Search

Transcriptional regulation underlies most developmental programs and physiological responses to environmental changes in plants. Transcription factors (TFs) play a key role in the regulation of gene expression by binding specifically to short DNA sequences in the regulatory regions of genes: the TF binding sites (TFBSs). In recent years, several bioinformatic tools have been developed to detect TFBSs in candidate genes, either by de novo prediction or by directly mapping experimentally known TFBSs. However, most of these tools contain information for only a few species or require multi-step procedures, and are not always intuitive for non-experienced researchers. Here we present TFBS-Discovery Tool Hub (TDTHub), a web server for quick and intuitive studies of transcriptional regulation in plants. TDTHub uses pre-computed TFBSs in 40 plant species and allows the choice of two mapping algorithms, providing a higher versatility. Besides the main TFBS enrichment tool, TDTHub includes additional tools to assist in the analysis and visualization of data. In order to demonstrate the effectiveness of TDTHub, we analyzed the transcriptional regulation of the anthocyanin biosynthesis pathway. We also analyzed the transcriptional cascades in response to jasmonate and wounding in Arabidopsis and tomato (Solanum lycopersicum), respectively. In these studies, TDTHub helped to verify the most relevant TF nodes and to propose new ones with a prominent role in these pathways. TDTHub is available at http://acrab.cnb.csic.es/TDTHub/, and it will be periodically upgraded and expanded for new species and gene annotations.

Lignin is a largely untapped source for the bioproduction of value-added chemicals. Pseudomonas putida KT2440 has emerged as a strong candidate for bioprocessing of lignin feedstocks due to its resistance to several industrial solvents, broad metabolic capabilities, and genetic amenability. Here we demonstrate the engineering of P. putida for the ability to metabolize syringic acid, one of the major products that comes from the breakdown of the syringyl component of lignin. The rational design was first applied for the construction of strain Sy-1 by overexpressing a native vanillate demethylase. Subsequent adaptive laboratory evolution (ALE) led to the generation of mutations that achieved robust growth on syringic acid as a sole carbon source. The best mutant showed a 30% increase in the growth rate over the original engineered strain. Genomic sequencing revealed multiple mutations repeated in separate evolved replicates. Reverse engineering of mutations identified in agmR, gbdR, fleQ, and the intergenic region of gstB and yadG into the parental strain recaptured the improved growth of the evolved strains to varied extent. These findings thus reveal the ability of P. putida to utilize lignin more fully as a feedstock and make it a more economically viable chassis for chemical production.

Multiple SARS-CoV-2 variants have successively, or concommitantly spread worldwide since summer 2020. A few co-infections with different variants were reported and genetic recombinations, common among coronaviruses, were reported or suspected based on co-detection of signature mutations of different variants in a given genome. Here we report three infections in southern France with a Delta 21J/AY.4-Omicron 21K/BA.1 “Deltamicron” recombinant. The hybrid genome harbors signature mutations of the two lineages, supported by a mean sequencing depth of 1,163-1,421 reads and mean nucleotide diversity of 0.1-0.6%. It is composed of the near full-length spike gene (from codons 156-179) of an Omicron 21K/BA.1 variant in a Delta 21J/AY.4 lineage backbone. Importantly, we cultured an isolate of this recombinant and sequenced its genome. It was observed by scanning electron microscopy. As it is misidentified with current variant screening qPCR, we designed and implemented for routine diagnosis a specific duplex qPCR. Finally, structural analysis of the recombinant spike suggested its hybrid content could optimize viral binding to the host cell membrane. These findings prompt further studies of the virological, epidemiological, and clinical features of this recombinant.

As important pattern recognition receptors (PRRs), C-type lectins play crucial roles in the crustacean innate immune system. In this study, a novel C-type lectin, designated as MnLec1, was obtained from the exoskeleton of the oriental river prawn Macrobrachium nipponense for the first time. The full-length cDNA of MnLec1 was 1329 bp with an open reading frame of 774 bp. The predicted MnLec1 protein contains a single carbohydrate-recognition domain with an EPN/LND motif and one Ca

A nonsynonymous nucleotide substitution in exon 1 results in the novel HLA-DQB1*03:493 allele.

One nucleotide substitution in codon 51 of HLA-A*24:02:01:01 results in the novel allele, HLA-A*24:244.

One nucleotide substitution in codon 141 of HLA-B*52:01:01:01 results in a novel allele HLA-B*52:109.

HLA-A*02:937 has one nucleotide change compared with HLA-A*02:07:01:01 in codon 182 of exon 3 (ACGGCG).

