostaining patterns of mutant FLCN-associated RCCs. We investigated 32 RCCs obtained from 17 BHD patients. The studied tumors included chromophobe RCCs (n = 15), hybrid oncocytic/chromophobe tumors (HOCT) (n = 14) and clear cell RCCs (n = 3). Almost all chromophobe RCCs and HOCTs revealed positive staining for S100A1, Ksp-cadherin and CD82. They stained either focally or diffusely for CK7, and were negative for CA-IX. All clear cell RCCs were positively stained for CA-IX and negative for CK7. These data confirmed that mutant FLCN-associated oncocytic and clear cell RCCs exhibited generally similar immunostaining patterns compared to their sporadic counterparts. Frequent positive staining for S100A1, Ksp-cadherin and CD82 in chromophobe RCCs and HOCTs indicated that these two types were relatively similar rather than distinctively different in their patterns of immunoreactivity. Characteristic peri-nuclear halos and polygonal cells with clear cytoplasm, which often misleads pathologists into the diagnosis of clear cell RCC, should be carefully examined using an immunohistochemical panel including CA-IX, Ksp-cadherin, CD82 and CK7.

Two of each semisynthetic lanostane- and cycloartane-type triterpenes with a cyano-enone functionality, i.e., 13 and 18, and 23 and 28, respectively, sixteen of their synthetic intermediates, 9-12, 14-17, 19-22, and 24-27, along with seven semisynthetic oxygenated triterpene acetates, 29-35, and eight natural hydroxy triterpenes, 1-8, were evaluated for their cytotoxic activities against leukemia (HL60), lung (A549), stomach (AZ521), and breast (SK-BR-3) cancer cell lines. One natural triterpene, 8, and ten semisynthetic triterpenes, 9, 13, 15, 18, 23, 25, 28, 29, 32, and 33, exhibited potent cytotoxicities against one or more cell lines with IC50 values in the range of 1.4-9.9 μM. Two lanostane-type triterpenes with a cyano-enone functionality, 3-oxolanosta-1,8,24-triene-2-carbonitrile (13) and 3-oxolanosta-1,8-diene-2-carbonitrile (18), induced apoptosis in HL60 cells, as observed by membrane phospholipid exposure in flow cytometry. Western blot analysis showed that 13 and 18 significantly reduced procaspases-3, -8, and -9, and increased cleaved caspases-3, -8, and -9. These findings indicated that compounds 13 and 18 induced apoptosis in HL60 cells via both the mitochondrial and the death receptor-mediated pathways. In addition, upon evaluation of the inhibitory effects on EpsteinBarr virus early antigen (EBV-EA) activation induced with 12-O-tetradecanoylphorbol-13-acetate (TPA) in Raji cells, seven natural triterpenes, 1-6 and 8, and ten semisynthetic triterpenes, 9, 10, 14, 15, 19, 20, 24, 25, 29, and 30, exhibited inhibitory effects which were higher than that of β-carotene, a vitamin A precursor studied widely in cancer-chemoprevention animal models.

Birt-Hogg-Dube syndrome (BHD) is an autosomal dominant disorder characterized by fibrofolliculomas, renal tumors and pulmonary cysts with repeated pneumothorax. This disorder is caused by mutations in the gene that encodes folliculin (FLCN). FLCN is known to be involved in the signaling of mammalian target of rapamycin (mTOR). We investigated the lung of a BHD patient who presented with a unique mutation. A 33-year-old woman visited our hospital due to repeated pneumothorax. Histopathologic study of the resected lung demonstrated multiple epithelial cysts. An increase of blood vessels was observed in the vicinity of subpleural cysts. Genomic DNA analysis revealed heterozygous mutation at the 3' end of intron 5 of the FLCN gene. Total mRNA and protein were extracted from the resected lung tissue. RT-PCR and sequence analysis demonstrated the production of exon 6-skipped FLCN mRNA. In Western blotting, the band intensities of phospho-mTOR, phospho-S6, phospho-Akt, hypoxia-inducible factor (HIF)-1α and vascular endothelial growth factor (VEGF) were increased in the BHD lung compared with normal lungs. Histopathologic analysis demonstrated strong immunostainings of mTOR signaling molecules in cyst-lining cells. Collective data indicates that dysregulation of mTOR signaling facilitates S6-mediated protein synthesis and HIF-1α-mediated angiogenesis, which may contribute to the development of pulmonary cysts in this disorder.

