Search

Clinical use of genome-wide sequencing (GWS) requires pre-test genetic counseling, but the availability of genetic counseling is limited. We developed an interactive online decision-support tool, DECIDE, to make genetic counseling, patient education, and decision support more readily available. We performed a non-inferiority trial comparing DECIDE to standard genetic counseling to assess the clinical value of DECIDE for pre-GWS counseling. One hundred and six parents considering GWS for their children with epilepsy were randomized to conventional genetic counseling or DECIDE. Following the intervention, we measured parents' knowledge and empowerment and asked their opinions about using DECIDE. Both DECIDE and conventional genetic counseling significantly increased parents' knowledge, with no difference between groups. Empowerment also increased but by less than 2% in each group. Parents liked using DECIDE and found it useful; 81% would recommend it to others; 49% wished to use it along with a genetic counselor; 26% of parents preferred to see a genetic counselor; 7% preferred DECIDE alone; and 18% had no preference. DECIDE appears equivalent to genetic counseling at conveying information. In addition, it was highly acceptable to the majority of study participants, many of whom indicated that it was useful to their decision-making. Use of DECIDE as a pre-test tool may extend genetic counseling resources.

Background Profiling the entire genome at base pair resolution in a single test offers novel insights into disease by means of dissection of genetic contributors to phenotypic features. Methods We performed genome sequencing for a patient who presented with atypical hereditary sensory and autonomic neuropathy, severe epileptic encephalopathy, global developmental delay, and growth hormone deficiency. Results Assessment of the variants detected by mapped sequencing reads followed by Sanger confirmation revealed that the proband is a compound heterozygote for rare variants within RETREG1 (FAM134B), a gene associated with a recessive form of hereditary sensory and autonomic neuropathy, but not with epileptic encephalopathy or global developmental delay. Further analysis of the data also revealed a heterozygous missense variant in DNM1L, a gene previously implicated in an autosomal dominant encephalopathy, epilepsy, and global developmental delay and confirmed by Sanger sequencing to be a de novo variant not present in parental genomes. Conclusions Our findings emphasize the importance of genome‐wide sequencing in patients with a well‐characterized genetic disease with atypical presentation. This approach reduces the potential for misdiagnoses.

The disruption of genes involved in epigenetic regulation is well known to cause Intellectual Disability (ID). We reported a custom microarray study that interrogated among others, the epigenetic regulatory gene-class, at single exon resolution. Here we elaborate on identified intragenic CNVs involving epigenetic regulatory genes; specifically discussing those in three genes previously unreported in ID etiology-ARID2, KDM3A, and ARID4B. The changes in ARID2 and KDM3A are likely pathogenic while the ARID4B variant is uncertain. Previously, we found a CNV involving only exon 6 of the JARID2 gene occurred apparently de novo in seven patients. JARID2 is known to cause ID and other neurodevelopmental conditions. However, exon 6 of this gene encodes one of a series of repeated motifs. We therefore, investigated the impact of this variant in two cohorts and present a genotype-phenotype assessment. We find the JARID2 exon 6 CNV is benign, with a high population frequency (>14%), but nevertheless could have a contributory effect. We also present results from an interrogation of the exomes of 2,044 patients with neurocognitive phenotypes for the incidence of potentially damaging mutation in the epigenetic regulatory gene-class. This paper provides a survey of the fine-scale CNV landscape for epigenetic regulatory genes in the context of ID, describing likely pathogenic as well as benign single exon imbalances. (C) 2016 Wiley Periodicals, Inc.

Many genetic conditions present in childhood (Biesecker & Green, 2014) as undiagnosed conditions that require a "diagnostic odyssey" to define the cause (Friedman et al., 2006). However, the technological advances of genome-wide (whole genome or exome) sequencing (GWS) enable geneticists to test the entire genome at once. This may greatly reduce both time and expense (Ayuso, Millan, Mancheno, & Dal-Re, 2013), and provide a specific genetic diagnosis in at least 25% of cases (Yang et al., 2013), resulting in immediate benefits, such as more accurate genetic counseling, access to resources, and possible treatment.BackgroundWhile GWS can provide diagnoses, this testing often reveals incidental findings (IFs): unanticipated results unrelated to the primary concern (Ormond et al., 2010). IFs may predispose a patient to conditions ranging from trivial to potentially severe in the present or sometime in the future. Healthcare professionals (HCPs) therefore have the challenging task of communicating accurate and sufficient information about the benefits and potential adverse implications of GWS to facilitate families' testing decisions. Genetic counselors (GCs) have expressed challenges with the length, complexity, and content of the GWS consent process (Machini, Douglas, Braxton, Tsipis, & Kramer, 2014). Specifically, GCs had difficulty ensuring their patients accurately understood the benefits, limitations, potential results, and implications of GWS for themselves and their family members (Machini et al., 2014). GCs expressed interest in having access to resources related to guidelines on consent, result communication, ethical, and counseling issues (Machini et al., 2014). These challenges align with the recommendation of the American Society of Human Genetics (ASHG), which states that HCPs who provide pediatric genetic testing need to have appropriate expertise and training in interpreting and communicating genetic information (Botkin et al., 2015). Furthermore, genetic HCPs should establish a long-term communication plan for all results, including, which individuals are involved in the communication and the staging of information (Botkin et al., 2015). HCPS should provide basic genetic counseling and must have appropriate knowledge and skills related to testing, interpreting and communicating GWS and its' results to patients and families (Botkin et al., 2015).In Canada, GWS has been carried out in the research setting for several years, and clinical GWS is becoming available. There are Canadian (Boycott et al., 2015), American (Green et al., 2013) and European (van El et al., 2013) professional recommendations for the use of clinical GWS. Canadian recommendations state that prior to testing, patients and families should undergo genetic counseling with a qualified person with a comprehensive understanding of clinical GWS (Boycott et al., 2015). The recommendations also state the inclusion of specific content to discuss during consent (Boycott et al., 2015). Given that GWS will ultimately impact patients, parents, and individuals, input is needed from them. In Europe and North America, parents have voiced concerns about GWS decision making, including the lengthy and often elaborate consent process (Rigter et al., 2013; Tabor et al., 2012), and the challenges of discussing complex concepts such as IFs (Levenseller et al., 2013). Research on parental perspectives has focused mainly on return of IFs or results (Daack-Hirsch et al., 2013; Kleiderman et al., 2013; Sapp et al., 2013; Townsend et al., 2012); however, exploration of what elements and supports parents perceive as important to their educational preparation, pretest discussion, counseling, and informed consent is sparse: we have little understanding of parents' perceptions of their decisional needs when making a choice about GWS for their child. Decisional needs are factors influencing decision making, including knowledge, expectations, values, support, resources, and individual characteristics (O'Connor, 2006). …