One nucleotide substitution (C T) in codon 183b HLA-DRB1*12:02:01:01, results in the novel allele, HLA-DRB1*12:69.

HLA-B*07:457 differs from HLA-B*07:02:01:01 in codon 117 in exon 3.

Currently, Chinese laboratory macaques are widely used in biomedical research. Correspondingly, clarity regarding the genetic diversity of Chinese laboratory macaques is important for both vendors and users.Genome sequences of 55 laboratory macaques (40 cynomolgus macaques and 15 rhesus macaques) bred in South China were analyzed using 2b-RAD simplified genome sequencing.A total of 115,681 single-nucleotide polymorphisms (SNPs) were found that were distributed in 21 chromosomes and an unplaced scaffold. Genetic diversity indices varied across populations and exhibited low values. The results of principal coordinate analysis (PCA) were consistent with those of the arithmetic mean (UPGMA) clustered tree and supported the structure analysis, demonstrating that the genetic differentiation in rhesus macaques was higher than that in cynomolgus macaques. Introgressive hybridization with the Chinese rhesus macaque was supported in more than 80% (32/40) of cynomolgus macaques.Chinese laboratory macaques had relatively low genetic diversity at the genomic level, and genetic differentiation in Chinese rhesus macaques was higher than in cynomolgus macaques. The genome of cynomolgus macaques has been shaped by introgression after hybridization with the Chinese rhesus macaques.

DNA polymerase β is one of the key enzymes involved in DNA damage repair and its proper expression is strictly controlled within different cells. We previously reported that three genetic mutations in the promoter region of the polb gene are prevalent in the Chinese Han population and two types of mutation are associated with thymic hyperplasia. The purpose of this study was to explore whether other mutated sites exist within the promoter region of the polb gene.Genomic DNAs of 421 healthy Chinese Han individuals were extracted from whole blood samples and used for gene amplification of the promoter region of the polb gene. After gel purification, PCR amplicons were sequenced by the Sanger sequencing method and used for sequence alignment with the Lasergene program. PCR products with novel mutations were then subcloned into luciferase reporter plasmid pGL4.10 and transfected into 293T cells for dual-luciferase activity analysis.In total, 11 mutated sites were detected in the Chinese Han population and eight of these were reported for the first time. Using a dual luciferase reporter system, it was found that one novel mutation -142 C G could decrease the transcription activity of the polb gene, whereas two novel mutations, -152_-151insC and -218 C G, could significantly increase the transcription activity of the polb gene.High polymorphic sites could be found in the promoter region of polb gene and approximately half of them could influence its transcription activity.

HpaR is a transcription regulator in the MarR family that controls the expression of the gene cluster responsible for conversion of p-hydroxyphenylacetate to pyruvate and succinate for cellular metabolism. Here, we report the biochemical and structural characterization of Acinetobacter baumannii HpaR (AbHpaR) and its complex with cognate DNA. Our study revealed that AbHpaR binds upstream of the divergently transcribed hpaA gene and the meta-cleavage operon, as well as the hpaR gene, thereby repressing their transcription by blocking access of RNA polymerase. Structural analysis of AbHpaR-DNA complex revealed that the DNA binding specificity can be achieved via a combination of both direct and indirect DNA sequence readouts. DNA binding of AbHpaR is weakened by 3,4-dihydroxyphenylacetate (DHPA), which is the substrate of the meta-cleavage reactions; this likely leads to expression of the target genes. Based on our findings, we propose a model for how A. baumannii controls transcription of HPA-metabolizing genes, which highlights the independence of global catabolite repression and could be beneficial for metabolic engineering toward bioremediation applications. DATABASES: The structural data that support these findings are openly available in the wwPDB at https://doi.org/10.2210/pdb7EL2/pdb and https://doi.org/10.2210/pdb7EL3/pdb for AbHpaR and AbHpaR-DNA complex, respectively.

