Search

UV (275 nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn2+ and Ca2+ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn2+ and Ca2+) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm−1. Copyright © 2013 John Wiley & Sons, Ltd.

In this work, the surface-enhanced Raman scattering (SERS) spectra of seven genomic DNAs from leaves of chrysanthemum (Dendranthema grandiflora Ramat.), common sundew (Drosera rotundifolia L.), edelweiss (Leontopodium alpinum Cass), Epilobium hirsutum L., Hypericum richeri ssp. transsilvanicum (Celak) Ciocârlan, rose (Rosa x hybrida L.) and redwood (Sequoia sempervirens D. Don. Endl.), respectively, have been analyzed in the wavenumber range 200–1800 cm−1. The surface-enhanced Raman vibrational modes for each of these cases, spectroscopic band assignments and structural interpretations of genomic DNAs are reported. A high molecular structural information content can be found in the SERS spectra of these DNAs from leaf tissues. Based on this work, specific plant DNA–ligand interactions or accurate local structure of DNA might be further investigated using surface-enhanced Raman spectroscopy. Besides, this study will generate information which is valuable in the development of label-free DNA detection for chemical probing in living cell. Copyright © 2013 John Wiley & Sons, Ltd.

Surface-enhanced Raman scattering (SERS) effect was used to demonstrate ultrasensitive optical detection of nucleic acids. In this work, the SERS spectra of seven genomic DNAs from leaves of Arnica montana (L.), Fam. Compositae, Astragalus peterfii (Jav.), Fam. Fabaceae, Kalanchoe x hybrida, Fam. Crassulaceae, strawberry (Fragaria x ananassa Duch.), Fam. Rosaceae, carnation (Dianthus caryophyllus L.), Fam. Caryophyllaceae, apple (Malus domestica Borkh.), Fam. Rosaceae and Persian violet (Exacum affine Balf.), Fam. Gentianaceae were analyzed in the wavenumber range 200–1800 cm−1. SERS signatures, spectroscopic band assignments and structural interpretations of these plant genomic DNAs are reported. SERS spectra of nucleic acids are compared here with caution, because these signals are time-dependent. The SERS spectra corresponding to DNA from Arnica, Dianthus, Fragaria and Kalanchoe leaves show well-resolved, accurate bands, providing thus a high molecular structural information content. Based on this work, specific plant DNA–ligand interactions or DNA structural changes induced by plant stress conditions associated with their natural environment might be further investigated using SERS spectroscopy. Besides, this study will generate information that is valuable in the development of label-free DNA-based nanosensors for chemical probing in the living cell. Copyright © 2011 John Wiley & Sons, Ltd.

Ultrasensitive Raman measurements of nucleic acids are possible by exploiting the effect of surface-enhanced Raman scattering (SERS). In this work, the vibrational spectra of eight genomic DNAs from in vitro grown apple leaf tissues (Malus domestica Borkh., Fam Rosaceae, cvs. Florina, Idared, Rebra, Goldrush, Romus 3, Romus 4 and the rootstocks M9 and M26) were analyzed using surface-enhanced Raman spectroscopy, in the wavenumber range 200–1800 cm−1. SERS signatures, spectroscopic band assignments and structural interpretations of these plant genomic DNAs are reported. Strong dependences of the SERS spectra on genomic DNA amount in the measured sample volume and on time were observed. Similarities of the SERS signals of DNAs from Rebra and Romus 3 leaves were detected. To our knowledge, this is the first SERS study on genomic DNA from leaf tissues. The present work provides a basis for future use of surface-enhanced Raman spectroscopy to analyze specific plant DNA–ligand interactions or DNA structural changes induced by plants' stress conditions associated with their natural environment. Besides, this study will generate information that is valuable in the development of low-level plant DNA-based analytical sensors. Copyright © 2010 John Wiley & Sons, Ltd.

Raman spectra of calf thymus DNA were measured in the pH interval 6.4 to 3.45 in the presence of divalent manganese ions. pH-dependent protonation of AT and GC base pairs and conformational changes were indicated in the spectra. Protonation of adenine residues becomes obvious at pH 4.4 and continues upon lowering the pH to 3.45. Adenine protonation is connected with the disruption of AT base pairs. Protonation of GC base pairs is indicated at somewhat lower pH than that of AT base pairs, namely at pH 3.8, and continues upon lowering the pH to 3.45. At pH 3.8 unstacking of thymine residues is indicated, and spectral markers for the unstacking of adenine and cytosine were found at pH 3.45. Changes of the DNA backbone are indicated by spectral changes of conformational marker bands at 898 and 1423 cm−1. Copyright © 2005 John Wiley & Sons, Ltd.

Low-pH-induced DNA structural changes were investigated in the pH range 6.8-2.10 by Raman microspectroscopy. Measurements were carried out on calf thymus DNA in the presence of low concentrations of Mg2+ ions. Vibrational spectra are presented in the wavenumber region 500-1650 cm-1. Large changes in the Raman spectra of calf-thymus DNA were observed on lowering the pH value. These are due to protonation and unstacking of the DNA bases during DNA melting and also to changes in the DNA backbone conformation. The intensities of the Raman bands of guanine (681 cm-1), adenine (728 cm-1), thymine (752 cm-1) and cytosine (785 cm-1), typical of the C2-endo-anti conformation of B-DNA, are discussed. The B-form marker near 835 cm-1 and the base vibrations in the higher wavenumber region (1200-1680 cm-1) are analysed. Effects of low pH value upon the protonation mechanism of opening AT and changing the protonation of GC base pairs in DNA are discussed.