Microdeletions of the entire NF1 gene and surrounding genomic region occur in about 5% of patients with neurofibromatosis 1 (NF1). NF1 microdeletion patients usually have more cutaneous and plexiform neurofibromas and a higher risk of developing malignant peripheral nerve sheath tumors than other people with NF1. Somatic overgrowth has also been observed in NF1 microdeletion patients, an observation that is remarkable because most NF1 patients are smaller than average for age and sex. We studied longitudinal measurements of height, weight, and head circumference in 56 patients with NF1 microdeletions and 226 NF1 patients with other kinds of mutations. Although children with NF1 microdeletions were much taller than non-deletion NF1 patients at all ages after 2 years, the lengths of deletion and nondeletion NF1 patients were similar in early infancy. NF1 microdeletion patients tended to be heavier than other NF1 patients, but height or weight more than 3 standard deviations above the mean for age and sex was infrequent in children with NF1 microdeletions. Head circumference and age of puberty were similar in deletion and non-deletion NF1 patients. The pattern of growth differs substantially in deletion and non-deletion NF1 patients, but the pathogenic basis for this difference is unknown.

The 2013 Neurofibromatosis (NF) Conference took place at the Portola Hotel and Spa, Monterey, CA, from June 8-11, 2013. This international meeting is sponsored annually by the Children's Tumor Foundation (CTF), with the goal of bringing together NF researchers and clinicians from disparate fields of expertise. The conference agenda included a range of preclinical topics with a focus on signaling pathways and mouse models and a number of clinical topics, including a symposium on the interaction of academics, government, and industry in NF clinical trials. Neurofibromatosis is a group of inherited genetic disorders – NF1, NF2, and schwannomatosis – that together affect about 100,000 persons in the US. NF1 is the most common, with an estimated birth prevalence of 1:3,000 [Friedman., 1999; Lammert et al., 2005]; for NF2 and schwannomatosis, the estimated birth prevalence is 1:25,000 and 1:40,000, respectively [Antinheimo et al., 2000; Evans et al., 2005]. NF1, NF2 and schwannomatosis have in common that they predispose affected individuals to develop Schwann cell tumors such as neurofibromas and schwannomas. At a lower frequency, they also predispose to the development of a number of other benign and malignant tumor types, as well as some developmental abnormalities including learning disabilities (in NF1). The disorders arise from mutations in different genes, each of which plays a key role in regulating cellular function. The NF1 gene on human chromosome 17 encodes an intracellular signaling molecule that functions as a GTPase activating protein for Ras proteins, whereas the NF2 gene on human chromosome 22 encodes a cytoskeletal-membrane linking protein with reported roles in the suppression of several different growth-associated signaling pathways. The biology of schwannomatosis remains understudied despite the identification of germline SMARCB1 mutations in schwannomatosis patients in 2007.

Massively parallel sequencing has revolutionized our understanding of Mendelian disorders, and many novel genes have been discovered to cause disease phenotypes when mutant. At the same time, next-generation sequencing approaches have enabled non-invasive prenatal testing of free fetal DNA in maternal blood. However, little attention has been paid to using whole exome and genome sequencing strategies for gene identification in fetal disorders that are lethal in utero, because they can appear to be sporadic and Mendelian inheritance may be missed. We present challenges and advantages of applying next-generation sequencing approaches to gene discovery in fetal malformation phenotypes and review recent successful discovery approaches. We discuss the implication and significance of recessive inheritance and cross-species phenotyping in fetal lethal conditions. Whole exome sequencing can be used in individual families with undiagnosed lethal congenital anomaly syndromes to discover causal mutations, provided that prior to data analysis, the fetal phenotype can be correlated to a particular developmental pathway in embryogenesis. Cross-species phenotyping allows providing further evidence for causality of discovered variants in genes involved in those extremely rare phenotypes and will increase our knowledge about normal and abnormal human developmental processes. Ultimately, families will benefit from the option of early prenatal diagnosis. © 2014 John Wiley & Sons, Ltd.