Selection leaves signatures in the DNA sequence of genes, with many test statistics devised to detect its action. While these statistics are frequently used to support hypotheses about the adaptive significance of particular genes, the effect these genes have on reproductive fitness is rarely quantified experimentally. Consequently, it is unclear how gene-level signatures of selection are associated with empirical estimates of gene effect on fitness. Eukaryotic data sets that permit this comparison are very limited. Using the model plant Arabidopsis thaliana, for which these resources are available, we calculated seven gene-level substitution and polymorphism-based statistics commonly used to infer selection (dN/dS, NI, DOS, Tajima's D, Fu and Li's D*, Fay and Wu's H, and Zeng's E) and, using knockout lines, compared these to gene-level estimates of effect on fitness. We found that consistent with expectations, essential genes were more likely to be classified as negatively selected. By contrast, using 379 Arabidopsis genes for which data was available, we found no evidence that genes predicted to be positively selected had a significantly different effect on fitness than genes evolving more neutrally. We discuss these results in the context of the analytic challenges posed by Arabidopsis, one of the only systems in which this study could be conducted, and advocate for examination in additional systems. These results are relevant to the evaluation of genome-wide studies across species where experimental fitness data is unavailable, as well as highlighting an increasing need for the latter.

Despite worldwide distribution and rich diversity, the knowledge of mitochondrial genome (mtgenome) characteristics within the family Tenebrionidae (Coleoptera) is still very limited, and phylogenetics remain unresolved for the family. In this study, the mtgenomes for 12 species are newly sequenced and annotated. Three of the species represent the first report of complete mtgenomes from the subfamily Alleculinae. Comparative analysis of 36 tenebrionid mtgenomes finds that gene composition and order are the same as a theoretical ancestral insect mtgenome, and AT bias, length variation, and codon usage are consistent with other reported beetle mtgenomes. Some intergenic overlap and gap sequences may contain phylogenetically informative information, whereas neither the conserved, nor repeat sequences in the control region do. The subfamilies Lagriinae, Pimeliinae, Stenochiinae, and Alleculinae are found to be monophyletic, and the subfamilies Diaperinae and Tenebrioninae polyphyletic in our study. Furthermore, Lagriinae is sister to the rest of the subfamilies. At the tribal level, the tribes Lagriini in the subfamily Lagrrinae; Strongyliini in Stenochiinae; Cteniopodini in Alleculinae; and Triboliini, Opatrini, and Amarygmini in Tenebrioninae are monophyletic; while Diaperini in Diaperinae, and Tenebrionini in Tenebrioninae are polyphyletic. This article is protected by copyright. All rights reserved.

Following the discovery of the SARS-CoV-2 Omicron variant (B.1.1.529), the global COVID-19 outbreak has resurfaced after appearing to be relentlessly spreading over the past 2 years. This new variant showed marked degree of mutation, compared with the previous SARS-CoV-2 variants. This study investigates the evolutionary links between Omicron variant and recently emerged SARS-CoV-2 variants. The entire genome sequences of SARS-CoV-2 variants were obtained, aligned using Clustal Omega, pairwise comparison was computed, differences, identity percent, gaps, and mutations were noted, and the identity matrix was generated. The phylogenetics of Omicron variants were determined using a variety of evolutionary substitution models. The ultrametric and metric clustering methods, such as UPGMA and neighbor-joining (NJ), using nucleotide substitution models that allowed the inclusion of nucleotide transitions and transversions as Kimura 80 models, revealed that the Omicron variant forms a new monophyletic clade that is distant from other SARS-CoV-2 variants. In contrast, the NJ method using a basic nucleotide substitution model such as Jukes-Cantor revealed a close relationship between the Omicron variant and the recently evolved Alpha variant. Based on the percentage of sequence identity, the closest variants were in the following order: Omicron, Alpha, Gamma, Delta, Beta, Mu, and then the SARS-CoV-2 USA isolate. A genome alignment with other variants indicated the greatest number of gaps in the Omicron variant's genome ranging from 43 to 63 gaps. It is possible, given their close relationship to the Alpha variety, that Omicron has been around for much longer than predicted, even though they created a separate monophyletic group. Sequencing initiatives in a systematic and comprehensive manner is highly recommended to study the evolution and mutations of the virus.

The pivotal role of dysregulated miRNAs in development of papillary thyroid carcinoma has been emphasized in recent research. miR‐671‐5p was previously documented to function as a tumor suppressor. However, the role and mechanism of miR‐671‐5p in progression of papillary thyroid carcinoma remain to be further studied. Data from functional assays indicated that forced expression of miR‐671‐5p decreased cell viability, repressed cell proliferation, migration, and invasion in papillary thyroid carcinoma cells. In vivo study showed that miR‐671‐5p overexpression inhibited tumor growth, downregulated Ki67, and decreased tumor volume and weight. Tripartite motif containing 14 (TRIM14) was verified as downstream target of miR‐671‐5p. The expression of TRIM14 was suppressed by miR‐671‐5p in papillary thyroid carcinoma. Overexpression of TRIM14 increased cell viability, and promoted the proliferation, migration, and invasion of papillary thyroid carcinoma. Moreover, TRIM14 counteracted the suppressive effect of miR‐671‐5p overexpression on papillary thyroid carcinoma cell growth. In conclusion, miR‐671‐5p repressed progression of papillary thyroid carcinoma through downregulation of TRIM14, providing a promising target for therapy of papillary thyroid carcinoma.