Cancer chemoprevention, the prevention of cancer by ingestion of chemical agents that reduce the risk of carcinogenesis, is one of the potent ways to reduce morbidity and mortality. We have been searching for cancer chemopreventive agents from the leaves and barks of coniferous trees that have been treated as waste in the forestry industry. We have previously reported the isolation of spiro-biflavonoids, named as abiesinols, and a neolignan from the MeOH extract of the bark of Abies sachalinensis. These compounds were tested for their inhibitory effects on the activation of (±)-(E)-methyl-2-[(E)-hydroxyimino]-5-nitro-6-methoxyhex-3-enamide (NOR 1), a nitric oxide (NO) donor, as a primary screening test for anti-tumor initiators. All compounds tested exhibited potent inhibitory effects on NOR 1 activation. Furthermore, abiesinol A, bearing a spiro-biflavonoid skeleton, showed remarkable anti-tumor-initiating activity in the in vivo two-stage mouse skin carcinogenesis test using peroxynitrite (ONOO(-); PN) as the initiator and 12-O-tetradecanoylphorbol-13-acetate (TPA) as the promoter.

11- and 4′-epichaetomugilin A were isolated from a strain of Chaetomium globosum that was originally isolated from the marine fish Mugil cephalus. 11-Epichaetomugilin A is the first compound to have an opposite absolute configuration at C(11) to that of other azaphilones isolated to date. Their absolute configurations were elucidated on the basis of spectroscopic analyses, including 1D- and 2D-NMR techniques, and some chemical transformations. 11-Epichaetomugilin A weakly inhibited the growth of cultured P388 cells and HL-60 cells (IC50 88.9 and 66.7 μM, resp.).

Eight spiro-biflavonoids named abiesinols A–H, along with three neolignans, quercetin, and protocatechuic acid were isolated from the MeOH extract of the bark of Abies sachalinensis. The structures of these phenolic compounds were characterized by spectroscopic methods including NMR and MS. The absolute configurations of the abiesinols were determined by Mosher's method, CD, and NOESY data.

We examined the effects of surfactant protein A (SP-A), a collectin, on the interaction of Pneumocystis murina with its host at the beginning, early to middle, and late stages of infection. Pneumocystis murina from SP-A wild-type (WT) mice inoculated intractracheally into WT mice (WT(S)-WT(R)) adhered well to alveolar macrophages, whereas organisms from SP-A knockout (KO) mice inoculated into KO mice (KO(S)-KO(R)) did not. Substitution of WT mice as the source of organisms (WT(S)-KO(R)) or recipient host macrophages (KO(S)-WT(R)) restored adherence to that found with WT(S)-WT(R) mice. In contrast, when immunosuppressed KO and WT mice were inoculated with P. murina from a homologous source (KO(S)-KO(R), WT(S)-WT(R)) or heterologous source (WT(S)-KO(R), KO(S)-WT(R)) and followed sequentially, WT(S)-KO(R) mice had the highest levels of infection at weeks 3 and 4; these mice also had the highest levels of the chemokine macrophage inflammatory protein-2 and neutrophils in lavage fluid at week 3. Surfactant protein-A administered to immunosuppressed KO(S)-KO(R) mice with Pneumocystis pneumonia for 8 wk as a therapeutic agent failed to lower the organism burden. We conclude that SP-A can correct the host immune defect in the beginning of P. murina infection, but not in the middle or late stages of the infection.

A series of new spiro[cyclopropane-1,4′-pyrazol-3-one] derivatives 3a-h were synthesized by the reaction of 4-arylidene-3H-pyrazol-3-one 1 with secondary and tertiary carbanions derived from a methylene and methine group bearing both a leaving group and electron-withdrawing group, e.g. methyl chloroacetate, ethyl chloroacetate, isopropyl chloroacetate, tert-butyl chloroacetate, chloroacetonitrile, 2-chloro-N,N-diethylacetamide, methyl 2-chloropropionate and 2-chloropropionitrile, in the presence of sodium hydride. All the synthesized compounds 3a-h were active against Candida albicans with MIC ≤ 25 μg/mL in vitro.