Gene discovery using massively parallel sequencing has focused on phenotypes diagnosed postnatally such as well-characterized syndromes or intellectual disability, but is rarely reported for fetal disorders. We used family-based whole-exome sequencing in order to identify causal variants for a recurrent pattern of an undescribed lethal fetal congenital anomaly syndrome. The clinical signs included intrauterine growth restriction (IUGR), severe microcephaly, renal cystic dysplasia/agenesis and complex brain and genitourinary malformations. The phenotype was compatible with a ciliopathy, but not diagnostic of any known condition. We hypothesized biallelic disruption of a gene leading to a defect related to the primary cilium. We identified novel autosomal recessive truncating mutations in KIF14 that segregated with the phenotype. Mice with autosomal recessive mutations in the same gene have recently been shown to have a strikingly similar phenotype. Genotype-phenotype correlations indicate that the function of KIF14 in cell division and cytokinesis can be linked to a role in primary cilia, supported by previous cellular and model organism studies of proteins that interact with KIF14. We describe the first human phenotype, a novel lethal ciliary disorder, associated with biallelic inactivating mutations in KIF14. KIF14 may also be considered a candidate gene for allelic viable ciliary and/or microcephaly phenotypes.

Purpose To determine which medications are most commonly used by women in the first trimester of pregnancy and identify the critical gaps in information about fetal risk for those medications.

Whole exome or whole genome analysis using massively parallel sequencing technologies will undoubtedly solve diagnostic dilemmas; however, incidental findings (IF) that may have medical and social implications will also be discovered. While there is consensus in the literature that analytically valid and medically actionable IF should be returned to patients if requested, there is debate regarding the return of other IF. There are currently no guidelines established for managing IF in the clinical context. We therefore distributed an online questionnaire to 496 geneticists and genetic counselors in Canada to explore this unresolved issue, and 210 professionals participated (response rate = 42%). The proportion of respondents who indicated that they would return IF to patients depended on the nature of the finding, ranging from 95% for information pertaining to a serious and treatable condition to 12% for information with only social implications (e.g., non-paternity). There was a lack of consensus around the disclosure of certain IF such as genetic carrier status, especially for pediatric patients. The most important considerations identified as impacting IF disclosure included condition-specific factors such as treatment availability, test accuracy, and evidence indicating pathogenicity. This is the first study to document the views of geneticists and genetic counselors in Canada towards the disclosure of IF, and represents a step towards evidence-based guidelines for clinical genome-wide sequencing investigations. © 2013 Wiley Periodicals, Inc.

Purpose Medication use during pregnancy is common and increasing. Women are also increasingly getting healthcare information from sources other than their physicians. Methods This report summarizes an environmental scan that identified 25 active Internet sites that list medications reported to be safe for use in pregnancy and highlights the inadequate evidence base and inconsistent guidance provided by these sites. Results These lists included 245 different products, of which 103 unique components had been previously evaluated in terms of fetal risk by the Teratogen Information System (TERIS), a resource that assesses risk of birth defects after exposure under usual conditions by consensus of clinical teratology experts. For 43 (42%) of the 103 components that were listed as ‘safe’ on one or more of the Internet sites surveyed, the TERIS experts were unable to determine the fetal risk based on published scientific literature. For 40 (93%) of these 43, either no data were available to assess human fetal risk or the available data were limited. Conclusions Women who see a medication on one of these ‘safe’ lists would be led to believe that there is no increased risk of birth defects resulting from exposure. Thus, women are being reassured that fetal exposure to these medications is safe even though a sufficient evidence base to determine the relative safety or risk does not exist. Copyright © 2013 John Wiley & Sons, Ltd.

The aim of this study was to characterize cardiac features of patients with neurofibromatosis 1 (NF1) and large deletions of the NF1 gene region. The study participants were 16 patients with large NF1 deletions and 16 age- and sex-matched NF1 patients without such deletions. All the patients were comprehensively characterized clinically and by echocardiography. Six of 16 NF1 deletion patients but none of 16 non-deletion NF1 patients have major cardiac abnormalities (p = 0.041). Congenital heart defects (CHDs) include mitral insufficiency in two patients and ventricular septal defect, aortic stenosis, and aortic insufficiency in one patient each. Three deletion patients have hypertrophic cardiomyopathy. Two patients have intracardiac tumors. NF1 patients without large deletions have increased left ventricular (LV) diastolic posterior wall thickness (p

Most birth defects are etiologically complex disorders caused by combinations of genetic and environmental factors, but most studies of birth defect etiology have examined only genetic factors or only environmental factors and have not considered interactions among them. Genome-wide epigenetic studies, which use the same genomic technologies that have revolutionized our ability to identify genetic causes of disease, provide an attractive way to study gene-environment interactions. However, finding an association between epigenetic variation and an etiologically complex birth defect without knowledge of the genetic variation and environmental exposures affecting the individuals who were studied usually provides little or no information regarding the cause of the disorder. In order for genome-wide studies of epigenetic variation to contribute to our understanding of the causes of birth defects, these studies must be combined with studies of environmental exposures and studies of genetic variation in the same subjects. Under such circumstances, epigenetic studies may help to establish the molecular basis for gene-environment interactions.

A majority of pregnant women take at least one medication during pregnancy, although the safety of such drugs during pregnancy is not always known. We reviewed the safety during pregnancy of 172 drugs approved by the US Food and Drug Administration (FDA) from 2000 to 2010 using the TERIS risk rating system. We also reviewed safety information for 468 drugs approved by the FDA from 1980 to 2000 to determine if revisions in risk categories had been made in the last 10 years. The teratogenic risk in human pregnancy was "undetermined" for 168 (97.7%) of drug treatments approved between 2000 and 2010. Furthermore, the amount of data available regarding safety in pregnancy was rated as "none" for 126 (73.3%) of these drugs. For those drugs approved between 1980 and 2000, only 23 (5%) changed a full risk category or more in the past 10 years. Sources of data that led to a revised risk were derived from exposure cohort studies performed through record linkage studies, teratogen information services, large population-based case-control studies, and pregnancy registries. The mean time for a treatment initially classified as having an "undetermined" risk to be assigned a more precise risk was 27 years (95% confidence interval 26-28 years). The lack of information needed to assess the safety of drug treatments during human pregnancy remains a serious public health problem. A more active approach to post-marketing surveillance for teratogenic effects is necessary.

