Search

Manfred Göthert, who had served Naunyn-Schmiedeberg’s Arch Pharmacol as Managing Editor from 1998 to 2005, deceased in June 2019. His scientific oeuvre encompasses more than 20 types of presynaptic receptors, mostly on serotoninergic and noradrenergic neurones. He was the first to identify presynaptic receptors for somatostatin and ACTH and described many presynaptic receptors, known from animal preparations, also in human tissue. In particular, he elucidated the pharmacology of presynaptic 5-HT receptors. A second field of interest included ligand-gated and voltage-dependent channels. The negative allosteric effect of anesthetics at peripheral nACh receptors is relevant for the peripheral clinical effects of these drugs and modified the Meyer-Overton hypothesis. The negative allosteric effect of ethanol at NMDA receptors in human brain tissue occurred at concentrations found in the range of clinical ethanol intoxication. Moreover, the inhibitory effect of gabapentinoids on P/Q Ca2+ channels and the subsequent decrease in AMPA-induced noradrenaline release may contribute to their clinical effect. Another ligand-gated ion channel, the 5-HT3 receptor, attracted the interest of Manfred Göthert from the whole animal via isolated preparations down to the cellular level. He contributed to that molecular study in which 5-HT3 receptor subtypes were disclosed. Finally, he found altered pharmacological properties of 5-HT receptor variants like the Arg219Leu 5-HT1A receptor (which was also shown to be associated with major depression) and the Phe124Cys 5-HT1B receptor (which may be related to sumatriptan-induced vasospasm). Manfred Göthert was a brilliant scientist and his papers have a major impact on today’s pharmacology.

Muscarinic M2 and M4 receptors resemble each other in brain distribution, function, and Gi/o protein signaling. However, there is evidence from human recombinant receptors that the M4 receptor also couples to Gs protein whereas such an alternative signaling is of minor importance for its M2 counterpart. The question arises whether this property is shared by native receptors, e.g., the murine hippocampal M2- and the striatal M4-autoreceptor. To this end, the electrically evoked tritium overflow was studied in mouse hippocampal and striatal slices pre-incubated with 3H-choline. 3H-Acetylcholine release in either region was inhibited by the potent muscarinic receptor agonist iperoxo (pIC50 8.6–8.8) in an atropine-sensitive manner (apparent pA2 8.6–8.8); iperoxo was much more potent than oxotremorine (pIC50 6.5–6.6). In hippocampal slices, N-ethylmaleimide (NEM) 32 μM, which inactivates Gi/o proteins, tended to shift the concentration-response curve of iperoxo (pIC50 8.8) to the right (pIC50 8.5) and depressed its maximum from 85 to 69%. In striatal slices, the inhibitory effect of iperoxo declined at concentrations higher than 0.1 μM, yielding a biphasic curve with a pIC50 of 8.6 for the falling part and a pEC50 of 6.4 for the rising part of the curve. The inhibitory effect of iperoxo 10 μM (47%) after NEM pre-treatment was lower by about 35% compared to the maximum (74%) obtained without NEM. In conclusion, our data, which need to be confirmed by pertussis toxin, might suggest that in the striatum, unlike the hippocampus, stimulatory Gs protein comes into play at high concentrations of a muscarinic receptor agonist.

The cannabinoid CB1 receptors on the noradrenergic neurons in guinea pig hippocampal slices show an endogenous endocannabinoid tone. This conclusion is based on rimonabant, the facilitatory effect of which on noradrenaline release might be due to its inverse CB1 receptor agonism and/or the interruption of a tonic inhibition elicited by endocannabinoids. To examine the latter mechanism, a neutral antagonist would be suitable. Therefore, we studied whether O-2050 is a neutral CB1 receptor antagonist in the guinea pig hippocampus and whether it mimics the facilitatory effect of rimonabant. CB1 receptor affinity of O-2050 was quantified in cerebrocortical membranes, using (3)H-rimonabant binding. Its CB1 receptor potency and effect on (3)H-noradrenaline release were determined in superfused hippocampal slices. Its intrinsic activity at CB1 receptors was studied in hippocampal membranes, using (35)S-GTPγS binding. Endocannabinoid levels in hippocampus were determined by liquid chromatography-multiple reaction monitoring. O-2050 was about ten times less potent than rimonabant in its CB1 receptor affinity, potency and facilitatory effect on noradrenaline release. Although not affecting (35)S-GTPγS binding by itself, O-2050 shifted the concentration-response curve of a CB1 receptor agonist to the right but that of rimonabant to the left. Levels of anandamide and 2-arachidonoyl glycerol in guinea pig hippocampus closely resembled those in mouse hippocampus. In conclusion, our results with O-2050 confirm that the CB1 receptors on noradrenergic neurons of the guinea pig hippocampus show an endogenous tone. To differentiate between the two mechanisms leading to an endogenous tone, O-2050 is not superior to rimonabant since O-2050 may increase the inverse agonistic effect of endocannabinoids.

Background The aim of our study was (1) the pharmacological characterization of EP 3 receptors in human pulmonary arteries and (2) the examination of the potential involvement of these receptors in the regulation of neurogenic tachycardia in pithed rats. L-826266 served as the EP3 receptor antagonist. Methods Experiments were performed on isolated human pulmonary arteries and pithed rats. Results The prostanoid EP 1 /EP 3 receptor agonist sulprostone (1 nM – 100 μM) concentration-dependently contracted isolated human pulmonary arteries (pEC 50 , 6.88 ± 0.10). The EP 1 receptor antagonist SC 19920 (100 μM) did not affect the vasoconstriction induced by sulprostone, the TP receptor antagonist sulotroban (10 μM) only slightly attenuated the effects elicited by sulprostone > 3 μM, whereas L-826266 (10 μM) shifted its concentration-response curve to the right (apparent pA 2 value 6.18; incubation time 0.5 h). In rings exposed to L-826266 (0.1,1 or 10 μM) for 3 h, a concentration-dependent inhibitory effect against the sulprostone-induced vasoconstriction was obtained, yielding a Schild plot-based pA 2 value of 7.39. In pithed rats, sulprostone (10 – 1,000 nmol/kg), but not the IP/EP 1 receptor agonist iloprost (1-100 nmol/kg), inhibited the electrically evoked increase in heart rate (HR) dosedependently, maximally by at least 80%. L-826266 (3 μmol/kg) did not affect basal HR and diastolic blood pressure, but reduced the inhibitory effect of sulprostone 1,000 nmol/kg by about 20%. Conclusion EP 3 receptors (1) located postsynaptically strongly contract human pulmonary arteries and (2) located presynaptically on sympathetic nerve fibers supplying the heart of pithed rats strongly inhibit the neurogenic tachycardia.

Intravenous (i.v.) injection of the endocannabinoid anandamide induces triphasic cardiovascular responses, including a pressor effect mediated via unknown central and peripheral mechanism(s). The aim of the present study was to determine the central mechanism(s) responsible for the pressor response to anandamide. For this purpose, the influence of antagonists at thromboxane A(2) TP (sulotroban, daltroban, SQ 29548), NMDA (MK-801) and beta(2)-adrenergic receptors (ICI 118551) on the pressor effect induced by i.v. and intracerebroventricularly (i.c.v.) administered anandamide was examined in urethane-anaesthetized rats. Anandamide (1.5-3 micromol/kg, i.v.) or its stable analogue methanandamide (0.75 micromol/kg, i.v.) increased blood pressure by 25%. Anandamide (0.03 mumol per animal i.c.v.) caused a pure pressor effect (by 20%) but only in the presence of antagonists of CB(1) and TRPV1 receptors. The effects of cannabinoids (i.v. or i.c.v.) were diminished by i.v. daltroban, sulotroban (10 mumol/kg each), and/or SQ 29548 (1 mumol/kg). The effect of anandamide i.v. was reduced by SQ 29548 (0.02 mumol per animal i.c.v.) and by the thromboxane A(2) synthesis inhibitor furegrelate i.c.v. (1.8 micromol per animal). ICI 118551, MK-801 (1 micromol/kg i.v. each), and bilateral adrenalectomy diminished the effect of anandamide i.c.v. Sulotroban (i.v.) failed to affect the response to anandamide (i.v.) in pithed rats, and anandamide and methanandamide did not bind to TP receptors in rat platelets. The present study suggests that central beta(2)-adrenergic, NMDA and thromboxane A(2) receptors are involved in the anandamide-induced adrenal secretion of catecholamines and their pressor effect in urethane-anaesthetized rats.

Prostaglandin E(2) (PGE(2)) and its analogue sulprostone inhibit noradrenaline and serotonin release in rodent tissues. We examined whether the receptor involved is blocked by the EP(3) antagonist L-826,266, whether such receptors also occur on central cholinergic neurones and retinal dopaminergic cells, whether PGE(2) is produced by the degradation of the endocannabinoid virodhamine and whether EP(3) receptor activation stimulates (35)S-GTPgammaS binding. Transmitter release was studied as electrically evoked tritium overflow in superfused tissues preincubated with (3)H-noradrenaline (which in the guinea pig retina labels dopaminergic cells), (3)H-serotonin or (3)H-choline. (35)S-GTPgammaS binding, a measure of G protein activation, was studied in mouse and guinea pig hippocampal membranes. L-826,266 antagonised the effect of sulprostone on noradrenaline release in the rat cortex, yielding a Schild plot-based pA(2) value of 7.56. Apparent pA(2) values in mouse cortex and rat vas deferens (noradrenaline release) and rat cortex (serotonin release) were 7.55, 7.87 and 7.67, respectively. PGE(2) did not affect acetylcholine release in rat brain and dopamine release in guinea pig retina. In seven mice tissues, noradrenaline release was inhibited by sulprostone but not affected by virodhamine. (35)S-GTPgammaS binding was not altered by sulprostone but stimulated by the cannabinoid agonist WIN 55,212-2. Prostaglandins of the E series inhibit monoamine release via EP(3) receptors at which L-826,266 is a competitive antagonist. EP(3) receptors that inhibit transmitter release are not present on central cholinergic neurones and retinal dopaminergic cells. Virodhamine is not converted to PGE(2). An EP(3) receptor model based on (35)S-GTPgammaS binding could not be identified.