Myxomycetes are terrestrial protists with many presumably cosmopolitan species dispersing via airborne spores. A truly cosmopolitan species would suffer from outbreeding depression hampering local adaptation, while locally adapted species with limited distribution would be at a higher risk of extinction in changing environments. Here, we investigate intraspecific genetic diversity and phylogeography of Physarum albescens over the entire Northern Hemisphere. We sequenced 324 field collections of fruit bodies for 1-3 genetic markers (SSU, EF1A, COI) and analysed 98 specimens with genotyping by sequencing. The structure of the three-gene phylogeny, SNP-based phylogeny, phylogenetic networks, and the observed recombination pattern of three independently inherited gene markers can be best explained by the presence of at least 18 reproductively isolated groups, which can be seen as cryptic species. In all intensively sampled regions and in many localities, members of several phylogroups coexisted. Some phylogroups were found to be abundant in only one region and completely absent in other well-studied regions, and thus may represent regional endemics. Our results demonstrate that the widely distributed myxomycete species Ph. albescens represents a complex of at least 18 cryptic species, and some of these seem to have a limited geographical distribution. In addition, the presence of groups of presumably clonal specimens suggests that sexual and asexual reproduction coexist in natural populations of myxomycetes.

Understanding the activity of biomolecules in cosolvent systems is important for catalysis, separation and developing biosensors. The majority of previously studied solvents are either phase separated with water or miscible with water. Butanol was recently used to extract water for the conjugation of DNA to gold nanoparticles. In this work, the effect of butanol on the activity of a few RNA-cleaving DNAzymes was studied. A 130-fold improvement in sensitivity for the Na+ -specific EtNa DNAzyme was observed, and butanol also improved the activity of another Na+ -specific DNAzyme, NaA43T by a few folds. However, when divalent metal ions were used for both EtNa and 17E DNAzymes, the activity was inhibited. A main driven force for enhanced DNAzyme activity is the concentration effect due to butanol dehydration. This study provides insights into the interplay between DNA, metal ions and organic solvents, and such an understanding might be useful for developing sensitive biosensors.

Endogenous transfer RNA‐derived small RNAs (tsRNAs) are newly identified RNAs that are closely associated with the pathogenesis of multiple diseases, but the involvement of tsRNAs in regulating acute pancreatitis (AP) development has not been reported. In this study, we screened out a novel tsRNA, tRF3‐Thr‐AGT, that was aberrantly downregulated in the acinar cell line AR42J treated with sodium taurocholate (STC) and the pancreatic tissues of STC‐induced AP rat models. In addition, STC treatment suppressed cell viability, induced pyroptotic cell death and cellular inflammation in AP models in vitro and in vivo. Overexpression of tRF3‐Thr‐AGT partially reversed STC‐induced detrimental effects on the AR42J cells. Next, Z‐DNA‐binding protein 1 (ZBP1) was identified as the downstream target of tRF3‐Thr‐AGT. Interestingly, upregulation of tRF3‐Thr‐AGT suppressed NOD‐like receptor protein 3 (NLRP3)‐mediated pyroptotic cell death in STC‐treated AR42J cells via degrading ZBP1. Moreover, the effects of tRF3‐Thr‐AGT overexpression on cell viability and inflammation in AR42J cells were abrogated by upregulating ZBP1 and NLRP3. Collectively, our data indicated that tRF3‐Thr‐AGT suppressed ZBP1 expressions to restrain NLRP3‐mediated pyroptotic cell death and inflammation in AP models. This study, for the first time, identified the role and potential underlying mechanisms by which tRF3‐Thr‐AGT regulated AP pathogenesis.