This article describes the pattern of reported antidepressant use around the time of pregnancy in a population-based sample of women who delivered live-born babies without birth defects. Data were used from the National Birth Defects Prevention Study, an ongoing case-control study of risk factors for birth defects covering 10 US states. Mothers of live-born infants without birth defects (controls) born between 1998 and 2005 were randomly selected from each site. Information on the mother's characteristics and exposure to antidepressants was collected via a standardized telephone interview. Among 6582 mothers included in the study, 298 (4.5%) reported use of an antidepressant in the period of 3 months before through the end of pregnancy. Use of selective serotonin-reuptake inhibitors was reported most often (3.8%), followed by bupropion (0.7%). A statistically significant decline was observed, from 3.1% to 2.3% (P < .001), in reported use of antidepressants between the first and second month after conception. The frequency of reported antidepressant use at any time during pregnancy increased from 2.5% in 1998 to 8.1% in 2005 (P < .001) in 4 states. The findings show an increase in reported antidepressant use over a 9-year period and a substantial decrease in use around the usual time of pregnancy recognition.

BACKGROUND: There continue to be many efforts around the world to develop assays that are shorter than the traditional embryofetal developmental toxicity assay, or use fewer or no mammals, or use less compound, or have all three attributes. Each assay developer needs to test the putative assay against a set of performance standards, which traditionally has involved testing the assays against a list of compounds that are generally recognized as “positive” or “negative” in vivo. However, developmental toxicity is highly conditional, being particularly dependent on magnitude (i.e. dose) and timing of exposure, which makes it difficult to develop lists of compounds neatly assigned as developmental toxicants or not. APPROACH: Here we offer an alternative approach for the evaluation of developmental toxicity assays based on exposures. Exposures are classified as “positive” or “negative” in a system, depending on the compound and the internal concentration. Although this linkage to “internal dose” departs from the recent approaches to validation, it fits well with widely accepted principles of developmental toxicology. CONCLUSIONS: This paper introduces this concept, discusses some of the benefits and drawbacks of such an approach, and lays out the steps we propose to implement it for the evaluation of developmental toxicity assays. Birth Defects Res (Part B) 89:526–530, 2010. © 2010 Wiley-Liss, Inc.

The skeleton is frequently affected in individuals with neurofibromatosis type 1, and some of these bone manifestations can result in significant morbidity. The natural history and pathogenesis of the skeletal abnormalities of this disorder are poorly understood and consequently therapeutic options for these manifestations are currently limited. The Children's Tumor Foundation convened an International Neurofibromatosis Type 1 Bone Abnormalities Consortium to address future directions for clinical trials in skeletal abnormalities associated with this disorder. This report reviews the clinical skeletal manifestations and available preclinical mouse models and summarizes key issues that present barriers to optimal clinical management of skeletal abnormalities in neurofibromatosis type 1. These concepts should help advance optimal clinical management of the skeletal abnormalities in this disease and address major difficulties encountered for the design of clinical trials.

Idiopathic developmental disability (DD) has been found to put significant psychological distress on families of children with DD. The cause of the disability, however, is unknown for up to one-half of the affected children. Chromosomal abnormalities identified by cytogenetic analysis are the most frequently recognized cause of DD, although they account for less than 10% of cases. Array genomic hybridization (AGH) is a new diagnostic tool that provides a much higher detection rate for chromosomal imbalance than conventional cytogenetic analysis. This increase in diagnostic capability comes at greater monetary costs, which provides an impetus for understanding how individuals value genetic testing for DD. This study estimated the willingness to pay (WTP) for diagnostic testing to find a genetic cause of DD from families of children with DD. A discrete choice experiment was used to obtain WTP values. When it was assumed that AGH resulted in twice as many diagnoses and a 1-week reduction in waiting time compared with conventional cytogenetic analysis, this study found that families were willing to pay up to CDN$1118 (95% confidence interval, $498-1788) for the expected benefit. These results support the conclusion that the introduction of AGH into the Canadian health care system may increase the perceived welfare of society, but future studies should examine the cost-benefit of AGH vs cytogenetic testing.

We report on a 14-year-old girl with mild cognitive impairment, deafness, and an unusual pattern of anomalies associated with a previously unreported de novo duplication of chromosome 17q21.33. The 1.1 Mb duplication was detected by Affymetrix 100K GeneChip array genome hybridization and involves the genomic region between 45,093,544 and 46,196,038 base pairs on chromosome 17 (NCBI build 36.1). The patient has microcephaly, unusual cup-shaped ears, scoliosis and other skeletal defects. Two genes involved in the duplicated region, PPP1R9B and COL1A1, are strong candidates for producing her phenotype.

Typing for HLA-A and -B antigens was performed on 87 children with definite juvenile dermatomyositis (JDMS). A significantly increased frequency of HLA-B8 (estimated relative risk = 2.8, Pc less than 0.01) was observed among White patients, but not among Blacks or Latin Americans with JDMS. No abnormality of HLA haplotype segregation was observed among 38 healthy siblings of the JDMS probands.