Cannabinoids exert complex effects on blood pressure related to their interference with cardiovascular centres in the central nervous system and to their direct influence on vascular muscle, vascular endothelium and heart. In view of the relative lack of information on the occurrence of CB1 receptors on the vascular postganglionic sympathetic nerve fibres, the aim of the present study was to examine whether cannabinoid receptor ligands affect the electrically evoked tritium overflow in superfused vessels (tissue pieces) from the guinea-pig, the rat and the mouse preincubated with 3H-noradrenaline. The cannabinoid receptor agonist WIN 55,212-2 (R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]-pyrrolo[1,2,3-de]1,4-benzoxazinyl](1-naphthalenyl) methanone) inhibited the evoked tritium overflow in the guinea-pig aorta, but not in that of the rat or mouse. The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist rimonabant, yielding an apparent pA2 value of 7.9. The most pronounced (near-maximum) inhibition obtained at the highest WIN 55,212-2 concentration applied (3.2 microM) amounted to 40%. WIN 55,212-2 also inhibited the evoked overflow in guinea-pig pulmonary artery, basilar artery and portal vein, again in a manner sensitive to antagonism by rimonabant. The latter did not affect the evoked overflow by itself in the four vessels, but did increase the electrically evoked tritium overflow from superfused guinea-pig hippocampal slices preincubated with 3H-choline and from superfused guinea-pig retina discs preincubated with 3H-noradrenaline (labelling dopaminergic cells in this tissue). The inhibitory effect of 3.2 microM WIN 55,212-2 on the evoked overflow from the guinea-pig aorta was comparable in size to that obtained with agonists at the histamine H3, kappa opioid (KOP) and ORL1 (NOP) receptor (1 or 10 microM, producing the respective near-maximum effects) whereas prostaglandin E2 1 microM caused a higher near-maximum inhibition of 70%. Prostaglandin E2 also induced an inhibition by 65 and 80% in the rat and mouse aorta respectively, indicating that the present conditions are basically suitable for detecting presynaptic receptor-mediated inhibition of noradrenaline release. The results show that the postganglionic sympathetic nerve fibres in the guinea-pig aorta, but not in the rat or mouse aorta, are endowed with presynaptic inhibitory cannabinoid CB1 receptors; such receptors also occur in guinea-pig pulmonary artery, basilar artery and portal vein. These CB1 receptors are not subject to an endogenous tone and the extent of inhibition obtainable via these receptors is within the same range as that of several other presynaptic heteroreceptors, but markedly lower than that obtainable via receptors for prostaglandin E2.

We examined whether replacement of imidazole by a piperidine or pyrrolidine moiety will affect the potency and affinity of six H3-receptor antagonists. Potencies were determined in superfused mouse brain cortex slices preincubated with [3H]noradrenaline, in which the interaction of the antagonists with histamine with respect to its inhibitory effect on the electrically evoked tritium overflow was studied. Affinities were determined in mouse brain cortex membranes, using the radioligand [3H] N(alpha)-methylhistamine. The concentration-response curve of histamine for its effect on the evoked overflow from mouse brain cortex slices was shifted to the right by the 13 compounds under study. Replacement of the imidazole by a piperidine ring affected the p A2 value as follows: thioperamide, -2.7 log units; clobenpropit, -1.9; proxyfan, -1.3; FUB 138, -1.2. Potency hardly changed (or =0.4 log units) when imidazole was replaced by piperidine in FUB 181 and by piperidine or pyrrolidine in FUB 153. Binding of [3H] N (alpha)-methylhistamine to mouse brain cortex membranes was inhibited monophasically by all compounds. The p K(i) values closely matched their p A2 values with three exceptions. The p K(i) values of proxyfan, FUB 138, and FUB 153 exceeded their respective p A(2) values by about 1 log unit. To reveal a potential partial agonism, the effect of the three drugs on (1) the electrically evoked tritium overflow and (2) [35S]GTPgammaS binding in mouse cortex preparations was determined. Proxyfan proved to be a partial agonist in both models (with intrinsic activities of 0.2 and 0.3, respectively) whereas FUB 138 and FUB 153 were devoid of agonistic effects. In conclusion, replacement of imidazole by piperidine or pyrrolidine affects the antagonist potencies of six H3-receptor antagonists in a very different manner. The piperidine analogue of FUB 181 (with a p A2 value as high as 7.7) may represent a lead for the development of non-imidazole H3-receptor antagonists. The discrepancy between the p K(i) and p A2 values may be accounted for by partial agonism in the case of proxyfan but can, at present, not be satisfactorily explained with respect to FUB 138 and FUB 153.

We studied the effects of nociceptin, the endogenous ligand of the opioid OP4 receptor, and of two cannabinoid receptor agonists WIN 55,212-2 and CP-55,940 (0.001-1 micromol/kg each) on the neurogenic tachycardia and bradycardia in pithed rats. Electrical stimulation (1 Hz, 1 ms, 50 V for 10 s) of the preganglionic sympathetic nerve fibres and injection of nicotine 2 micromol/kg or isoprenaline 0.5 nmol/kg increased heart rate by about 70 beats/min (bpm) in pithed rats pretreated with atropine 1.5-2 micromol/kg. The electrically induced tachycardia was reduced dose dependently by nociceptin, WIN 55,212-2 and CP-55,940 (by 60, 30 and 20% at the highest dose, respectively). The OP4 and cannabinoid receptor agonists diminished the nicotine- but not the isoprenaline-stimulated increase in heart rate. In pithed rats pretreated with propranolol 3 micromol/kg, vagal stimulation (5 Hz, 1 ms, 15 V for 10 s) or injection of methacholine (5-10 nmol/kg) decreased heart rate by about 30 bpm. Nociceptin, but not WIN 55,212-2 or CP-55,940 decreased the vagal bradycardia dose dependently (the inhibitory effect of 1 micromol/kg was about 40%). Nociceptin failed to modify the methacholine-induced decrease in heart rate. The OP4 receptor antagonists naloxone benzoylhydrazone 5 micromol/kg and/or [Phe1Psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 0.7 micromol/kg, but not the OP(1-3) receptor antagonist naloxone 10 micromol/kg, diminished the inhibitory action of nociceptin on the neurogenic tachycardia and bradycardia. The inhibitory effect of both cannabinoid receptor agonists on the neurogenic tachycardia was abolished by the CB1 receptor antagonist SR 141716 0.1 micromol/kg. The present data suggest that the postganglionic sympathetic nerve fibres innervating the rat heart are endowed with presynaptic opioid OP4 and cannabinoid CB1 receptors, activation of which inhibits the neurogenic tachycardia. The parasympathetic nerve fibres innervating the heart and causing bradycardia are endowed with presynaptic opioid OP4 but not cannabinoid receptors.

Clenbuterol, a lipophilic beta2-adrenoceptor agonist, was investigated in various seizure models of experimental epilepsy. In the maximal electroshock seizure threshold test, clenbuterol (> or =4 mg/kg i.p.) increased the electroconvulsive threshold for tonic seizures in mice. In the traditional maximal electroshock seizure (MES) test in mice, ED50 values of 11 mg/kg i.p. or s.c. were determined. In both models, the beta2-receptor antagonist ICI 118.551 did not antagonize the anticonvulsant activity of clenbuterol. Combinations of clenbuterol with standard antiepileptics revealed additive anticonvulsant effects. Repeated administration of clenbuterol (5 mg/kg s.c., twice daily for 14 days) to mice did not significantly influence its anticonvulsant potency or the effectiveness of phenobarbital in the MES test. In various chemically-induced seizure tests with tonic convulsions, clenbuterol inhibited or tended to suppress the tonic phase. However, this drug was not effective in preventing clonic seizures in the pentylenetetrazol (85 mg/kg s.c.) seizure threshold test. In the rotarod ataxia test (mice), a minimal "neurotoxic" dose (TD50) of 41 mg/kg i.p. was determined. In unrestrained rats with chronically implanted electrodes in the dorsal hippocampus, clenbuterol (2 mg/kg and 4 mg/kg i.p.) significantly reduced the duration of electrically evoked hippocampal afterdischarges. In amygdala-kindled rats, clenbuterol (5 mg/kg and 10 mg/kg i.p.) reduced the seizure severity to stage 3. Additional studies indicated that clenbuterol (6 mg/kg i.p.) increased the heart rate and decreased the blood pressure, but this drug did not alter the plasma level of the two tested antiepileptics phenobarbital and carbamazepine. Furthermore, in whole-cell voltage-clamp experiments on cultured neonatal rat cardiomyocytes, clenbuterol (1-100 microM) depressed the fast sodium current in a concentration- and frequency-dependent manner. In conclusion, the anticonvulsant effects of higher doses of clenbuterol against generalized tonic-clonic and complex partial seizures seem to be related to the inhibition of voltage-dependent sodium channels and not to the modulation of beta-adrenoceptors.