Three new lanostane-type triterpenoids, inonotsutriols A (1), B (2), and C (3) were isolated from the sclerotia of Inonotus obliquus (Pers.: Fr.) (Japanese name: kabanoanatake; Russian name: chaga). Their structures were determined to be (3β,21R,24S)-21,24-cyclolanost-8-ene-3,21,25-triol (1), (3β,21R,24R)-21,24-cyclolanost-8-ene-3,21,25-triol (2), and (3β,21R,24S)-21,24-cyclolanosta-7,9(11)-diene-3,21,25-triol (3) on the basis of NMR spectroscopy including 1D and 2D experiments (1H,1H-COSY, NOESY, HMQC, and HMBC) and EI-MS.

Three new lanostane-type triterpenoids, inonotsulides A, B, and C (1–3, resp.) were isolated from the sclerotia of Inonotus obliquus (Pers.: Fr.) (Japanese name: Kabanoanatake; Russian name: Chaga). Their structures were determined to be (20R,24S)-3β,25-dihydroxylanost-8-en-20,24-olide (1), (20R,24R)-3β,25-dihydroxylanost-8-en-20,24-olide (2), and (20R,24S)-3β,25-dihydroxylanosta-7,9(11)-dien-20,24-olide (3) on the basis of chemical transformation, NMR spectroscopy including 1D and 2D (1H,1H-COSY, NOESY, HMQC, HMBC), EI-MS, and single-crystal X-ray analysis.

Based on the membrane-modifying peptaibol trichocellin-A-I (1) from Trichoderma viride, we designed a vehicle for the cellular delivery of antisense oligodeoxynucleotides by attaching a (Lys)10 stretch to the C-terminus of 1. The resulting transporter peptide 2, prepared by solid-phase synthesis using Fmoc protocol in combination with amino acid fluorides, was found to be mainly alpha-helical in solution, in contrast to its precursors 1 and 3. The uptake of the complex formed between carrier 2 and a fluorescence-tagged oligonucleotide, i.e., 4, was studied at different charge ratios by confocal laser-scanning microscopy, using two different eukaryotic cell lines: mouse embryonal fibroblast (NIH3T3) and human lung carcinoma (A549) cells. Peptide 2 readily translocated 4 into the cytoplasms of NIH3T3 cells. However, the peptide/oligonucleotide complex was accumulated around the plasma membrane of the A549 cells.

A new rearranged ergostane-type steroid, named eringiacetal A (1), together with known compound 2, were isolated from the fruiting bodies of Pleurotus eryngii (Pleurotaceae). Its structure was fully elucidated by NMR spectroscopy and X-ray crystallography. Eringiacetal A (1) features an unprecedented 5,6-seco-(5S,6R,7R,9S)-5,6:5,7:6,9-triepoxyergosta-8(14),22-diene-3β,7β-diol. This is the first report of a 5,6-seco-ergostane-type steroid. A plausible biogenetic pathway of 1 from 2 is also described. Furthermore, isolated compounds were evaluated for inhibitory effects on nitric oxide (NO) production induced by lipopolysaccharide in macrophages. Compound 1 exhibited inhibitory activity on NO production (IC50 = 19.9 μM) accompanied by modest cytotoxicity (IC50 = 25.6 μM). Compound 2 did not have inhibitory effects on NO production or cytotoxicity (IC50 > 100 μM each).

Seven novel limonoids, e.g. mexicanolide-type carapanolides R (Ia) and S (Ib) are isolated from the oil of Carapa guianensis.

This compound shows moderate cytotoxic activity against human HL-60 and taurine L1210 leukemia cell lines.