Array genomic hybridization (AGH) can detect chromosomal gains or losses that are 100 times smaller than those identifiable by conventional cytogenetic methods. Genome-wide AGH can identify genomic imbalance that causes birth defects and mental retardation at least twice as frequently as conventional cytogenetic analysis. Using AGH as a prenatal test for fetal genomic imbalance offers the promise of detecting pathogenic gain or loss of genomic material more quickly and much more frequently than current methods. However, the chance of finding a result of uncertain clinical significance is much greater than with conventional cytogenetic analysis, and the benefit-cost ratio of doing AGH in addition to conventional cytogenetic analysis in pregnancies at high risk for Down syndrome is likely to be poor. Very little is known about the natural history and range of clinical variability associated with most pathogenic submicroscopic copy number variants (CNVs). It seems doubtful that patients can be adequately counseled for prenatal AGH testing in most cases because the risks and benefits are unknown. At present, AGH should be offered for prenatal diagnosis only if the pregnancy is at especially high risk of having a pathogenic CNV or if AGH is being done as part of a clinical trial.

Kallmann syndrome is defined by the association of hypogonadotropic hypogonadism and anosmia. A previously unreported association of Kallmann syndrome and choanal atresia in a family is reported. The mechanism of the embryopathic association of hypogonadotropic hypogonadism, anosmia, and choanal atresia is though to be due to a single developmental field defect in the region of the median forebrain and associated structures. An irregular autosomal dominant mode of inheritance is suspected.

Neurofibromatosis 1 (NF1) is an autosomal dominant disorder presented with multiple cafe-au-lait spots, Lisch nodules,multiple nerve sheath tumors, and cardiovascular complications such as ischemia...

Neurofibromatosis 1 (NF1) is an autosomal dominant disorder, characterized by multiple cafe-au-lait spots, iris harmartomas, multiple nerve sheath tumors. Patients also present with heart and cereb...

Angiotensin II (A-II) is the main effector of the renin-angiotensin system. A-II functions by binding its type 1 (AT1) receptors to cause vasoconstriction and retention of sodium and fluid. Several AT1 receptor antagonists-a group of drugs collectively called "sartans"-have been marketed during the past few years for treatment of hypertension and heart failure. At least 15 case reports describe oligohydramnios, fetal growth retardation, pulmonary hypoplasia, limb contractures, and calvarial hypoplasia in various combinations in association with maternal losartan, candesartan, valsartan, or telmisartan treatment during the second or third trimester of pregnancy. Stillbirth or neonatal death is frequent in these reports, and surviving infants may exhibit renal damage. The fetal abnormalities, which are strikingly similar to those produced by maternal treatment with angiotensin-converting enzyme (ACE) inhibitors during the second and third trimesters of pregnancy, are probably related to extreme sensitivity of the fetus to the hypotensive action of these drugs. Very little information is available regarding the outcome of human pregnancies in which the mother was treated with an AT1 receptor antagonist during the first trimester, but animal studies have not demonstrated teratogenic effects after maternal treatment with large doses of AT1 receptor antagonists during organogenesis. We conclude that pharmacological suppression of the fetal renin-angiotensin system through ACE inhibition or AT1 receptor blockade seems to disrupt fetal vascular perfusion and renal function. We recommend that maternal treatment with AT1 receptor antagonists be avoided during the second and third trimesters of pregnancy and that women who become pregnant while taking one of these medications be changed to an antihypertensive drug of a different class as soon as the pregnancy is recognized.

Intellectual disability (ID) affects about 3% of the population (IQ < 70), and in about 40% of moderate (IQ 35-49) to severe ID (IQ < 34), and 70% of cases of mild ID (IQ 50-70), the etiology of the disease remains unknown. It has long been suspected that chromosomal gains and losses undetectable by routine cytogenetic analysis (i.e., less than 5-10 Mb in size) are implicated in ID of unknown etiology. Array CGH has recently been used to perform a genome-wide screen for submicroscopic gains and losses in individuals with a normal karyotype but with features suggestive of a chromosome abnormality. In two recent studies, the technique has demonstrated a approximately 15% detection rate for de novo copy number changes of individual clones or groups of clones. Here, we describe a study of 22 individuals with mild to moderate ID and nonsyndromic pattern of dysmorphic features suspicious of an underlying chromosome abnormality, using the 3 Mb and 1 Mb commercial arrays (Spectral Genomics). Deletions and duplications of 16 clones, previously described to show copy number variability in normal individuals [Iafrate et al., 2004; Lapierre et al., 2004; Schoumans et al., 2004; Vermeesch et al., 2005] were seen in 21/22 subjects and were considered polymorphisms. In addition, three subjects showed submicroscopic deletions and duplications not previously reported as normal variants. Two of these submicroscopic changes were of de novo origin (microdeletions at 7q36.3 and a microduplication at 11q12.3-13.1) and one was of unknown origin as parental testing of origin could not be performed (microduplication of Xp22.3). The clinical description of the three subjects with submicroscopic chromosomal changes at 7q36.3, 11q12.3-13.1, Xp22.3 is provided.