Cannabinoid CB1 receptors occur as presynaptic receptors producing inhibition of neurotransmitter release. To elucidate their physiological role, experiments on tissues from CB1 receptor knockout mice would be helpful. We studied whether CB1 receptor-mediated inhibition of acetylcholine release is detectable in the brain of NMRI mice and of CD-1 and C57BL/6J mice (the latter two strains representing the wild-type strains of the two CB1 receptor knockout mouse models). Brain slices preincubated with [3H]choline were superfused and tritium overflow was evoked electrically (3 Hz) or by introduction of Ca2+ into Ca2+-free K+-rich medium (35 mM) containing tetrodotoxin. The eletrically evoked tritium overflow from NMRI mouse hippocampal slices was inhibited (maximally by 60%) by the cannabinoid receptor agonists CP-55,940 and WIN 55,212-2 but not affected by WIN 55,212-3 (the inactive enantiomer of WIN 55,212-2; pEC50=7.9, 7.4 and5.5). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2=8.6). Compared to hippocampal slices from NMRI mice, WIN 55,212-2 1 microM inhibited the electrically evoked overflow (1) from cortical slices from NMRI mice to a lesser extent and from striatal slices not at all, (2) from hippocampal slices from CD-1 and C57BL/6J mice to an identical extent and (3) from hippocampal slices from Sprague-Dawley rats to at least the same extent. SR 141716 0.32 microM abolished the effect of WIN 55,212-2 1 microM in hippocampal slices from NMRI, CD-1 and C57BL/6J mice and in cortical slices from NMRI mice. The electrically evoked tritium overflow from NMRI mouse hippocampal slices was also inhibited by the muscarinic receptor agonist oxotremorine (maximum effect of 85%; pEC50=6.5) and this effect was antagonized by the muscarinic receptor antagonist AF-DX 384 (apparent pA2=8.3). The Ca2+-evoked tritium overflow from NMRI mouse hippocampal slices was inhibited by WIN 55,212-2 in a manner sensitive to SR 141716. In conclusion, the cholinergic axon terminals of the NMRI mouse hippocampus are endowed with presynaptic CB1 receptors. Such receptors are also detectable in the hippocampus of CD-1 and C57BL/6J mice. The maximum extent of the CB1 receptor-mediated inhibition of acetylcholine release is lower than the maximum effect mediated via the autoreceptor.

We studied whether serotonin release in the CNS is inhibited via cannabinoid receptors. In mouse brain cortex slices preincubated with [3H]serotonin and superfused with medium containing indalpine and metitepine, tritium overflow was evoked either electrically (3 Hz) or by introduction of Ca2+ (1.3 mM) into Ca2+-free K+-rich (25 mM) medium containing tetrodotoxin. The effects of cannabinoid receptor ligands on the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline and on the binding of [3H]WIN 55,212-2 and [35S]GTPgammaS to mouse brain cortex membranes were examined as well. In superfused mouse cortex membranes preincubated with [3H]serotonin, the electrically evoked tritium overflow was inhibited by the cannabinoid receptor agonist WIN 55,212-2 (maximum effect of 20%, obtained at 1 microM; pEC50=7.11) and this effect was counteracted by the CB1 receptor antagonist SR 141716 (apparent pA2=8.02), which did not affect the evoked tritium overflow by itself. The effect of WIN 55,212-2 was not shared by its enantiomer WIN 55,212-3 but was mimicked by another cannabinoid receptor agonist, CP-55,940. WIN 55,212-2 also inhibited the Ca2+-evoked tritium overflow and this effect was antagonized by SR 141716. Concentrations of histamine, prostaglandin E2 and neuropeptide Y, causing the maximum effect at their respective receptors, inhibited the electrically evoked tritium overflow by 33, 69 and 73%, respectively. WIN 55,212-2 (1 microM) inhibited the electrically evoked tritium overflow from mouse brain cortex slices preincubated with [3H]choline by 49%. [3H]WIN 55,212-2 binding to mouse cortex membranes was inhibited by CP-55,940, SR 141716 and WIN 55,212-2 (pKi=9.30, 8.70 and 8.19, respectively) but not by the auxiliary drugs indalpine, metitepine and tetrodotoxin (pKi

Nociceptin (or orphanin FQ), the endogenous ligand for the opioid receptor-like 1 (ORL1) receptor, decreases blood pressure in the conscious and anesthetized rat. This study examined whether prejunctional inhibitory ORL1 receptors located on the postganglionic sympathetic neurons innervating the resistance vessels are detectable in pithed rats. In pithed and vagotomized rats electrical stimulation of the preganglionic sympathetic nerve fibers, injection of nicotine (2 micromol/kg) or noradrenaline (1 nmol/kg) increased blood pressure by about 30 mmHg. The electrically induced vasopressor response was decreased dose-dependently by nociceptin (0.001-1 micromol/kg; decrease by about 60% at 1 micromol/kg). Nociceptin 0.1 micromol/kg reduced the nicotine-induced vasopressor response by about 40% but at doses up to 1 micromol/kg failed to affect the increase in blood pressure evoked by noradrenaline. The inhibitory action of nociceptin on the electrically and nicotine-induced increase in blood pressure was attenuated by the ORL1 receptor antagonists naloxone benzoylhydrazone (5 micromol/kg) and/or [Phe1psi(CH2-NH)Gly2]-nociceptin(1-13)NH2 (1 micromol/kg) but was not affected by naloxone 10 micromol/kg. In conclusion, the present data suggest that the postganglionic sympathetic nerve fibers innervating the resistance vessels of the rat are endowed with prejunctional ORL1 receptors, activation of which causes inhibition of noradrenaline release.

We have studied (i) the effect of antisense oligodeoxynucleotides complementary to CB1 mRNA on the CB1 receptor binding in hippocampus, striatum and cerebral cortex of the rat; (ii) the possible mechanism of action of one of the antisense oligodeoxynucleotides; and (iii) its effect on two functional CB1 receptor-mediated effects. Synthetic oligodeoxynucleotides or saline were administered to male Wistar rats by the intracerebroventricular (i.c.v.) route twice daily for 3 days. Antisense oligodeoxynucleotides corresponding to the nucleotides 4 to 21 (AS1; GCCATCTAGGATCGACTT) and -8 to 12 (AS2; GATCGACTTCATAACCTCAG) and a mismatch oligodeoxynucleotide differing from AS1 in 6 positions (MM; TCCAGCTACTATGGACTG) were used. The dissociation constant (K(D)) of rat CB1 cannabinoid receptors, labelled by the radioligand [3H]-SR141716, did not differ in membranes from rats treated with saline, AS , AS2 or MM. The density of receptor binding (Bmax) was reduced by the antisense oligodeoxynucleotides, 10nmol, in the hippocampus (AS 1, -40%; AS2, -20%) and striatum (AS1, -29%; AS2 -6%), but not in the cerebral cortex. When the dose of AS1 was raised to 30 nmol, the reduction of Bmax in the hippocampus and striatum was only marginally increased; a dose of 3nmol of AS1 reduced Bmax in both brain regions by somewhat more than the half-maximum effect. The mismatch oligodeoxynucleotide MM (3-30nmol) did not affect Bmax. In the second part of the study, RNA obtained from the three brain regions of rats pretreated with AS1 10 nmol, MM 10 nmol or saline was analyzed using reverse transcription-polymerase chain reaction of CB1 receptor mRNA and of beta-actin mRNA levels (used as reference value). The ratio of CB1 receptor mRNA over beta-actin mRNA after treatment with AS1 did not differ from the ratios following treatment with saline or MM in the hippocampus, striatum and cerebral cortex. Finally, pretreatment with antisense oligodeoxynucleotide AS1 30nmol attenuated two functional effects via CB1 receptors, i.e., the facilitatory effect of WIN 55,212-2 on [35S]-GTPgammaS binding in rat hippocampus membranes and the inhibitory effect of WIN 55,212-2 on acetylcholine release in rat hippocampus slices. In conclusion, (i) two antisense oligodeoxynucleotides reduce the density of CB1 receptors in the rat hippocampus and striatum after i.c.v. administration. (ii) The effect of the antisense oligodeoxynucleotide AS1 does not appear to be related to breakdown of CB1 receptor mRNA. (iii) Pretreatment with AS1 attenuated the CB1 receptor-mediated effect in two functional models.

Selective H2- and H3-receptor agonists, exhibiting an at least tenfold higher potency than histamine itself at the respective receptors, have been known for several years. Selective H1-receptor agonists with a potency exceeding that of histamine have become available only recently; the most potent are methylhistaprodifen and dimethylhistaprodifen [Nalpha-methyl- and Nalpha,Nalpha-dimethyl-2(3,3-diphenylpropyl)histamine, respectively] with 3.4- and 2.4-fold higher potencies than histamine in vitro (in the guinea-pig ileum). The aim of the present study was to examine whether these compounds and the parent compound histaprodifen are potent H1-receptor agonists in the pithed and in the anaesthetized rat. In pithed, vagotomized rats diastolic blood pressure was decreased by 2-(2-thiazolyl)ethanamine i.v. (which was used as a reference H1-receptor agonist) and by histaprodifen, methylhistaprodifen, and dimethylhistaprodifen; the maximum decrease was about 45 mmHg for each compound, and the potencies, expressed as pED50, the negative logarithm of the dose (in mole per kilogram body weight) eliciting a half-maximal response, were 7.23, 7.55, 8.43 and 8.12, respectively. The dose/response curves of the four compounds were shifted to the right to about the same extent by the H1-receptor antagonist dimetindene (1 micromol/kg i.v.). The vasodepressor response was not affected by combined i.v. administration of the H2- and H3-receptor antagonists ranitidine and thioperamide, by combined i.v. administration of the alpha1- and alpha2-adrenoceptor antagonists prazosin and rauwolscine, and by the beta-adrenoceptor antagonist propranolol i.v. but was attenuated by the inhibitor of NO synthase, N(omega)-nitro-L-arginine methyl ester i.v. In anaesthetized rats 2-(2-thiazolyl)ethanamine, histaprodifen, methylhistaprodifen and dimethylhistaprodifen i.v. also decreased diastolic blood pressure in a manner sensitive to dimetindene i.v. Our data show that histaprodifen and, in particular, methyl and dimethylhistaprodifen are highly potent H1-receptor agonists in vivo.