Ultraviolet light is the major cause of skin cancers in human, and several effects of ultraviolet light B (UVB) are thought to contribute to skin photocarcinogenesis. 3Beta-methoxy-13alpha,14alpha-epoxyserratan-21beta-ol (PJJ-34; 1) isolated from Picea jezoensis Carr. var. jezoensis showed the strongest antitumor-promoting activity among naturally occurring triterpenoids in the in vivo two-stage mouse skin-carcinogenesis test. To investigate the anti-initiating activity, we further studied mouse models initiated with ultraviolet-B (UVB) and promoted with 12-O-tetradecanoylphorbol-13-acetate (TPA). Oral administration of the PJJ-34 (1) during a period before and after the three times of UVB irradiation led to a remarkable effect: oral administration of a 0.0025% solution of 1 only to the test group, which started one week before and ended one week after the irradiation, showed less than half papillomas, and inhibition of tumor incidence and tumor multiplicity in comparison to the control group. Therefore, it was recognized that PJJ-34 (1) showed strong anti-initiating activity as well as anti-promoting activity. After all, 1 seems to be useful as cancer-chemopreventive agent.

DNA Topoisomerases (Topos) II are target enzymes for anticancer chemotherapeutic drug development. Bioassay-guided fractionation of the CHCl3 extract of the bark of Bischofia javanica led to the isolation of betulinic acid (1) and its derivatives, betulonic acid (2), 3beta-O-(Z)-coumaroylbetulinic acid (3), and 3beta-O-(E)-coumaroylbetulinic acid (4). These compounds were found to be catalytic inhibitors of Topo II activities with IC50 values ranging from 0.38 to 58 microM. The acylation of the OH group at C(3) of betulinic acid exhibited stronger Topo II inhibitory activity.

In a search for cancer chemopreventive agents from natural sources, four lupane-type and seven oleanane-type triterpenoids, and ten synthetic analogs were screened as potential anti-tumor promoters by using the in vitro short-term 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced Epstein-Barr virus early antigen (EBV-EA) activation assay. Among them, 25-acetoxy-3alpha-hydroxyolean-12-en-28-oic acid (1) and 3beta,25-epoxy-3alpha-hydroxylup-20(29)-en-28-oic acid (2) were examined for anti-tumor promoting activity in a two-stage carcinogenesis assay on mouse skin with 7,12-dimethylbenz[a]anthracene (DMBA) and TPA as promoter. 25-Acetoxy-3alpha-hydroxyolean-12-en-28-oic acid (1) and 3beta,25-epoxy-3alpha-hydroxylup-20(29)-en-28-oic acid (2) showed moderate inhibitory activities.

Birt–Hogg–Dube syndrome is a familial genodermatosis, of which patients frequently develop renal neoplasms, fibrofolliculomas and pneumatocele. Here, we report a mother and daughter with renal neoplasms surgically resected (69 and 46 years-of-age at surgery, respectively). The mother's tumor was diagnosed as an unclassified type renal cell carcinoma associated with microscopic tumorous nodules, whereas the daughter's tumor was a hybrid oncocytic/chromophobe tumor. The germline mutation analysis of the responsible gene, FCLN (the folliculin gene), showed a deletion of 18 bp in exon 5 (c.332_349del/p.H111_Q116del), predicting an alteration of the amino acid sequence of “HPSHPQ” replaced by a single amino acid, “L”. This is a novel germline mutation of the FCLN gene that has not been previously reported.

Tandyukisin (1), a novel decalin derivative with an enolic β-ketoaldehyde, has been isolated from a strain of Trichoderma harzianum OUPS-111D-4 originally derived from the marine sponge Halichondria okadai, and its structure has been elucidated on the basis of spectroscopic analyses using 1D and 2D NMR techniques. In addition, the absolute configuration for 1 was established by the application of CD spectrum to the tribenzoate derivative. This compounds exhibited moderate cytotoxicity against human cancer cell lines.