Mutations of the NF1 locus cause neurofibromatosis 1 (NF1), a clinically variable autosomal dominant disease. Expression of neurofibromin, the protein product of the NF1 gene, is regulated in a tissue- and developmentally-specific fashion, but the basis for this regulation is not understood. We used phylogenetic footprinting and other bioinformatic methods to identify potential transcriptional regulatory regions in the 5' upstream region and intron 1 of the NF1 gene from human, mouse, rat, and pufferfish. Three genomic segments that have equal or higher homology than the coding region were found in the NF1 5' upstream region, and four more very highly homologous regions were found in intron 1. Five of these highly homologous regions are confidently predicted to contain transcription factor binding sites. One highly homologous segment in the 5' upstream region spans the transcription start site and contains several potential transcription factor binding sites. This segment includes a novel 24-bp sequence (acttccggtggggtgtcatggcgg) that lies 310-333 bp upstream of the translation initiation site. This sequence, which is identical in human, mouse, and rat and differs by only 1-bp in Fugu, may contain the core promoter element for NF1 transcription.

Neurofibromatosis 1 (NF1) is a common genetic disorder with an autosomal dominant mode of inheritance, an increased morbidity and mortality, and a shorter lifespan. Although the disease is fully penetrant by the age of 8, the variability in symptoms and complications is high, even among members of the same family. The aim of this study was to identify easily recognizable clinical features that may be associated with mortality in a cohort of patients affected with NF1. We used prospectively collected data from the Neurofibromatosis Institute Database (NFID) and included in our analysis 703 patients who fulfilled the NIH diagnostic criteria for NF1. Clinical, especially dermatological features were tested as potential factors associated with mortality. Among the patients, 405 (57.6%) were children and 298 (42.4%) were adults. The mean follow-up was 2.4 years (median = 0.98, range: 0-15.3 years). Forty patients died during follow-up, mostly due to tumor development such as sarcoma (n = 18). In the adult population, subcutaneous neurofibromas (odds ratio [OR] = 3.6, 95% confidence interval (CI): [1.2-11.3], P = 0.02) and male gender (OR = 5.6, [1.5-20.9], P = 0.004) were independent predictors of mortality after adjustment for age. Among children, the presence of facial plexiform neurofibromas and pruritus were significantly associated with mortality in univariate analysis. Our study describes independent risk factors of mortality in a large cohort of adult and pediatric patients. Close follow-up should be obtained for patients presenting with subcutaneous neurofibromas.

Databases that collect clinical information on patients with particular genetic diseases can be used to investigate the clinical history of a disorder, its genetics, and genotype-phenotype correlations. A database can also serve as a valuable source of patients for studies of disease pathogenesis, variability, or treatment. We review the strengths and limitations of genetic disease databases in the context of our experience with the National Neurofibromatosis Foundation International Database (NNFFID). Genetic disease databases have been developed by individual investigators, scientific consortia, patient support organizations, and commercial enterprises. Databases vary from simple lists of affected individuals to comprehensive collections of detailed clinical and genetic information. Data may be obtained from people who volunteer to be included, systematic assessments of patients seen at participating medical centers, or population-based registries. Access to information may be highly restricted or widely available. These variables all affect the possible uses and usefulness of the data for research. Technical aspects of data entry, organization, storage, and retrieval, as well as issues related to data quality, confidentiality, and security, help determine how well a system actually functions. We discuss examples of research that have been accomplished with genetic disease databases and make recommendations regarding the organization and operation of these resources.

Knudson's 'two-hit' hypothesis has provided extremely important insights into the pathogenesis of tumors in autosomal dominant tumor predisposition syndromes, but recent evidence suggests that some such tumors may occur without a 'second hit' or require more than two mutations. Inactivation of both RB1 alleles appears to be insufficient by itself to cause malignancy in the tumors that develop in patients with hereditary retinoblastoma. On the other hand, certain tumors in patients with tuberous sclerosis complex appear to develop in haploinsufficient tissues that do not have 'second hit' mutations of a tuberous sclerosis gene. The molecular pathogenesis of certain other tumors in patients with tuberous sclerosis complex or neurofibromatosis 1 may not be fully explained by the 'two-hit' hypothesis either. Hereditary tumors, like non-hereditary tumors, may arise by a variety of molecular mechanisms, with loss of both alleles of a particular tumor suppressor gene being a frequent, but not invariably necessary or sufficient, event. Four models are presented to explain how various tumors may arise in patients with inherited tumor predisposition syndromes such as hereditary retinoblastoma, tuberous sclerosis complex or neurofibromatosis 1. Even tumors of one particular type may develop by more than one mechanism.

Measuring correlation in clinical traits among relatives is important to our understanding of the causes of variable expressivity in Mendelian diseases. Random effects models are widely used to estimate intrafamilial correlations, but such models have limitations. We incorporated survival techniques into a random effects model so that it can be used to estimate intrafamilial correlations in continuous variables with right censoring, such as age at onset. We also describe a negative-binomial gamma mixture model to determine intrafamilial correlations of discrete (e.g., count) data. We demonstrate the utility of these methods by analyzing intrafamilial correlations among patients with neurofibromatosis 2 (NF2), an autosomal-dominant disease caused by mutations of the NF2 tumor-suppressor gene. We estimated intrafamilial correlations in age at first symptom of NF2, age at onset of hearing loss, and number of intracranial meningiomas in 390 NF2 nonprobands from 153 unrelated families. A significant intrafamilial correlation was observed for each of the three features: age at onset (0.35; 95% confidence interval (CI) 0.23-0.47), age at onset of hearing loss (0.51; 95% CI, 0.35-0.64), and number of meninginomas (0.29; 95% CI, 0.15-0.43). Significant correlations were also observed for age at first symptom within NF2 families with truncating mutations (0.41; 95% CI, 0.06-0.68) or splice-site mutations (0.29; 95% CI, 0.03-0.51), for age at onset of hearing loss within families with missense mutations (0.67; 95% CI, 0.18-0.89), and for number of meningiomas within families with splice-site mutations (0.39; 95% CI, 0.13-0.66). Our findings are consistent with effects of both allelic and nonallelic familial factors on the clinical variability of NF2.