The effect of histamine and related drugs on the tritium overflow evoked electrically (0.3 Hz) or by introduction of Ca2+ ions into Ca2+-free K+-rich (25 mmol/l) medium containing tetrodotoxin was studied in superfused guinea-pig brain cortex, cerebellum, hippocampus or hypothalamus slices and in mouse brain cortex slices preincubated with 3H-noradrenaline. The electrically evoked tritium overflow in guinea-pig cortex slices was inhibited by histamine; the H3 receptor antagonist clobenpropit reversed the effect of histamine to a slight facilitation. The facilitatory effect of histamine (obtained in the presence of clobenpropit) was not affected by the H1 receptor antagonist mepyramine but abolished by the H2 receptor antagonist ranitidine. In the absence of clobenpropit, ranitidine augmented the inhibitory effect of histamine. In slices superfused in the presence of ranitidine, the evoked overflow was inhibited by histamine and, more potently, by the H3 receptor agonist R-alpha-methylhistamine in a concentration-dependent manner (maximum inhibitory effect obtained for both agonists 30-35%). The concentration-response curve of histamine was shifted to the right by the H3 receptor antagonist thioperamide. R-alpha-methylhistamine inhibited the electrically evoked tritium overflow also in guinea-pig cerebellar, hippocampal and hypothalamic slices. In cortex slices superfused in the presence of clobenpropit, the H2 receptor agonists impromidine and, less potently, R-sopromidine facilitated the evoked overflow in a concentration-dependent manner. S-Sopromidine only tended to increase the evoked overflow. The effect of impromidine was counteracted by the H2 receptor antagonists ranitidine and cimetidine. The extent of the maximum facilitatory effect of impromidine (by 15-20%) was about the same when (i) the Ca2+ concentration in the medium was reduced from 1.3 to 0.98 mmol/l, (ii) the time of exposure to impromidine was reduced from 28 to 8 min or (iii) cerebellar, hippocampal or hypothalamic slices were used instead of cortical slices. The Ca2+-induced tritium overflow in guinea-pig cortex slices was inhibited by histamine (in the presence of ranitidine); this effect was abolished by clobenpropit. In slices superfused in the presence of clobenpropit, impromidine failed to facilitate the Ca2+-evoked tritium overflow. The electrically evoked tritium overflow in mouse brain cortex slices was inhibited by histamine by about 60% (both in the absence or presence of ranitidine). The inhibitory effect of histamine was abolished (but not reversed) by clobenpropit. In conclusion, noradrenaline release in the guinea-pig brain cortex is inhibited via presynaptic H3 receptors and facilitated via H2 receptors not located presynaptically. In the mouse brain cortex, only inhibitory H3 receptors occur. The extent of the H3 receptor-mediated effect is more marked in the mouse than in the guinea-pig brain cortex.

Human cerebral cortical slices and synaptosomes, guinea-pig cerebral cortical slices and human right atrial appendages were used to study the effects of SB-216641, a preferential h5-HT1B receptor ligand, and of BRL-15572, a preferential h5-HT1D receptor ligand, on the presynaptic h5-HT1B and h5-HT1B-like autoreceptors in the human and guinea-pig brain preparations, respectively, and on the presynaptic h5-HT1D heteroreceptors in the human atrium. The brain preparations, preincubated with [3H]serotonin ([3H]5-HT), and the segments of atrial appendages, preincubated with [3H]noradrenaline, were superfused with modified Krebs' solution and tritium overflow was evoked electrically (human and guinea-pig cerebral cortex slices and human atrial appendages) or by high K+ (human cerebral cortex synaptosomes). The electrically evoked tritium overflow from guinea-pig cerebral cortex slices was reduced by the 5-HT receptor agonist 5-carboxamidotryptamine (5-CT). This effect was not modified by BRL-15572 (2 microM; concentration 154 times higher than its Ki at h5-HT1D receptors) but was antagonized by SB-216641 (0.1 microM; concentration 100 times higher than its Ki at h5-HT1B receptors; apparent pA2 8.45). SB-216641 (0.1 microM) by itself facilitated, whereas BRL-15572 (2 microM) did not affect, the evoked overflow. In human cerebral cortex slices SB-216641 (0.1 microM) also facilitated, and BRL-15572 (2 microM) again failed to affect, the electrically evoked tritium overflow. In human cerebral cortical synaptosomes, 5-CT reduced the K+-evoked tritium overflow. This response was unaffected by BRL-15572 (300 nM) but antagonized by SB-216641 (15 nM; drug concentrations 23 and 15 times higher than their Ki at h5-HT1D and h5-HT1B receptors, respectively). Both drugs, given alone, did not modify the K+-evoked tritium overflow. In human atrial appendages, the electrically evoked tritium overflow was inhibited by 5-HT in a manner susceptible to antagonism by BRL-15572 (300 nM; 23 times Ki at h5-HT1D receptors) but not by SB-216641 (30 nM; 30 times Ki at h5-HT1B receptors). Both drugs by themselves did not change the electrically evoked tritium overflow. In conclusion, SB-216641 behaves as a preferential antagonist at native human 5-HT1B receptors and BRL-15572 as a preferential antagonist at native human 5-HT1D receptors. These compounds are clearly useful tools for the differentiation between human 5-HT1B and 5-HT1D receptors in functional studies.

The effects of two cannabinoid receptor agonists, R(+)-[2,3-dihydro-5-methyl-3-[(morpholinyl)methyl]pyrrolo[1,2,3-de]-1,4- benzoxazin-yl]-(1-naphthalenyl)-methanone (WIN 55,212-2) and (-)-cis-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-trans-4-(3-hydr oxypropyl)-cyclohexanol (CP-55,940), were studied on (i) the vasopressor response elicited in pithed rats by electrical stimulation of the sympathetic outflow and (ii) the release of 3H-noradrenaline and the vasoconstriction elicited in isolated rat tail arteries by transmural electrical stimulation. In pithed rats, the electrical (1 Hz for 10 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 30 mmHg. This neurogenic vasopressor response (which under the conditions of our study was almost exclusively due to the release of catecholamines) was decreased by WIN 55-212,2 and CP-55,940 in a dose-dependent manner (inhibition by WIN 55,212-2 and CP-55,940, 0.1 micromol/kg each, about 25-30%). The inhibition was identical in adrenalectomized rats and in animals with intact adrenals. The inhibitory action of WIN 55,212-2 and CP-55,940 was abolished by a dose of 0.03 micromol/kg of the CB1 receptor antagonist N-piperidino-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-3-pyrazo le-carboxamide (SR 141716), which, by itself, had no effect. WIN 55,212-2, CP-55,940 and SR 141716 failed to affect the vasopressor response to exogenous noradrenaline (1 nmol/kg), which also increased diastolic blood pressure by about 30 mmHg. In isolated rat tail arteries, the electrically (0.4 Hz) evoked tritium overflow and vasoconstriction were not modified by WIN 55,212-2 and CP-55,940 (1 micromol/l each). In conclusion, the neurogenic vasopressor response in the pithed rat can be modulated via cannabinoid CB1 receptors probably located presynaptically on the postganglionic sympathetic nerve fibres innervating resistance vessels.

Our previous results demonstrate the occurrence of presynaptic inhibitory histamine H3 receptors on sympathetic neurons innervating resistance vessels of the pithed rat. The present study, in which new H3 receptor ligands with increased potency and selectivity (imetit, clobenpropit) were used, was designed to further explore the role of H3 receptors in the regulation of the rat cardiovascular system. In particular we were interested whether these receptors may be activated by endogenous histamine and whether they are detectable in an experimental model of hypertension. All experiments were performed on pithed and vagotomized rats treated with rauwolscine 1 mumol/kg. In normotensive Wistar rats the electrical (1 Hz, 1 ms, 50 V for 20 s) stimulation of the preganglionic sympathetic nerve fibres increased diastolic blood pressure by about 35 mmHg. Two H3 receptor agonists, R-(-)-alpha-methylhistamine and imetit, inhibited the electrically induced increase in diastolic blood pressure in a dose-dependent manner. The maximal effect (about 25%) was obtained for R-(-)-alpha-methylhistamine at about 10 mumol/kg and for imetit at about 1 mumol/kg. Two H3 receptor antagonists, thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg, attenuated the inhibitory effect of imetit. The neurogenic vasopressor response was increased by about 15% by thioperamide 1 mumol/kg and clobenpropit 0.1 mumol/kg and decreased by 25% by the histamine methyltransferase inhibitor metoprine 37 mumol/kg. R-(-)-alpha-Methylhistamine, imetit, thioperamide, clobenpropit and metoprine did not affect the vasopressor response to exogenously added noradrenaline 0.01 mumol/kg (which increased diastolic blood pressure by about 40 mmHg). Metoprine had only a very low affinity for H3 binding sites (labelled by 3H-N alpha-methylhistamine; pKi 4.46). In pithed Wistar Kyoto (WKY) and spontaneously hypertensive (SHR) rats, electrical (1 Hz, 1 ms, 50 V for 10 s) stimulation increased diastolic blood pressure by 28 and 37 mmHg, respectively. Imetit inhibited the neurogenic vasopressor response to about the same extent in WKY and SHR rats (maximal effect of about 30%). The inhibitory influence of imetit was diminished by thioperamide 1 mumol/kg to about the same degree in rats of either strain. The present study confirms the occurrence of presynaptic H3 receptors on sympathetic nerve fibres involved in the inhibition of the neurogenic vasopressor response. Moreover, it demonstrates that these H3 receptors are probably activated by endogenous histamine and appear to be operative in hypertension.