BACKGROUND Adenocarcinomas and carcinoid tumors are the most common malignant tumors of the small intestine. K-ras oncogene mutations at codon 12 are common in gastric, pancreatic, and colon carcinomas, with an incidence of 35-88%. K-ras mutations have not been extensively studied in either adenocarcinomas or carcinoid tumors of the small bowel. The purpose of this study was to determine whether ras mutations play an important role in the formation of these tumors. METHODS Archival tissues from 28 adenocarcinomas and 22 carcinoid tumors of the small bowel were studied, along with archival tissues from 32 adenocarcinomas of the large bowel, which were used as controls. DNA from the small intestine tumors was analyzed for K-ras, H-ras, and N-ras oncogene mutations at codons 12, 13, and 61, using polymerase chain reaction and sequence specific oligonucleotide hybridization techniques. Large bowel adenocarcinomas were analyzed for K-ras mutations at codons 12 and 13. RESULTS A point mutation of K-ras at codon 12 was detected in 4 of 28 (14.3%) of the small bowel adenocarcinomas, in 12 of 32 (37.5%) of the large bowel adenocarcinomas, and in 0 of 22 small intestine carcinoid tumors. No other K-ras, H-ras, or N-ras mutations were detected in any of the small bowel tumors. Each small intestine K-ras mutation was found in a duodenal adenocarcinoma (4 of 12 cases, 33%), whereas none occurred in 16 other jejunal or ileal adenocarcinomas. CONCLUSIONS K-ras mutations appear to play a significant role in the pathogenesis of duodenal adenocarcinomas, but they do not appear to be important in the development of jejunal or ileal adenocarcinomas or of carcinoid tumors of the small intestine. Cancer 1997; 79:1804-8. © 1997 American Cancer Society.

Scedosporium apiospermum, a ubiquitously distributed saprophyte, is emerging as an important pathogen in immunocompromised patients. We describe a 72-year-old patient with chronic S. apiospermum infection of the lung simulating aspergilloma. His medical history was unremarkable except that he had undergone partial lung resection as a treatment for pulmonary tuberculosis several decades previously. He had no underlying immunosuppressive conditions. This patient illustrates that pulmonary scedosporiosis is not confined to immunocompromised patients and that the clinical presentation may be indistinguishable from that of aspergilloma.

Novel 5 lupane-type of triterpenois, i.e., 3β-acetoxy-18α,19α-epoxylupan-21β-ol (1), 18α,19α-epoxy-21β-hydroxylupan-3-one (2), lup-18-ene-3,21-dione (3), lupa-18,21-dien-3β-yl acetate (4), and (17S)-17,18-seco-lup-19(21)-ene-3,18,22-trione (5), named officinatrione, as well as 16 known compounds from the roots of Taraxacum officinale collected in Takatsuki city, Osaka, Japan. Of the above compounds, 5 was the first lupane-type triterpene, of which the D-ring was open to form a nine-membered ring. Compounds 2 and 5 exhibited moderate cytotoxic activities against L1210 cell line (IC50 10.5 and 10.1 μM).

Having observed that multiple neutralization epitopes of human T-cell-leukemia-virus-type-I (HTLV-I) envelope gp46 clustered in a region between amino acids 187 and 199, we speculated that a region of HTLV-II gp46 corresponding to the HTLV-I-neutralization region may contain HTLV-II-specific neutralization epitopes. To test this, we immunized a NZW rabbit and BALB/c mice with a synthetic peptide containing the HTLV-II gp46 amino acids 182 to 199 (pep182-199) conjugated to OVA. The serum from the rabbit reacted to the HTLV-II gp46 and neutralized HTLV-II-mediated syncytium formation. One monoclonal antibody (MAb), M2E186N1, generated from the BALB/c mice, stained specifically the surface of HTLV-II-positive cells and reacted with HTLV-II gp46 by Western blot. This MAb was of the IgA isotype and inhibited HTLV-II- but not HTLV-I-mediated syncytium formation at a final antibody concentration of 200 micrograms/ml; it also neutralized an HTLV-II-VSV pseudotype virus specifically. Epitope mapping by ELISA using overlapping synthetic peptides indicated that the neutralization epitope recognized by the M2E186N1 MAb was located between HTLV-II gp46 amino acids 186 and 192, corresponding to the sequence Leu-Gln-His-Val-Ile-Leu-Gln-Pro. These new observations will be helpful in developing vaccines against HTLV-II infection.