The genomic era continues to revolutionize our understanding of the evolution of biodiversity. In phycology, emphasis remains on assembling nuclear and organellar genomes, leaving the full potential of genomic datasets to answer long-standing questions about the evolution of biodiversity largely unexplored. Here, we used whole-genome sequencing (WGS) datasets to survey species diversity in the kelp genus Alaria, compare phylogenetic signals across organellar and nuclear genomes, and specifically test whether phylogenies behave like trees or networks. Genomes were sequenced from across the global distribution of Alaria (including Alaria crassifolia, A. praelonga, A. crispa, A. marginata, and A. esculenta), representing over 550 GB of data and over 2.2 billion paired reads. Genomic datasets retrieved 3,814 and 4,536 single-nucleotide polymorphisms (SNPs) for mitochondrial and chloroplast genomes, respectively, and upwards of 148,542 high-quality nuclear SNPs. WGS revealed an Arctic lineage of Alaria, which we hypothesize represents the synonymized taxon A. grandifolia. The SNP datasets also revealed inconsistent topologies across genomic compartments, and hybridization (i.e., phylogenetic networks) between Pacific A. praelonga, A. crispa, and putative A. grandifolia, and between some lineages of the A. marginata complex. Our analysis demonstrates the potential for WGS data to advance our understanding of evolution and biodiversity beyond amplicon sequencing, and that hybridization is potentially an important mechanism contributing to novel lineages within Alaria. We also emphasize the importance of surveying phylogenetic signals across organellar and nuclear genomes, such that models of mixed ancestry become integrated into our evolutionary and taxonomic understanding.

The Heteroduplex mobility assay (HMA) has proven to be a robust tool for the detection of genetic variation. Here, we describe a simple and rapid application of the HMA by microfluidic capillary electrophoresis, for phylogenetics and population genetic analyses (pgHMA). We show how commonly applied techniques in phylogenetics and population genetics have equivalents with pgHMA: phylogenetic reconstruction with bootstrapping, skyline plots, and mismatch distribution analysis. We assess the performance and accuracy of pgHMA by comparing the results obtained against those obtained using standard methods of analyses applied to sequencing data. The resulting comparisons demonstrate that: (1) there is a significant linear relationship (R = 0.992) between heteroduplex mobility and genetic distance; (2) phylogenetic trees obtained by HMA and nucleotide sequences present nearly identical topologies; (3) clades with high pgHMA parametric bootstrap support also have high bootstrap support on nucleotide phylogenies; (4) skyline plots estimated from the UPGMA trees of HMA and Bayesian trees of nucleotide data reveal similar trends, especially for the median trend estimate of effective population size; and (5) optimized mismatch distributions of HMA are closely fitted to the mismatch distributions of nucleotide sequences. In summary, pgHMA is an easily-applied method for approximating phylogenetic diversity and population trends. KEYWORDS: bootstrap, heteroduplex mobility assay, mismatch distribution, phylogenetics, skyline plot

Background Tick-borne encephalitis virus (TBEV) is an important causative agent that causes neurological infections in humans and animals. In recent years, only few epidemiological surveys on TBEV have been conducted in China. The purpose of this study was to determine the prevalence and subtype of TBEV in ticks in northeastern (NE) China. Methods A total of 3799 questing ticks were collected in NE China between April 2015 and June 2016. Ticks were pooled and tested for TBEV RNA using semi-nested reverse transcriptase polymerase chain reaction. Positive pools were used to isolate the virus and amplify complete sequences, followed by sequence identity and phylogenetic analysis. Results TBEV RNA was detected in Ixodes persulcatus ticks at a total prevalence of 2.9% (6/143; 95% confidence interval: 1.2-5.9%). Three TBEV strains were isolated (JL-T75, HLB-T74, and DXAL-T83) and showed 93.9-99.1% nucleotide identities and 97.1-99.5% amino acid identities in Far Eastern (FE) TBEV subtypes, and 82.9-87.6% nucleotide identities and 92.9-96.4% amino acid identities in other subtypes. For polyprotein, the JL-T75, HLB-T74, and DXAL-T83 strains showed 29, 50, and 55 amino acid residues, respectively, different from those in the TBEV vaccine (Senzhang) strain in China. Phylogenetic analysis revealed that these viruses were clustered in the FE-TBEV branch but formed distinct clades depending on the natural foci. Conclusions The results of this study suggest that the FE-TBEV subtype is still endemic in I. persulcatus ticks in NE China, and the viruses in different natural foci in NE China are more likely to have genetic differences. This article is protected by copyright. All rights reserved.