The possible occurrence of cannabinoid (CB) receptors was studied on superfused guinea-pig retinal discs preincubated with [3H]dopamine or [3H]noradrenaline. Tritium overflow was evoked either electrically (3 Hz) or by re-introduction of Ca2+ 1.3 mM after superfusion with Ca(2+)-free medium containing K+ 30 mM. The accumulation of [3H]dopamine ([3H]DA) and [3H]noradrenaline ([3H]NA) was inhibited by the selective inhibitor of the neuronal dopamine transporter GBR-12909 (pIC50% 7.29 and 7.41, respectively) but not by the selective inhibitor of the neuronal noradrenaline transporter desipramine (1 microM). The electrically or Ca(2+)-evoked tritium overflow in retinal discs preincubated with [3H]DA or [3H]NA was reduced by the CB receptor agonists CP-55,940 and WIN 55,212-2 (pIC50% in discs preincubated with [3H]NA, electrical stimulation: 7.03 and 6.70, respectively) but not affected by the inactive S(-)enantiomer of the latter, WIN 55,212-3 (up to 10 microM). The concentration-response curve of WIN 55,212-2 was shifted to the right by the CB1 receptor antagonist SR 141716 (apparent pA2: 8.29) which, by itself, increased the evoked overflow. The facilitatory effect of SR 141716 was not affected by GBR-12909 and the dopamine receptor antagonist haloperidol. In conclusion, the dopaminergic neurones of the guinea-pig retina can be labelled by both [3H]DA and [3H]NA. Transmitter release from the dopaminergic neurones is inhibited by activation of cannabinoid receptors of the CB1 type, which appear to be tonically activated by an endogenous CB receptor ligand.

It was the aim of the present study to determine the affinities of four neuroleptics and five antidepressants for histamine H3 receptors. In rat brain cortex membranes, the specifically bound [3H]-N alpha-methylhistamine was monophasically displaced by clozapine (pKi 6.15). The other drugs did not completely displace the radioligand even at 100 microM; the pKi values were: haloperidol (4.91); sulpiride (4.73); amitriptyline (4.56); desipramine (4.15); levomepromazine (4.14); fluovoxamine (4.13); maprotiline (4.09); moclobemide (< 4.0). The effect of clozapine was further examined in a functional H3 receptor model, i.e., in superfused mouse brain cortex slices preincubated with [3H]-noradrenaline. The electrically evoked tritium overflow was not affected by clozapine 0.5-32 microM. However, clozapine shifted the concentration-response curve of histamine for its inhibitory effect on the evoked overflow to the right, but did not affect the maximum effect of histamine. The Schild plot yielded a pA2 value of 6.33. In conclusion, clozapine shows an intermediate affinity and potency (as a competitive antagonist) at H3 receptors. The Ki value of clozapine at H3 receptors resembles its Ki value at D2 receptors (the target of the classical neuroleptics), but is higher than its Ki values at D4, 5-HT2 or muscarinic acetylcholine receptors, which according to current hypotheses, might be involved in the atypical profile of clozapine.

The human saphenous vein was used to examine whether presynaptic histamine receptors can modulate noradrenaline release and, if so, to determine their pharmacological characteristics. Strips of this blood vessel were incubated with [3H]noradrenaline and subsequently superfused with physiological salt solution containing desipramine and corticosterone. Electrically (2 Hz) evoked 3H overflow was inhibited by histamine and the H3 receptor agonist R-(-)-alpha-methylhistamine. Histamine-induced inhibition of electrically evoked tritium overflow was not affected by alpha 2-adrenoceptor blockade by rauwolscine. S-(+)-alpha-methylhistamine (up to 10 mumol/l) as well as the histamine H1 and H2 receptor agonists 2-(2-thiazolyl)ethylamine (up to 3 mumol/l) and dimaprit (up to 30 mumol/l), respectively, were ineffective. The selective histamine H3 receptor antagonist thioperamide abolished the inhibitory effect of histamine. The histamine H2 and H1 receptor antagonists ranitidine and pheniramine, respectively, did not affect the histamine-induced inhibition of evoked tritium overflow. The present results are compatible with the suggestion that the sympathetic nerves of the human saphenous vein are endowed with inhibitory presynaptic histamine receptors of the H3 class.

Mouse brain cortex slices preincubated with3H-noradrenaline were superfused and the effect of histamine on the electrically (0.3 or 3 Hz) evoked tritium overflow was examined. The evoked overflow was inhibited by histamine and R-(−)-α-methylhistamine but not by 2-(2-thiazolyl)ethylamine and dimaprit. The effect of histamine was antagonized by thioperamide but not by dimethindene and ranitidine. The degree of inhibition produced by histamine was more marked at 0.3 than at 3 Hz and was attenuated by the α2-adrenoceptor agonist talipexole (the former B-HT 920) but increased by phentolamine and the α2-adrenoceptor antagonist rauwolscine. Pre-exposure of slices toN-ethylmaleimide attenuated the inhibitory effect of histamine. The results suggest that histamine inhibits nordrenaline release in the mouse brain cortex via H3 receptors which interact with presynaptic α2-adrenoceptor and may be coupled to a G (e.g. Gi or Go) protein. The extent of H3 receptor-mediated inhibition of nordrenaline release in the mouse brain is more marked than that in the rat brain.

Brain cortex slices were preincubated with 3H-noradrenaline and superfused with physiological salt solution containing desipramine. We studied the inhibition of the electrically evoked tritium overflow caused by histamine in the presence of α-adrenoceptor ligands (mouse and rat brain cortex), and the inhibition caused by talipexole (the former B-HT 920) in the presence of H3-receptor ligands (mouse brain cortex). In mouse brain cortex slices, the inhibitory effect of histamine on the tritium overflow evoked by 36 pulses, 0.3 Hz was not changed by the α1-adrenoceptor antagonist prazosin, but increased by the α2-adrenoceptor antagonist rauwolscine. When the current strength or the duration of electrical pulses was reduced to compensate for the increase in evoked tritium overflow produced by rauwolscine, the latter still. enhanced the effect of histamine. The histamine-induced inhibition of tritium overflow evoked by 360 pulses, 3 Hz was not affected by the α1-adrenoceptor agonist phenylephrine but attenuated by the α2-adrenoceptor- agonist talipexole. Finally, the inhibition by histamine of the tritium overflow evoked by 3 pulses, 100 Hz was attenuated by talipexole but not affected by rauwolscine. Conversely,. the inhibitory effect of talipexole on tritium overflow elicited by 360 pulses, 3 Hz was slightly attenuated by the H3-receptor agonist R-(−)-α-methylhistamine but not, affected by the H3- receptor antagonist thioperamide. In rat brain cortex slices, histamine only tended to inhibit tritium overflow evoked by 360 pulses, 3 Hz, both in the absence of α-adrenoceptor antagonists and in the presence of prazosin. However, histamine markedly inhibited the evoked overflow in the presence of rauwolscine. Again, enhancement of the histamine-induced inhibition also occurred when the current strength or the duration of pulses was reduced in order to compensate for the increase in evoked tritium overflow produced by rauwolscine. The results suggest that the α2-autoreceptors and the H3-heteroreceptors at the noradrenergic nerve endings in the brain of mouse and rat interact with each other. Activation of the α2-autoreceptors decreases, whereas blockade of the activated (but not of the non-activated) α2-autoreceptors increases, the inhibitory effect of histamine. Activation of the H3-heteroreceptors slightly decreases, whereas blockade of the H3-receptors fails to affect, the inhibitory effect of talipexole.

The effects of neuropeptide Y (NPY), peptide YY (PYY), pancreatic polypeptide and of another four peptides on the electrically evoked 3H overflow were studied in superfused rat brain cortex slices preincubated with 3H-serotonin. In addition, we determined the effect of NPY on the Ca2(+)-induced 3H overflow from rat brain cortex slices and synaptosomes (preincubated with 3H-serotonin) and on the forskolin-stimulated accumulation of cAMP in a membrane fraction from rat brain cortex. The electrically (3 Hz) evoked 3H overflow was inhibited by PYY, NPY and pancreatic polypeptide (decreasing order of potency), but not affected by ACTH1-24, angiotensin II, bradykinin and delta-sleep-inducing peptide. The inhibitory effect of NPY did not change when the stimulation frequency was lowered to 1 Hz, but was markedly reduced at 10 Hz. The inhibitory effect of a presumably maximally active concentration of PYY was not altered in the presence of NPY or pancreatic polypeptide (effects not additive), whereas the inhibition produced by a maximally active concentration of the alpha 2-adrenoceptor agonist clonidine was further increased by NPY. NPY also inhibited (1) the tritium overflow, evoked by introduction of Ca2+, in slices superfused with Ca2(+)-free and K(+)-rich medium containing tetrodotoxin, (2) the tritium overflow, evoked by simultaneously increasing Ca2+ and K+ in the superfusion fluid of synaptosomes previously superfused with Ca2(+)-free medium and (3) the forskolin-stimulated accumulation of cAMP in rat brain cortex membranes. The present results suggest that NPY inhibits serotonin release in the rat brain via presynaptic NPY receptors, which are also activated by PYY and pancreatic polypeptide and may be negatively coupled to an adenylate cyclase.