Several kinds of naturally occurring fernane-type triterpenoids isolated from a Euphorbia genus were tested on the inhibitory effects of DNA Topoisomerases I (Topo I) and II (Topo II) activities. A-ring cleaved 3,4-seco-8 beta H-ferna-4(23),9(11)-dien-3-oic acid and its 3-hydroxyl derivative were found to be selective inhibitors of Topo II activity without the stabilization of a DNA/Topo II cleavable complex.

During the course of a search for biologically active constituents from unexamined plant sources, several biogenetically interesting new di- and tri-terpenes and steroids were isolated from several weeds and shrubs of Euphorbiaceae and the bark, leaves and cones of several Pinaceae trees which had been treated as wastes in the forestry industry. Euphorbia supina contained 3,4-seco-5 alpha- and 5 beta-adian-4(23)-ene-3,5-diols and related oxides, oxygenated fern-8-en-3 beta-ols named supinenolones A-E and unusually migrated oxyfernanes having (9S)- and (9R)-7(8-->9)abeo-9-D:C-friedo-B':A'-neogammacerane skeletons named spirosupinane and neospirosupinane, while E. chamaesyce contained 3,4-seco-oleana-4(23), 18-dien-3-oic acid, 3,4-seco-8 beta H-ferna-4(23),9(11)-dien-3-oic acid and two oxygenated obtusifoliols. The bark of Phyllanthus flexuosus (Euphorbiaceae) contained 11 beta-hydroxy-D:A-friedo-olean-1-en-3-one, lup-20(29)-ene-3 beta, 15 alpha-diol, olean-12-ene-3 beta,15 alpha-diol and olean-12-ene-3 beta,15 alpha,24-triol together with trichadenic acid B for which we revised the structure to 3 beta-hydroxy-D:A-friedo-oleanan-27-oic acid. Two 26-nor-D:A-friedo-olean-14-enes were isolated from P. watsonii. Regarding Pinaceae trees, an unusually migrated abieslactone [(3R, 7S, 9R, 23R)-7-hydroxy-3-methoxy-8-oxo-7(8-->9)abeo-lanost-24-eno-26,23-lactone], named spiroveitchionolide, was isolated from the bark of Abies species, besides nine abieslactone analogues. Two pairs of unusually migrated serratanes, piceanonols A and B and jezananals A and B having novel skeletal systems of 14(13-->12) abeo- and 16(15-->14) abeo-serratanes named piceanane and jezanane, respectively, were also isolated from the stem bark of Picea species, besides three 14 beta,15 beta-epoxyserratanes and two 13 alpha,14 alpha-epoxyserratanes. The leaves of Larix kaempferi contained two deformed abietanes named karamatsuic acid (9,10-seco-9,10 alpha-epoxyabieta-8,11,13-trien-18-oic acid) and larikaempferic acid [9 alpha,13 alpha-epoxy-8-oxo-9(8-->7)abeo-7 beta-abietan-18-oic acid], as well as the cones to contain 8 alpha,12 alpha-epidioxy-15-hydroxyabiet-13-en-18-oic acid, three diepoxy-abietan-18-oic acids and two new dehydroabietic acid analogues. Several of the above compounds exhibited inhibitory effects against tumor-promoting and DNA topoisomerase II activities.

A CHCl 3 extract of the stem bark of Picea jezoensis var. hondoensis (Pinaceae) afforded two triterpenoids named piceanonols A and B with a novel 14(13 → 12) abeo -12α H -serratane skeleton. Extensive NMR studies, MS spectral analyses and X-ray crystallographics established their structures as 3β-methoxy-14β,21β-dihydroxy-14(13 → 12) abeo -12α H -serratan-13-one and 21α-methoxy-14β-hydroxy-14(13 → 12) abeo -12α H -serratane-3,13-dione.

Standishinal (1), a new irregular abietane-type diterpenoid, was isolated from the bark of Thuja standishii and the absolute stereostructure was established by 2D NMR and X-ray crystallographic analyses. It was found that treatment of 12-hydroxy-6,7-seco-abieta-8,11,13-triene-6,7-dial (2) with BF3·OEt2 at 0°C in CH2Cl2 furnished compound 1.