The creation of new soybean varieties has been limited by genomic duplication and redundancy. Efficient multiplex gene editing and large chromosomal segment deletion through clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) systems are promising strategies for overcoming these obstacles. CRISPR/Cpf1 is a robust tool for multiplex gene editing. However, large chromosomal excision mediated by CRISPR/Cpf1 has been reported in only a few non-plant species. Here, we report on CRISPR/LbCpf1-induced large chromosomal segment deletions in soybean using multiplex gene targeting. The CRISPR/LbCpf1 system was optimized for direct repeat and guide RNA lengths in crispr RNA (crRNA) array. The editing efficiency was evaluated using LbCpf1 driven by the CaMV35S and soybean ubiquitin promoter. The optimized system exhibited editing efficiencies of up to 91.7%. Our results showed eight gene targets could be edited simultaneously in one step when a single eight-gRNA-target crRNA array was employed, with an efficiency of up to 17.1%. We successfully employed CRISPR/LbCpf1 to produce small fragments (

Premise Although chestnuts and chinquapins are some of the best known and most widely loved of any plants in North America, relatively little genomic sequencing has been done, and much is still unknown about their evolution. Methods We used double-digest restriction-site-associated DNA (ddRAD) sequencing data to infer the species-level phylogeny for Castanea and assess the phylogeography of the North American species using samples collected from populations that span the full extent of the species' ranges. We also constructed species distribution models using digitized herbarium specimens and observational data from field surveys. Results We identified strong population structure within Castanea dentata (American chestnut) that reflects a stepwise northern migration since the last glacial maximum. Our species distribution models further confirmed this scenario and matched closely with the Castanea fossil pollen record. We also found significant structure within the Castanea pumila lineage, most notably a genetic cluster that corresponds to the frequently recognized Castanea pumila var. ozarkensis. Conclusions The two North American Castanea species have contrasting patterns of population structure, but each is typical of plant phylogeography in North America. Within the C. pumila complex, we found novel genetic structure that provides new insights about C. pumila taxonomy. Our results also identified a series of distinctive populations that will be valuable in ongoing efforts to conserve and restore chestnuts and chinquapins in North America.

Aptamers composed of mirror-image L-(deoxy)ribose nucleic acids, referred to as L-aptamers, are a promising class of RNA-binding reagents. Yet, the selectivity of cross-chiral interactions between L-aptamers and their RNA targets remain poorly characterized, limiting the potential utility of this approach for applications in biological systems. Herein, we carried out the first comprehensive analysis of cross-chiral L-aptamer selectivity using a newly developed "inverse" in vitro selection approach that exploits the genetic nature of the D-RNA ligand. By employing a library of more than a million target-derived sequences, we determined the RNA sequence and structural preference of a model L-aptamer and revealed previously unidentified and potentially broad off-target RNA binding behaviors. These results provide valuable information for assessing the likelihood and consequences of potential off-target interactions and reveal strategies to mitigate these effects. Thus, inverse in vitro selection provides several opportunities to advance L-aptamer technology.

Technological progress over the past 15 years has fueled an explosion in genome-wide chromatin profiling tools that take advantage of low-cost short-read sequencing technologies to map particular chromatin features. Here, we survey the recent development of epigenomic tools that provide precise positions of chromatin proteins genome-wide in intact cells or nuclei. Some profiling tools are based on tethering Micrococcal Nuclease to chromatin proteins of interest in situ, whereas others similarly tether Tn5 transposase to integrate DNA sequencing adapters (tagmentation) and so eliminate the need for library preparation. These in situ cleavage and tagmentation tools have gained in popularity over the past few years, with many protocol enhancements and adaptations for single-cell and spatial chromatin profiling. The application of experimental and computational tools to address problems in gene regulation, eukaryotic development, and human disease are helping to define the emerging field of chromatin structural epigenomics.

The Pacific cupped oyster Crassostrea gigas is one of the most 'globalized' marine invertebrates and its production is predominant in many parts of the world including Europe. However, it is threatened by mortality events associated with pathogenic microorganisms such as the virus OsHV-1 and the bacteria Vibrio aestuarianus. C. gigas is also a host for protozoan parasites including haplosporidians. In contrast with Haplosporidium nelsoni previously detected in Europe, H. costale was considered exotic although its presence in French oysters was suggested in the 1980s based on ultrastructural examination. Here, a combination of light and transmission electron microscopy, PCR and sequencing allowed characterizing the presence of the parasite in the context of low mortality events which occurred in 2019 in France. Histological observation revealed the presence of uninucleated, plasmodial and spore stages within the connective tissues of some oysters. Ultrastructural features were similar to H. costale ones in particular the presence of axe-shaped haplosporosomes in spore cytoplasms. Three fragments of the genome including partial small subunit rRNA gene, the ITS-1, 5.8S and ITS-2 array and part of the actin gene were successfully sequenced and grouped with H. costale homologous sequences. This is the first time that the presence of H. costale was confirmed in C. gigas in France. Furthermore, a TaqMan real-time PCR assay was developed and validated [DSe = 92.6% (78.2-99.8) and DSp = 95.5% (92.3-98.6)] to enable the rapid and specific detection of the parasite. The application of the PCR assay on archived samples revealed that the parasite has been present in French oyster populations at least since 2008. Considering the little information available on this parasite, the newly developed TaqMan assay will be very helpful to investigate the temporal and geographic distribution and the life cycle of the parasite in France and more generally in C. gigas geographic range.