The effect of the newly synthetized H1 agonists 2-(3-trifluoromethylphenyl)histamine (2-TFMPH) and 2-(3-bromophenyl)histamine (2-BPH) and of the reference compound 2-(2-thiazolyl)ethylamine (2-TEA) on diastolic blood pressure and heart rate was studied in pithed and vagotomized rats. 2-TFMPH and 2-BPH were at least equipotent with 2-TEA in producinga dimethindene-sensitive, short-lasting vasodepressor response. At the highest dose, 2-TFMPH and 2-BPH produced an additional small vasopressor response, which was followed by a long-lasting vasodepressor effect not counteracted by dimethindene and ranitidine 2-TEA, at the highest dose, induced an additional vasopressor response abolished by prazosin plus rauwolscine. Basal heart rate was increased by 2-TEA (in a desipramine-sensitive manner) but not affected by 2-TFMPH or 2-BPH. In conclusion, 2-TFMPH and 2-BPH are potent H1 agonists, devoid of an indirect sympathomimetic effect; at high doses, they produce a vasodepressor response not mediated via histamine receptors.

In pithed and vagotomized rats, the electrically induced vasopressor response was not affected by 2-(2-thiazolyl)ethylamine and dimaprit but was inhibited by Nα-methylhistamine (NαMH) in a thioperamidesensitive manner. NαMH did not affect the vasopressor response to exogenously added noradrenaline. NαMH produced a biphasic effect on basal diastolic blood pressure, i.e. a vasodepressor response (abolished by dimethindene plus ranitidine) and a subsequent vasopressor effect (counteracted by dimethindene or adrenalectomy). Basal heart rate was increased by NαMH (effect abolished by propranolol, dimethindene or adrenalectomy). In conclusion, presynaptic H3, but not H1 or H2, receptors are detectable in the resistance vessels of the rat. NαMH allows the characterization of another four histamine receptor-mediated effects, i.e vasodepressor effects mediated via H1 and H2 receptors and an increase in blood pressure and heart rate mediated via catecholamine-releasing H1, receptors in the adrenal medulla.

The endocannabinoid anandamide exerts complex effects on the cardiovascular system [Malinowska et al., Br J Pharmacol, 2011]. Thus, rapid intravenous injection of anandamide and its stable analogue methanandamide in anaesthetized rats and mice induces typical triphasic changes. Phase I, the so-called BezoldJarisch reflex, is characterized by a rapid bradycardia and hypotension associated with a decrease in cardiac contractility and an increase in total peripheral resistance. Phase II is a brief pressor response associated with an increase in cardiac contractility and blood flow in the mesenteric and renal arteries. Phase III comprises a prolonged (lasting up to 10 min) and marked decrease in blood pressure, mesenteric and renal blood flow, a marked decrease in cardiac contractility and a slight decrease in heart rate and total peripheral resistance. Phase I is mediated via vanilloid TRPV1 receptors since it was induced also by the TRPV1 receptor agonist capsaicin (but not by the CB1 receptor agonist CP55940), blocked by the TRPV1 receptor antagonists capsazepine and ruthenium red (but not by the CB1 receptor antagonist rimonabant) and absent in TRPV1 / mice. Phase II consists of a peripheral component that is most probably located in blood vessels, is sensitive to nifedipine, ruthenium red and pentobarbitone and, hence, probably represents a Ca-dependent mode of action and a central component. The paraventricular nucleus of the hypothalamus (PVN) may contribute to the latter since a pressor effect was obtained after injection of anandamide, methanandamide or CP55940 (intraventricularly or directly into the PVN). This effect only occurred when the peripheral CB1 receptors were blocked by administration of CB1 receptor antagonists, including AM6545 that does not reach the brain. It was sensitive to adrenalectomy and counteracted by antagonists of CB1, NMDA, thromboxane A2 and b2adrenergic receptors [AM251 (directly into the PVN), MK-801, SQ29548 and ICI118551, respectively] suggesting that the latter four receptors are involved in the events ultimately leading to the anandamide-induced adrenal secretion of catecholamines. Importantly, the hypotensive effect of intravenously administered CP55940 was reversed into a hypertensive one in the presence of AM6545 and both responses were abolished by chemical lesion of the PVN by kainic acid. Phase III is mediated mainly by presynaptic inhibitory CB1 receptors located on the postganglionic (although a preganglionic localization cannot be excluded) sympathetic nerve endings innervating resistance vessels and heart. The CB1 receptor antagonist-sensitive inhibitory effect of these receptors was detected after electrical stimulation of the preganglionic sympathetic nerve fibres in pithed rabbits or rats or following injection of nicotine but not phenylephrine/noradrenaline or isoprenaline (increasing blood pressure and heart rate, respectively). The prolonged hypotension might also be related to the activation of CB1 and/or vanilloid TRPV1 receptors in the spinal cord or to a direct vasodilatation via O-1918 sensitive receptors. In conscious rats anandamide and methanandamide induced a brief pressor (phase II) response connected with renal and mesenteric vasoconstriction and hindquarters vasodilatation. In addition, higher doses of anandamide elicited an initial bradycardia, hypotension and hindquarters vasoconstriction (phase I). However, unlike in anaesthetized rats, none of the cannabinoids led to a prolonged hypotension (phase III). Cardiovascular effects of anandamide are changed under pathophysiological conditions. Thus, in anaesthetized rats myocardial ischemia enhanced phase I and reduced phase III whereas hypertension enhanced phase III. Acknowledgement: B.M. and E.S. would like to express their gratitude to Professor Manfred Gothert for his continuous encouragement extending over a time period of decades.

The present study was aimed at the identification of mechanisms following the activation of histamine H3 receptors. Mouse brain cortex slices preincubated with 3H-noradrenaline were superfused and the (H3 receptor-mediated) effect of histamine on the electrically evoked tritium overflow was studied under a variety of conditions. The extent of inhibition produced by histamine was inversely related to the frequency of stimulation used to evoke tritium overflow and to the Ca2+ concentration in the superfusion medium. An activator (levcromakalim) and blocker (glibenclamide) of ATP-dependent K+ channels did not affect the electrically evoked tritium overflow and its inhibition by histamine. A blocker of voltage-sensitive K+ channels, tetraethylammonium (TEA), increased the evoked overflow and attenuated the inhibitory effect of histamine. TEA also reduced the inhibitory effect of noradrenaline and prostaglandin E2 on the evoked overflow. When the facilitatory effect of TEA on the evoked overflow was compensated for by reducing the Ca 2+ concentration in the superfusion medium, TEA did no longer attenuate the effect of histamine. Exposure of the slices to the SH group-alkylating agent N-ethylmaleimide increased the evoked overflow and attenuated the inhibitory effect of histamine; both effects were counteracted by the SH group-protecting agent dithiothreitol, which, by itself, did not affect the evoked overflow and its inhibition by histamine. Mouse brain cortex membranes were used to study the effect of the H3 receptor agonist R-(−)α-methylhistamine on the basal cAMP accumulation and on the accumulation stimulated by forskolin or noradrenaline. R-(−)-α-Methylhistamine did not affect basal cAMP accumulation but, at high concentrations, inhibited the forskolin- and noradrenaline-stimulated cAMP accumulation. S-(+)-α-Methylhistamine (which is 100 times less potent than R-(−)-α-methylhistamine at H3 receptors) was equipotent with the R-(−)-enantiomer in inhibiting the forskolin-stimulated CAMP accumulation. The inhibition by R-(−)-α-methylhistamine was not affected by the H3 receptor antagonist clobenpropit but was counteracted by the α2-adrenoceptor antagonist rauwolscine. The present results suggest that the histamine-induced inhibition of noradrenaline release depends on the availability of extracellular Ca2+ ions for stimulus-release coupling; in particular, a decrease in Ca 2+ influx into the varicosities may contribute to this inhibition. The H3 receptors (which may be coupled to a G protein) do not appear to be coupled to adenylate cyclase, to ATP-dependent K+ channels or to (TEA-sensitive) voltage-regulated K+ channels. α-Methylhistamine, in addition to its main action as a stereoselective H3 receptor agonist, proved to be weakly potent as an α2-adrenoceptor agonist.

In superfused rat brain cortex slices and synaptosomes preincubated with [3H]noradrenaline the effect of agonists or antagonists at presynaptic H3 receptors on NMDA-evoked [3H]noradrenaline release was investigated. In experiments on slices, histamine and the preferential H3 receptor agonist R-(-)-alpha-methylhistamine inhibited NMDA-evoked tritium overflow (IC20 values 0.27 mumol/l or 0.032 mumol/l, respectively); S-(+)-alpha-methylhistamine (up to 10 mumol/l) as well as the selective H1 receptor agonist (2-(2-thiazolyl)ethylamine and the selective H2 receptor agonist dimaprit (each up to 10 mumol/l) were ineffective. The H3 receptor antagonist thioperamide abolished the inhibitory effect of histamine whereas the preferential H1 receptor antagonist dimetindene and the preferential H2 receptor antagonist ranitidine were ineffective. In experiments on synaptosomes, histamine and R-(-)-alpha-methylhistamine inhibited NMDA-evoked tritium overflow, whereas 2-(2-thiazolyl)ethylamine or dimaprit had no effect. The inhibitory effect of histamine was abolished by thioperamide. When tritium overflow was stimulated by NMDA in the presence of omega-conotoxin GVIA (which by itself decreased the response to NMDA by about 55%), R-(-)-alpha-methylhistamine did not inhibit NMDA-evoked overflow. It is concluded that NMDA-evoked noradrenaline release in the cerebral cortex can be modulated by inhibitory H3 receptors. NMDA receptors and H3 receptors are both located presynaptically and may interact at the same noradrenergic varicosity. An unimpaired function of the N-type voltage-sensitive calcium channel probably is a prerequisite for the inhibition of NMDA-evoked noradrenaline release by H3 receptor stimulation.