Two novel skeletal triterpene aldehydes, jezananals A ( 1 ) and B ( 2 ) were isolated from the stem bark of Picea jezoensis var. jezoensis (Pinaceae). Their absolute stereo structures were determined to be 21β-hydroxy-3β-methoxy-16(15→14)abeo-13R,14S-serratan-15-al and the 3α-epimer, on the basis of spectral, single crystal X-ray analysis and chemical conversion. Compounds 1 and 2 are based on the unique 16(15→14)abeo-serratane skeleton. 3β-Methoxyserrat-14-en-21β-ol ( 3 ), 3α-methoxyserrat-14-en-21β-ol ( 4 ), and 14β,15β-epoxy-3β-methoxyserratan-21β-ol ( 5 ), which is considered to be intermediates of compounds 1 and 2 , and showed strong inhibitory effects on Epstein-Barr virus early antigen (EBV-EA) induction, while compounds 1 and 2 were inactive.

Chaetomugilins G and H were isolated from a strain of Chaetomium globosum that was originally isolated from the marine fish, Mugil cephalus, and their absolute stereostructures were elucidated on the basis of spectroscopic analyses, including 1D and 2D NMR techniques, and chemical transformation. In addition, the absolute configuration of chaetoviridin C was established by derivatization from chaetomugilin A. These compounds exhibited a growth inhibitory activity against cultured P388, HL-60, L1210 and KB cells.

Eight spiro-biflavonoids named abiesinols A–H, along with three neolignans, quercetin, and protocatechuic acid were isolated from the MeOH extract of the bark of Abies sachalinensis. The structures of these phenolic compounds were characterized by spectroscopic methods including NMR and MS. The absolute configurations of the abiesinols were determined by Mosher's method, CD, and NOESY data.

Chaetomugilins A∼F have been isolated from a strain of Chaetomium globosum originally isolated from the marine fish Mugil cephalus, and their absolute stereostructures have been elucidated on the basis of spectroscopic analyses, including 1D and 2D NMR techniques, some chemical transformations and an X-ray analysis. These compounds exhibited significant growth inhibition against cultured P388 cells and HL-60 cells. In addition, chaetomugilins A, C and F showed selective cytotoxic activities against 39 human cancer cell lines.

Chaetomugilins A–C were isolated from a strain of Chaetomium globosum originally isolated from the marine fish Mugil cephalus, and their absolute stereostructures have been elucidated on the basis of spectroscopic analyses using 1D and 2D NMR techniques, some chemical transformations, and an X-ray analysis. This compound exhibited significant cytotoxicity against cultured P388 cells and HL-60 cells.

Three new lanostane-type triterpenoids, inonotsulides A, B, and C (1–3, resp.) were isolated from the sclerotia of Inonotus obliquus (Pers.: Fr.) (Japanese name: Kabanoanatake; Russian name: Chaga). Their structures were determined to be (20R,24S)-3β,25-dihydroxylanost-8-en-20,24-olide (1), (20R,24R)-3β,25-dihydroxylanost-8-en-20,24-olide (2), and (20R,24S)-3β,25-dihydroxylanosta-7,9(11)-dien-20,24-olide (3) on the basis of chemical transformation, NMR spectroscopy including 1D and 2D (1H,1H-COSY, NOESY, HMQC, HMBC), EI-MS, and single-crystal X-ray analysis.

Cephalimysin A (1) was isolated from a strain of Aspergillus fumigatus originally separated from the marine fish Mugil cephalus, and its absolute stereostructure was elucidated on the basis of spectroscopic analyses using 1D and 2D NMR techniques and some chemical transformations including the modified Mosher’s method. This compound exhibited significant cytotoxicity against cultured P388 cells and HL-60 cells.

Two new skeletal triterpene lactones, spiromarienonols A (1a) and B (2a), were isolated from the stem bark of Abies mariesii Masters (Pinaceae). Based on spectral data and biogenetic considerations, their unique three-dimensional structures were determined to be (3R,7S,9R,23R)- (1a) and (3R,7S,9S,23R)-3,7-dihydroxy-8-oxo-7(8→9)abeo-lanost-24-eno-26,23-lactone (2a). Moreover, the potent activity of abiesenonic acid methyl ester (3) and abieslactone (4) against a disease-oriented panel of 39 human cancer cell lines were investigated.