HLA-B*35:251:02 has one nucleotide change from HLA-B*35:22:01:01 at nucleotide 363 changing Serine to Arginine at residue 97.

Nucleotide substitutions in codons 11 and 12 of HLA-A*26:01:01:01 result in a novel allele, HLA-A*26:35.

HLA-B*46:83 differs from HLA-B*46:03 by one single nucleotide substitution at position 539GT.

HLA-DPB1*03:01:14 differs from HLA-DPB1*03:01:01:01 by a single nucleotide substitution at position 390 C A.

To investigate the role of the lncRNA growth arrest special 5 (GAS5) in ovarian clear cell carcinoma (OCCC), we measured the expression of GAS5 and miR‐31‐5p in OCCC tissue samples and OCCC cell lines using RT‐qPCR. MTT and colony formation assays were used to measure cell viability and colony formation ability. Cell invasion was determined by Transwell assays. The binding between GAS5 and miR‐31‐5p as well as miR‐31‐5p and ARID1A was determined by dual‐luciferase reporter assays. The ARID1A protein levels were detected using western blotting. Kaplan–Meier curves were used for the analysis of the 5‐year survival rate of patients with OCCC. GAS5 and ARID1A levels were significantly decreased, while miR‐31‐5p levels were strongly elevated in the OCCC tissues and cell lines. Patients with lower GAS5/ARID1A levels had shorter overall survival times. Overexpression of GAS5 or inhibition of miR‐31‐5p suppressed cell viability and invasion of OCCC cells and upregulated the protein levels of ARID1A. Moreover, overexpression of miR‐31‐5p reversed the effects of overexpression of GAS5. Cotransfection with pcDNA3.1‐GAS5 and miR‐31‐5p inhibitor led to the lowest cell viability and cell invasion rates. A dual‐luciferase reporter assay was performed to confirm the target relationship between GAS5 and miR‐31‐5p, as well as between miR‐31‐5p and ARID1A. LncRNA GAS5 inhibited cell viability and invasion of OCCC through activation of ARID1A by sponging miR‐31‐5p.

HLA-B*46:64 has one nucleotide change from HLA-B*46:01:01:01 where Histidine (113) is changed to Arginine. This article is protected by copyright. All rights reserved.

To fully appreciate genetics, one must understand the link between genotype (DNA sequence) and phenotype (observable characteristics). Advances in high-throughput genomic sequencing technologies and applications, so-called "-omics," have made genetic sequencing readily available across fields in biology from applications in non-traditional study organisms to precision medicine. Thus, understanding these tools is critical for any biologist, especially those early in their career. This comprehensive review discusses the chronological development of different sequencing methods, the bioinformatics steps to analyzing this data, and social and ethical issues raised by these techniques that must be discussed and evaluated, including anticipatory guides and discussion questions for active engagement in the classroom. Additionally, the Supporting Information includes a case study to apply technical and ethical concepts from the text.

Trichomes function in plant defenses against biotic and abiotic stresses; examination of glabrous lines, which lack trichomes, has revealed key aspects of trichome development and function. Tests of allelism in 51 glabrous rice (Oryza sativa) accessions collected worldwide identified OsSPL10 and OsWOX3B as regulators of trichome development in rice. Here, we report that OsSPL10 acts as a transcriptional regulator controlling trichome development. Haplotype and transient expression analyses revealed that variation in the approximately 700-bp OsSPL10 promoter region is the primary cause of the glabrous phenotype in the indica cultivar WD-17993. Disruption of OsSPL10 by genome editing decreased leaf trichome density and length in the NIL-HL6 background. Plants with genotype OsSPL10WD-17993 /HL6 generated by crossing WD-17993 with NIL-HL6 also had fewer trichomes in the glumes. HAIRY LEAF6 (HL6) encodes another transcription factor that regulates trichome initiation and elongation, and OsSPL10 directly binds to the HL6 promoter to regulate its expression. Moreover, the transcript levels of auxin-related genes, such as OsYUCCA5 and OsPIN-FORMED1b, were altered in OsSPL10 overexpression and RNAi transgenic lines. Feeding tests using locusts (Locusta migratoria) demonstrated that non-glandular trichomes affect feeding by this herbivore. Our findings provide a molecular framework for trichome development and an ecological perspective on trichome functions.