In pithed and vagotomized rats the effects of the H3 receptor agonist R-(-)-alpha-methylhistamine, the H1 receptor agonist 2-(2-thiazolyl)ethylamine and the H2 receptor agonist dimaprit on basal diastolic blood pressure, basal heart rate and the electrically induced rise in heart rate were examined. Basal diastolic blood pressure was not altered by low, but increased by high doses of R-(-)-alpha-methylhistamine; the latter effect was not affected by selective H1, H2 or H3 receptor antagonists and by prazosin, but was attenuated by rauwolscine. Rauwolscine also unmasked a vasodepressor response to R-(-)-alpha-methylhistamine not affected by the H3 receptor antagonist thioperamide, but counteracted by the H1 receptor antagonist dimetindene or the H2 receptor antagonist ranitidine. The vasodepressor responses to 2-(2-thiazolyl)ethylamine and dimaprit were antagonized by dimetindene and ranitidine, respectively. The vasodepressor response to 2-(2-thiazolyl)ethylamine was not altered by indomethacin, but reduced by an inhibitor of endothelial nitric oxide synthase, N omega-nitro-L-arginine methyl ester (which, by itself, markedly increased blood pressure). Both drug tools did not alter the effect of dimaprit. Basal heart rate was not affected by 2-(2-thiazolyl)ethylamine (examined after administration of propranolol), dimaprit and R-(-)-alpha-methylhistamine. The electrically induced increase in heart rate (studied in animals which had received rauwolscine) was decreased by R-(-)-alpha-methylhistamine but not affected by 2-(2-thiazolyl)ethylamine and dimaprit. The effect of R-(-)-alpha-methylhistamine was abolished by thioperamide. R-(-)-alpha-methylhistamine did not influence the increase in heart rate produced by isoprenaline.(ABSTRACT TRUNCATED AT 250 WORDS)

Slices and synaptosomes from human cerebral cortex (which had to be removed to reach deeply located tumours) and, for comparison, synaptosomes from guinea-pig and rat cerebral cortex were preincubated with [3H]5-hydroxytryptamine and superfused with physiological salt solution containing an inhibitor of 5-hydroxytryptamine uptake. The effects of alpha-adrenoceptor agonists and antagonists on the electrically (slices) or potassium-evoked (synaptosomes) tritium overflow were studied. In human cerebral cortical slices, the electrically-evoked [3H] overflow was inhibited by noradrenaline (pIC25 value: 6.35); the non-selective alpha-adrenoceptor antagonist phentolamine, at a concentration of 0.32 mumol/l, strongly antagonized the inhibitory effect of noradrenaline (apparent pA2 value: 8.19) but did not affect the evoked overflow by itself. In synaptosomes from humans, guinea-pigs and rats, noradrenaline also inhibited the K(+)-evoked [3H] overflow in a concentration dependent manner; the alpha 2-adrenoceptor clonidine (1 mumol/l), but not the alpha 1-adrenoceptor agonist methoxamine (1 mumol/l), mimicked the effects of noradrenaline; the effect of noradrenaline (0.3 mumol/l) was abolished by the alpha 2-adrenoceptor antagonist idazoxan (0.5 mumol/l), but not by the alpha 1-adrenoceptor antagonist prazosin (1 mumol/l). It is concluded that release-inhibiting adrenoceptors of the alpha 2-subtype exist on 5-hydroxytryptamine terminals innervating the cerebral cortex in human and guinea-pig brain.

Rat brain cortex slices preincubated with 3H-noradrenaline were superfused with Krebs-Henseleit solution with or without Mg2+. In the absence of Mg2+ ions, NMDA evoked 3H-noradrenaline overflow above basal efflux; this effect was concentration-dependently inhibited by Mg2+ (IC50: 19 mumol/l). Despite the presence of 1.2 mmol/l Mg2+, which is known to block cation influx through the ion channel coupled to the NMDA receptor, NMDA evoked 3H-noradrenaline release if the membrane was permanently kept depolarized by 20 or 25 mmol/l K+, 1 mumol/l veratridine or 200 mumol/1 3,4-diaminopyridine; the stimulant effect of NMDA was counteracted by 2-amino-5-phosphonovaleric acid (2-APV), a competitive antagonist at the NMDA receptor and by (+)-5-methyl-10,11-dihydro-5H-dibenzo(a,d)cyclohept-5,10-imine hydrogen maleate (MK 801), an antagonist acting at the cation channel associated with the NMDA receptor. In contrast, no stimulatory effect of NMDA in the presence of 1.2 mmol/l Mg2+ was observed when the membrane of the nerve terminals was intermittently depolarized by electrical impulses of 2 ms duration at a frequency of 1-3 Hz. It is concluded that continuous depolarization of the nerve membrane counteracts the blocking effect of Mg2+ on cation influx through the NMDA receptor-associated ion channel. Under this condition, noradrenaline release can be stimulated by NMDA receptor activation even in the presence of physiological Mg2+ concentrations.

The effects of histamine, thioperamide and EEDQ (N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline) at the noradrenaline release-modulating H3 receptor in the mouse brain were examined. In superfused mouse brain cortex slices preincubated with 3H-noradrenaline, the inhibitory effect of histamine on the electrically (0.3 Hz) evoked tritium overflow was virtually identical when the time of exposure was 30, 80 or 130 min; after withdrawal of histamine, the evoked overflow recovered within 80 min. The attenuation of the effect of histamine by thioperamide was reversible within 50 min after withdrawal of the antagonist, whereas the attenuation produced by EEDQ remained constant for at least 80 min. In conclusion, the effects of histamine and thioperamide at the H3 receptor are readily reversible, whereas EEDQ appears to be an irreversible antagonist; desensitization of the H3 receptor does not occur.

Rat brain cortex slices preincubated with 3H-serotonin were superfused with physiological salt solution containing the serotonin uptake blocker DU 24565 (6-nitroquipazine). The effects of (+/-)-cyanopindolol and its enantiomers, of ICI 118,551 (erythro-dl-1-(7-methylindan-4-yloxy)-3-isopropylaminobut an-2-ol) and of isoprenaline on the electrically (3 Hz) evoked 3H overflow were studied. (+/-)-Cyanopindolol increased the evoked 3H overflow; this effect was prevented by preexposure to the previously characterized serotonin receptor antagonist metitepin. The concentration-response curve of unlabelled serotonin for its inhibitory effect on the electrically evoked 3H overflow was shifted to the right by (+/-)-cyanopindolol (apparent pA2 value: 8.29), whereas that of noradrenaline (determined in the absence of DU 24565) was not affected (apparent pA2 value: less than 6.0). The concentration-response curve of serotonin was also shifted to the right by (-)-cyanopindolol (apparent pA2 value: 8.30) and (+)-cyanopindolol (6.83) but not by ICI 118,551 (less than 5.5). Isoprenaline (up to 10 mumol/l; examined in the absence of DU 24565) did not influence the electrically evoked 3H overflow. The present results show that the presynaptic serotonin autoreceptor is blocked by cyanopindolol in a stereoselective way. This drug is 20 times more potent than metitepin as an antagonist at the presynaptic serotonin autoreceptor, and, in contrast to the latter, it does not act as an antagonist at the presynaptic alpha 2-adrenoceptor on the serotoninergic neurone.

Rat brain frontal cortex or striatal slices preincubated with 3H-serotonin were superfused with physiological salt solution and tritium overflow was evoked by electrical field stimulation at a frequency of 3 Hz. 1. GABA 1 mmol/1 inhibited the evoked overflow from frontal cortex slices by about 30%. The inhibitory effect was abolished when the frequency of electrical stimulation was 10 instead of 3 Hz. Progabide and R(-)-baclofen were more potent, whereas muscimol was less potent than GABA itself in inhibiting the evoked overflow; the IC15 values of progabide, R(-)-baclofen, GABA and muscimol were 8.3, 15, 170 and greater than 320 mumol/1, respectively. S(+)-baclofen behaved as a partial agonist with a maximum inhibitory effect by about 15%. Nipecotic acid and aminooxyacetic acid were ineffective. The same held true for bicuculline, picrotoxin and diazepam. 2. Bicuculline, picrotoxin, diazepam, phentolamine and the serotonin receptor antagonist metitepin did not influence the inhibitory effect of GABA. By contrast, S(+)-baclofen attenuated the effects of GABA and R(-)-baclofen. 3. The evoked overflow from striatal slices was inhibited by GABA and progabide (IC15 values: 480 and 13 mumol/1, respectively). Nipecotic acid was ineffective. The results suggest that exogenous GABA inhibits serotonin release in the rat brain via GABAB receptors which may be assumed to be located presynaptically.

The effects of histamine and related drugs on the evoked tritium overflow from superfused rat brain cortex slices preincubated with 3H-noradrenaline were determined. Tritium overflow was stimulated electrically (3 Hz; slices superfused with normal physiological salt solution) or by introduction of CaCl2 1.3 mmol/l (slices superfused with Ca2(+)-free medium containing K+ 20 mmol/l). Histamine slightly decreased the electrically evoked 3H overflow in slices superfused in the presence of desipramine. The degree of inhibition obtained with histamine was doubled when both desipramine and phentolamine were present in the superfusion medium (pIC15 6.46). Under the latter condition, the evoked overflow was inhibited by the H3 receptor agonist R-(-)-alpha-methylhistamine and its S-(+) enantiomer (pIC15 7.36 and 5.09, respectively), but was not affected by the H2 receptor agonist dimaprit and the H1 receptor agonist 2-thiazolylethylamine (both at up to 32 mumols/l). The concentration-response curve of histamine was shifted to the right by the H3 receptor antagonists thioperamide, impromidine and burimamide (apparent pA2 8.37, 6.86 and 7.05, respectively), by the H2 receptor antagonist ranitidine (apparent pA2 4.27) and was not affected by the H1 receptor antagonist dimetindene (32 mumols/l). The inhibitory effect of R-(-)-alpha-methylhistamine on the evoked overflow was also counteracted by thioperamide. Given alone, none of the five histamine receptor antagonists affected the evoked overflow. In the absence of desipramine plus phentolamine, impromidine and burimamide facilitated the electrically evoked 3H overflow whereas thioperamide had no effect. The facilitatory effects of impromidine and burimamide were abolished by phentolamine, but not affected by desipramine.(ABSTRACT TRUNCATED AT 250 WORDS)