Azathioprine (AZA) and its active metabolite, 6-mercaptopurine (6-MP), are purine analogues that interfere with the synthesis of adenine and guanine ribonucleosides. These ribonucleosides are important precursors of DNA and RNA. Because AZA and 6-MP act predominantly on rapidly dividing cells such as the T lymphocytes, these drugs are not only cytotoxic but also immunosuppressive and anti-inflammatory. The effects are dose-related, small doses of either drug are anti-inflammatory, but larger doses are immunosuppressive and cytotoxic (Goldstein, ’87). 6-MP has been used in cancer chemotherapy, primarily in childhood and adult leukemias and usually in combination with other drugs. 6-MP is also used to treat autoimmune diseases, such as inflammatory bowel disease (IBD), systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA) (Bermas and Hill, ’95; Ramsey-Goldman and Schilling, ’97). Initial oral doses for treatment of leukemia range between 2.5–5 mg/kg/d. For maintenance therapy of leukemia, doses range between 1.5–2.5 mg/kg/d. Similar doses (1.5–2.5 mg/kg/d) are used to treat IBD (Present et al., ’80; Botoman et al., ’98; USP DI, ’01), but the use of 6-MP as an immunosuppressant has been largely superseded by AZA, which has been shown to possess a better therapeutic index (Van Scoik et al., ’85; Goldstein, ’87; Chabner et al., ’96). AZA is no longer used as an antineoplastic agent (Ostensen, ’92), but is employed in the treatment of autoimmune disorders at doses between 1–2.5 mg/kg/d and at doses between 1–5 mg/kg/d as part of immunosuppressive regimens to prevent transplant rejection (Botoman et al., ’98; USP DI, ’01). The majority of patients affected by autoimmune diseases are women, in whom the peak incidence occurs between 16 and 55 years of age (Weterman, ’89; Brent et al., ’97; Esplin and Branch, ’97). Successful treatment with cytotoxic and immunosuppressant drugs such as AZA has greatly improved the feasibility of pregnancy in affected women, many of whom must continue to take the medications throughout gestation to prevent relapse. Similarly, women who become pregnant after organ transplantation continue immunosuppressive therapy to prevent rejection if they have been on immunosuppressive therapy before pregnancy. In some patients who become ill with an immunopathic or malignant disease while pregnant, treatment with 6-MP or AZA may be initiated during gestation. The use of cytotoxic immunosuppressants during pregnancy raises concern about possible adverse effects in the developing embryo or fetus, but the potential teratogenicity of AZA and 6-MP is difficult to evaluate in humans. These agents are used to treat patients who have severe illness, and it is often impossible to determine if adverse effects that occur in the embryo/fetus resulted from a particular treatment, the maternal illness, or some other factor (Brent et al., ’97). Also, because of the severity of the illness and the complications that ensue, combination therapy is common. Use of drug combinations as well as variations in dose further hamper efforts to attribute an observed adverse effect to a particular treatment. This article will review human and animal data regarding the pharmacology of 6-MP and AZA and their adverse effects on the embryo and fetus.

Background and Methods The purpose of this annual article is to highlight and briefly review new and significant information on agents that may be teratogenic in pregnant women. Various sources of on-line and printed information are given. Results The following topics have been discussed: 1) lithium medication: decreased estimate of risk; 2) cigarette smoking and genotype as contributors to oral-facial clefts and clubfoot; 3) trimethoprim; 4) methimazole syndrome?; 5) glucocorticoids and oral-facial clefts; 6) binge drinking; 7) fetal valproate syndrome; and 8) carbamazepine. Conclusions We have highlighted several maternal exposures during pregnancy that are associated with small but increased rates of birth defects, generally only a few cases per 1,000 infants. These exposures include cigarette smoking, and treatment with lithium, trimethoprim, methimazole, or corticosteroids. This weak teratogenic effect was usually identified by the linkage of an uncommon treatment with an unusual birth defect outcome. The use of modern epidemiologic techniques, especially prospective multicenter studies that provide increased numbers, has helped to strengthen the evidence for these associations. We discuss how teratogenic risks that are small in comparison to the background risk can be presented to at-risk women and their doctors. We have briefly listed some elements that might be used in prioritizing further studies of suspected teratogenic exposures. Various existing methods for expressing the strength of evidence for human teratogenicity are also given. Teratology 65:153–161, 2002. © 2002 Wiley-Liss, Inc.

Tsang E, Birch P, Friedman JM. Valuing gene testing in children with possible neurofibromatosis 1. With the growing number of clinical guidelines recommending genetics tests in routine clinical care, the value of these tests should be evaluated. We examined the economic value of offering genetic testing to children with possible neurofibromatosis 1 (NF1) in British Columbia. Diagnosis of NF1 is usually made based on diagnostic clinical criteria, but molecular diagnostic testing, currently offered on a case-by-case basis in BC, now reliably diagnoses NF1 in 95% of cases. Children who present with some clinical features but whose findings are insufficient to meet the diagnostic criteria are labelled as having ‘possible NF1’. Current guidelines call for these children to be followed as they have NF1, leading to annual ophthalmologic examinations and screening for complications; thus, there are increased costs to health care system. We created a model to account for these costs to the health care system, comparing the current protocol with one that would offer all children diagnosed with possible NF1 with genetic testing. Focusing on the incremental cost allowed us to determine that genetic testing provides good value, and patient interviews provided insight into the qualitative benefits of an earlier firm diagnosis. These findings may be helpful in guiding health policy decision-making.