The kidney tropism of severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) has been well‐validated clinically and often leads to various forms of renal damage in coronavirus disease‐2019 (COVID‐19) patients. However, the underlying mechanisms and diagnostic approaches remain to be determined. We interrogated the expression of virus‐related host factors in single‐cell RNA sequencing (scRNA‐seq) datasets of normal human kidneys and kidneys with pre‐existing diseases and validated the results with urinary proteomics of COVID‐19 patients and healthy individuals. We also assessed the effects of genetic variants on kidney susceptibility using expression quantitative trait loci (eQTLs) databases. We identified a subtype of tubular cells, which we named PT‐3 cells, as being vulnerable to SARS‐CoV‐2 infections in the kidneys. PT‐3 cells were enriched in viral entry factors and replication and assembly machinery but lacked antiviral restriction factors. Immunohistochemistry confirmed positive staining of PT‐3 cell marker SCL36A2 on kidney sections from COVID‐19 patients. Urinary proteomic analyses of COVID‐19 patients revealed that markers of PT‐3 cells were significantly increased, along with elevated viral receptor angiotensin‐converting enzyme 2. We further found that the proportion of PT‐3 cells increased in diabetic nephropathy but decreased in kidney allografts and lupus nephropathy, suggesting that kidney susceptibility varied among these diseases. We finally identified several eQTLs that regulate the expression of host factors in kidney cells. PT‐3 cells may represent a key determinant for the kidney tropism of SARS‐CoV‐2, and detection of PT‐3 cells may be used to assess the risk of renal infection during COVID‐19., Through single‐cell analysis, we identified PT‐3 cells, a proximal tubule epithelial cell subtype in human kidney, that are highly susceptible to severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. We validated these results using immunostaining and urinary proteomics in coronavirus disease‐2019 (COVID‐19) patients. Our findings provide not only new insights into the mechanism involving SARS‐CoV‐2 infection of the kidney cells, but also a potential strategy for risk assessment of kidney infection among COVID‐19 patients.

Circular RNAs (circRNAs) are a class of noncoding RNAs that are widely expressed in cancer tissues and play a pro‐ or anticancer role in modulating cancer progression. This work is aimed to probe the biological role of circ_0000317 in colorectal cancer (CRC) and its underlying mechanism. Circ_0000317 was selected from the circRNA microarray datasets (GSE121895). Quantitative real‐time polymerase chain reaction was utilized to examine circ_0000317, microRNA (miR)‐520g, and homeobox D10 (HOXD10) mRNA expression in CRC. Cell Counting Kit‐8 and Transwell experiments were conducted to examine the effects of circ_0000317 on proliferation, migration, and invasion of CRC cells. Bioinformatic analysis and dual‐luciferase reporter gene experiments were implemented to predict and validate the targeting relationship between circ_0000317 and miR‐520g, miR‐520g, and HOXD10. Western blot was employed to examine HOXD10 expression at protein level in CRC cells. Circ_0000317 and HOXD10 mRNA expression were unveiled to be down‐modulated and miR‐520g expression was up‐modulated in CRC. Functionally, circ_0000317 overexpression repressed CRC cell proliferation, migration, and invasion. Mechanistically, miR‐520g was a direct target of circ_0000317 and miR‐520g specifically modulated HOXD10 expression. Furthermore, miR‐520g mimics partially counteracted the suppressing effect of circ_0000317 on malignant phenotype of CRC cells. Circ_0000317 represses CRC progression by targeting miR‐520g and modulating HOXD10 expression. Hence, circ_0000317 may be a promising diagnostic biomarker and a therapeutic target for CRC.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) system has been widely used for precise gene editing in plants. However, simultaneous gene editing of multiple homoeoalleles remains challenging, especially in self-incompatible polyploid plants. Here, we simultaneously introduced targeted mutations in all three homoeoalleles of two genes in the self-incompatible allohexaploid tall fescue, using both CRISPR/Cas9 and LbCas12a (LbCpf1) systems. Loss-of-function mutants of FaPDS exhibited albino leaves, while knockout of FaHSP17.9 resulted in impaired heat resistance in T0 generation of tall fescue. Moreover, these mutations were inheritable. Our findings demonstrate the feasibility of generating loss-of-function mutants in T0 generation polyploid perennial grasses using CRISPR/Cas systems.