Rats were pithed, vagotomized and adrenalectomized and the effect of procaterol on the pressor response to electrical stimulation of the thoracolumbar preganglionic sympathetic outflow from the spinal cord or to exogenous noradrenaline was studied in the absence and presence of beta-adrenoceptor antagonists and drugs interfering with the renin-angiotensin system. 1. Basal diastolic blood pressure was decreased by captopril, ramiprilate (angiotensin converting enzyme inhibitors), saralasin (an angiotensin II receptor antagonist), pepstatin A (a protease inhibitor with renin antagonistic properties) and by functional nephrectomy (ligation of both renal hili), but was not affected by procaterol (a beta 2-adrenoceptor agonist), nebivolol (a beta 1-adrenoceptor antagonist) and ICI 118,551 (erythro-dl-1-(7-methylindan-4-yloxy)-3-isopropylaminobut an-2-ol; a beta 2-adrenoceptor antagonist). 2. The vasopressor response induced by electrical stimulation of the preganglionic sympathetic nerve fibres was increased by procaterol, whereas the increase in blood pressure evoked by exogenous noradrenaline was not affected. The pressor response to both electrical stimulation and exogenous noradrenaline was decreased by captopril, ramiprilate, saralasin and nephrectomy but was not affected by nebivolol and ICI 118,551. 3. The facilitatory effect of procaterol on the neurogenic, electrically induced pressor response, which was also obtained when basal blood pressure was decreased by nephrectomy and increased by Lys8-vasopressin, was abolished by ICI 118,551 but not affected by nebivolol. Under none of these experimental conditions did procaterol alter the vasopressor response to exogenous noradrenaline. 4. The facilitatory effect of procaterol on the neurogenic, electrically induced rise in blood pressure was abolished by captopril, ramiprilate, saralasin and pepstatin A.(ABSTRACT TRUNCATED AT 250 WORDS)

1. In rat brain cortex slices preincubated with [3H]5-HT, the potencies of 17 5-HT receptor agonists to inhibit the electrically evoked3H overflow and the affinities of 13 antagonists (including several β-adrenoceptor blocking agents) to antagonize competitively the inhibitory effect of unlabelled 5-HT on evoked3H overflow were determined. 2. The affinities of the compounds for 5-HT1B and 5-HT2 binding sites in rat brain cortex membranes (labelled by [125I]cyanopindolol = [125I]-CYP in the presence of 30 μmol/l isoprenaline and [3H]ketanserin, respectively), for 5-HT1A binding sites in pig and rat brain cortex membranes (labelled by [3H]8-hydroxy-2-(di-n-propylamino)tetralin = [3H]8-OH-DPAT) and for 5-HT1C binding sites in pig choroid plexus membranes (labelled by [3H]mesulergine) were also determined. The affinities of the drugs for the various 5-HT recognition sites ranged over 4–5 log units (the functional experiments revealed the same range of differences between the drugs). 3. There were no significant correlations between the affinities of the drugs at 5-HT1C and 5-HT2 binding sites and their potencies or affinities, determined for the 5-HT autoreceptors. In contrast, significant correlations were found between the potencies or affinities of the drugs for the autoreceptors and their affinities at 5-HT1A or 5-HT1B binding sites; the best correlations were obtained with the 5-HT1B binding site. 4. Some of the drugs investigated were not included in the correlation since their agonistic or antagonistic effects on the autoreceptors were weak and pEC30 or apparent pA2 values could not be determined ( 7.2). 5. In conclusion, the evidence indicates that the presynaptic 5-HT autoreceptor belongs to the 5-HT1B receptor subtype.

Stimulation-evoked tritium overflow was examined in superfused rat brain cortex slices (stimulus: electrical impulses; 3 Hz) and synaptosomes (stimulus: potassium 12 mmol/l) preincubated with 3H-5-HT. 1. In slices and synaptosomes, the evoked 3H overflow was facilitated by forskolin and 8-Br-cAMP, but was not affected by AH 21-132 (an inhibitor of cAMP phosphodiesterase; cis-6-(p-acetamidophenyl)-1, 2, 3, 4, 4 a,10b-hexahydro-8, 9-dimethoxy-2-methylbenzo [c] [1,6]-naphthyridine). In the presence of AH 21-132, the facilitatory effect of forskolin on evoked overflow was increased. 2. In slices, AH 21-132 or combined administration of forskolin plus AH 21-132 did not change the percentage of basal or evoked 3H overflow represented by unmetabolized 3H-serotonin (about 30% and 60%, respectively). 3. In slices, cocaine or 6-nitroquipazine, an inhibitor of serotonin uptake, did not influence the increase in evoked overflow produced by forskolin plus AH 21-132. Forskolin plus AH 21-132 did not alter the inhibitory effect of serotonin (examined in the presence of 6-nitroquipazine) and the facilitatory effect of metitepin (a serotonin receptor antagonist) on evoked 3H overflow, but considerably decreased the inhibitory effect of clonidine or B-HT 920 (2-amino-6-allyl-5,6,7,8-tetrahydro-4H-thiazolo-[5,4-d]-azepine). The present results suggest that the serotoninergic nerve terminals in the rat brain cortex are endowed with an adenylate cyclase, which is negatively coupled to the presynaptic α2-adrenoceptors, but is not linked to the presynaptic autoreceptors.

The effects of serotonin receptor agonists and antagonists on the electrically (3 Hz) evoked 3H overflow were determined on pig brain cortex slices preincubated with 3H-serotonin and superfused with physiological salt solution containing indalpine (an inhibitor of serotonin uptake) plus phentolamine. The potencies of the serotonin receptor agonists and antagonists were compared with their affinities for 5-HT1A, 5-HT1B, 5-HT1c, and 5-HT1D binding sites in pig or rat tissue membranes; in addition, the potencies of the agonists were compared to their potencies in inhibiting adenylate cyclase activity in membranes of calf substantia nigra. In the superfusion experiments on pig brain cortex slices the following rank orders of potencies were obtained: agonists, serotonin > 5-methoxytryptamine = 5-carboxamidotryptamine >R U 24969 (5-methoxy-3(1,2,3,6-tetrahydropyridin-4-yl)-1H-indole) > SDZ 21009 (4(3-terbutylamino- 2-hydroxypropoxy)indol- 2-carbonic-acid-isopropylester) ≥ yohimbine ≥ cyanopindolol > 8-OHDPAT (8-hydroxy-2-(di-n-propylamino)tetralin) ≥ CGS 12066 B (7-trifluoromethyl-4(4-methyl-l-piperazinyl)-pyrrolo[1,2-a]quinoxaline); ipsapirone and urapidil were ineffective; antagonists (antagonism determined against 5methoxytryptamine as an agonist), metitepine > metergoline > mianserin. Propranolol, spiperone or mesulergine did not produce a shift of the concentration-response curve for 5-methoxytryptamine. The potencies of the serotonin receptor agonists in pig brain cortex slices were significantly correlated with their affinities for 5-HT1c and 5-HT1D binding sites in membranes of the pig choroid plexus and caudate nucleus, respectively, but not with their affinities for 5-HT1A and 5-HT1B sites in membranes of the cerebral cortex of pig and rat, respectively. The agonist potencies in decreasing 3H overflow were also significantly correlated with their potencies in inhibiting adenylate cylase activity in calf substantia nigra (i.e., a 5-HT1D receptor-mediated effect). In conclusion, the pig brain cortical 5-HT autoreceptor probably belongs to the 5-HT1D subtype. The involvement of 5-HT1c recognition sites was excluded by the low potency of mianserin as an antagonist and, in particular, by the ineffectiveness of the 5-HT1c receptor antagonist mesulergine.

Pig brain cortex synaptosomes and slices preincubated with 3H-5-hydroxytryptamine (3H-5-HT) were superfused with physiological salt solution containing citalopram (an inhibitor of 5-HT uptake), and the effects of indolethylamines and 5-HT receptor antagonists on the potassium- or electrically evoked 3H overflow were determined. The potassium (25 mmol/l)-evoked tritium overflow from cortex synaptosomes was inhibited by 5-HT; the inhibitory effect of 5-HT was counteracted by metitepine, which, by itself, did not affect the evoked overflow. 5-Methoxytryptamine (examined in the absence of citalopram) also produced an inhibition of the evoked overflow. In cortex slices, the electrically (3 Hz) evoked overflow was inhibited by 5-HT and 5-carboxamidotryptamine. The inhibitory effect of 5-HT was antagonized by metitepine, which, given alone, increased the evoked overflow, but was not attenuated by ketanserin and ICS 205-930 ([3 alpha-tropanyl]-1H-indole-3-carboxylic acid ester), which, by themselves, did not influence the evoked overflow. The present results suggest that the serotoninergic nerve fibres of the pig brain cortex are endowed with presynaptic 5-HT1 receptors, which can be activated by endogenous and exogenous 5-HT.

Rat brain cortex slices preincubated with 3H-serotonin were superfused with physiological salt solution (containing citalopram, an inhibitor of serotonin uptake) and the effect of histamine on the electrically (3 Hz) evoked 3H overflow was studied. Histamine decreased the evoked overflow in a concentration-dependent manner. The inhibitory effect of histamine was antagonized by impromidine and burimamide, but was not affected by pheniramine, ranitidine, metitepine and phentolamine. Given alone, impromidine facilitated the evoked overflow, whereas burimamide, pheniramine and ranitidine had no effect. The results suggest that histamine inhibits serotonin release in the rat brain cortex via histamine H3 receptors, which may be located presynaptically.