Vascular lesions in neurofibromatosis 1 (NF1) are infrequently recognised as manifestations of the disease, yet they can produce serious complications. Most individuals with NF1 vasculopathy are asymptomatic, which may contribute to underestimation of its frequency. A recent study indicates that vascular changes in individuals with NF1 contribute to mortality at younger ages. We report the sudden death of a young man with NF1. On autopsy examination there was evidence of an intramyocardial vasculopathy characteristic of the vascular pathology previously described in NF1. Other cardiac findings included non-specific cardiomyopathic changes, myocardial fibrosis, and a “floppy” mitral valve. © 2001 Wiley-Liss, Inc.

Renal-coloboma syndrome includes abnormalities in the urogenital and ocular systems as its primary manifestations, although it can be associated with abnormalities in other systems as well. This syndrome is caused by mutations in the PAX2 gene and is transmitted as an autosomal dominant trait. We report a family in which at least 7 members have manifestations of renal-coloboma syndrome, including two in whom renal disease was diagnosed prenatally by ultrasound examination. A pathogenic frame-shift mutation (619insG) was found in the PAX2 gene in affected family members, who show remarkable variability in both the ocular and renal manifestations of the syndrome.

James Wilson originally proposed a set of “Principles of Teratology” in 1959, the year before he helped to found the Teratology Society. By 1977, when these Principles were presented in a more definitive form in Wilson and Fraser's Handbook of Teratology, they had become a standard formulation of the basic tenets of the field. Wilson's Principles have continued to guide scientific research in teratology, and they are widely used in teaching. Recent advances in our knowledge of the molecular and cellular bases of embryogenesis serve only to provide a deeper understanding of the fundamental developmental mechanisms that underlie Wilson's Principles of Teratology. Birth Defects Research (Part A), 2010. © 2010 Wiley-Liss, Inc.

Intrinsic lesions of arterial walls are an important manifestation of neurofibromatosis 1 (NF1). Neurofibromin is expressed in blood vessel endothelial and smooth muscle cells, and NF1 vasculopathy may result from an alteration of neurofibromin function in these cells. Elucidation of the role of neurofibromin in the maintenance and repair of blood vessels may lead to novel approaches to the treatment of NF1 vasculopathy and vascular disease in general.

Neurofibromatosis 1 (NF1), an autosomal dominant disease, exhibits extreme clinical variability. This variability greatly increases the burden for affected families and impairs our ability to understand the pathogenesis of NF1. Recognition of heterogeneity within a disease may provide important pathogenic insights, therefore we tested clinical data from three large sets of NF1 patients for evidence that certain common features are more likely to occur in some NF1 patients than in others. Clinical information on 4,402 patients with NF1 was obtained from three independent databases. We examined associations between pairs of clinical features in individual affected probands. We also examined associations between the occurrence of individual features in affected relatives. Associations were summarized as odds ratios with 95% confidence intervals. We found associations between several pairs of features in affected probands: intertriginous freckling and Lisch nodules, discrete neurofibromas and plexiform neurofibromas, discrete neurofibromas and Lisch nodules, plexiform neurofibromas and scoliosis, learning disability or mental retardation and seizures. We also found associations between the occurrence of Lisch nodules, macrocephaly, short stature, and learning disability or mental retardation as individual features in parents and children with NF1. Our observations suggest that, contrary to established belief, some NF1 patients are more likely than others to develop particular manifestations of the disease. Genetic factors appear to determine the development of particular phenotypic features.

Five percent of individuals with neurofibromatosis type 1 (NF1) present with congenital long bone pseudarthrosis (PA). In large series, 50-80% of patients with congenital long bone PA also have NF1. Very little information exists on the natural history and pathogenesis of PA in NF1. This report is a descriptive analysis of a large series of patients with NF1 and tibial bowing or PA. Study A is a case-control study using the National Neurofibromatosis Foundation International Database (NNFFID). Eighty-five patients with PA were compared to a control group from the same database. There was a statistically significant male predominance of NF1 cases with PA (54 males to 31 females), compared to controls (85 males to 87 females) (chi2 = 4.0, P = 0.046, using a two-tailed test with Yates' correction). There was no significant difference in the clinical presentation of NF1 manifestations in NF1 patients with PA than in NF1 patients without PA. Of the affected individuals with PA, there were 24 de novo cases and 21 familial cases (9 through maternal and 12 through paternal inheritance). Questions that could not be answered by Study A were addressed by a partially overlapping case-series report, Study B, in which data on 75 cases ascertained through questionnaires completed by NF center directors were collected. From Study B we determined that half of the patients who had a fracture sustained it before age 2, and approximately 16% of the pseudarthrosis patients had an amputation. Our data indicate a male predominance and no parent-of-origin effect. Male gender may be a susceptibility factor for pseudarthrosis in NF1.

The prevalence of neurofibromatosis type 1 (NF1) is about 1/3,000. There are no known ethnic groups in which NF1 does not occur or is unusually common. The prevalence is somewhat higher in young children than in adults, a difference that probably results at least in part from the early death of some NF1 patients. NF1 is fully penetrant in adults, but many disease features increase in frequency or severity with age. The reproductive fitness of NF1 patients is reduced by about one-half. About half of all cases result from new mutations. The estimated rate of new NF1 mutations is unusually high, but the basis for this high mutation rate is not known. Am. J. Med. Genet. (Semin. Med. Genet.) 89:1-6, 1999.