Search

Purpose: To identify the types of viral infection in aqueous humor (AqH) among patients diagnosed as Fuchs uveitis syndrome (FUS) or Posner-Schlossman syndrome (PSS) and investigate their relevance to clinical manifestations and visual outcome. Methods: A total of 375 patients and 171 patients were diagnosed as FUS or PSS in our department. AqH and serum samples from 68 FUS patients and 16 PSS patients were obtained during eye surgery. The viral etiologies, clinical features, auxiliary tests and visual prognosis of patients with FUS or PSS who underwent AqH analysis were analysed and compared. Results: Among 68 FUS patients, rubella virus (RV), cytomegalovirus (CMV), herpes simplex virus (HSV) and varicella-zoster virus were identified in 17, 11, 1 and 1 patients, respectively. Seven patients with CMV and 1 with HSV were identified in 16 PSS patients. In both FUS and PSS groups, virus-associated eyes had higher proportion of secondary glaucoma and worse visual prognosis as compared with non-virus-associated eyes (all P < 0.05). In FUS group, specifically, CMV infection manifested as more obvious anterior segment inflammation and lower corneal endothelial cell density (CECD). RV infection showed a higher percentage of vitritis. In PSS group, CMV-associated PSS had a lower retinal nerve fiber layer thickness and CECD, worse visual prognosis as compared with non-virus-associated PSS (all P < 0.05). Conclusion: Our study identified 4 types of viral infection in FUS and 2 types of viral infection in PSS. Virus-associated patients are usually associated with more obvious clinical signs and poor visual prognosis. [ABSTRACT FROM AUTHOR]

Serological screening for TORCH(Toxoplasma gondii [TOX], Rubella virus [RV], Cytomegalovirus [CMV], and Herpes simplex virus [HSV]) infections is an effective method for preventing congenital infections caused by TORCH pathogens.In this study, we retrospectively analyzed the characteristics of TORCH infections in 17,807 infertile women of childbearing age in northwest China.We conducted serological detection of TORCH-pathogen-specific IgM and IgG antibodies. The seroprevalence of TORCH infections was statistically analyzed by applying χ2 and Fisher exact-probability tests to evaluate the differences among ages and across quarters of the year. The overall IgM/IgG seroprevalences of TOX, RV, CMV, HSV-1, and HSV-2 were 0.46/3.4%, 0.77/84.93%, 0.68/97.54%, 1.2/82.83%, and 0.62/10.04%, respectively. The positive rates for RV-IgM in women ≥ 40 years old were significantly higher than those for women 25–39 (P < 0.05) years of age. The seroprevalence of HSV1-IgM was higher in the third and fourth quarters of the year (seasons) (P < 0.001), and the seroprevalence of CMV-IgG was statistically significant between differences quarters (P = 0.017), and the seroprevalence of CMV-IgG in the first quarter was lower than that in the third and fourth quarters (Bonferroni correction, P = 0.009 > 0.0083), suggesting no statistically significant difference between the latter two groups. This study showed that in northwestern China the risk of acquiring primary infection by a TORCH pathogen among infertile women of childbearing age were still high, especially Toxoplasma gondii and Herpesvirus type 2 infection. Therefore, effective prevention strategies that include serological screening for TORCH should be implemented. [ABSTRACT FROM AUTHOR]

Background: TORCH infections during pregnancy significantly impact neonatal and maternal mortality rates worldwide. This study aimed to gather baseline serological data for pregnant women's immunological status to infection and determine if definite TORCH pathogens (cytomegalovirus, rubella virus, and Herpes simplex virus) were associated with Toxoplasma infection, to improve prenatal care and provide appropriate infection control strategies. Methodology: Blood samples were gathered from 210 pregnant women attending Al Zagazig University hospitals from February to May 2023. Samples were examined for specific IgM and IgG antibodies against TORCH pathogens by electrochemiluminescence technique. Results: Regarding TORCH infection, 60 (28.6%) cases were seronegative, while 77 (36.7%), 63 (30.0%), 56 (26.7%), and 15 (7.1%) were positive IgG antibodies against Toxoplasma gondii, cytomegalovirus, rubella virus, and Herpes simplex virus, respectively. There was no estimate for IgM for cytomegalovirus, rubella virus, or Herpes simplex virus, indicating that no primary infection had been detected during the pregnancy. There was a statistically significant association between seroprevalence of toxoplasmosis infections (IgM and IgG) and age group ≤ 25 years, which is the most common childbearing age group. Cytomegalovirus seropositivity was found in those beyond 25 years (P-value 0.001). Antibodies to mono-infections were found in 97/210 (46.2%) subjects. It is substantially higher under-25 years age group, 71/97 (73.2%), P-value of 0.001. 45/210 (21.4%) participants had antibodies to two agents, with no significant difference in the age group over 25 years, 26/45 (57.8%). Antibodies to three agents were assessed in eight instances, all under 25 years. Conclusions: According to our findings, serological evaluation for the TORCH complex in all pregnant women is recommended to determine infection immunity, current immunization regimens, and infection reactivation. Low TORCH antibodies rates amongst pregnant women in Egypt's Sharqia governorate might be an appropriate starting point for prenatal screening initiatives. [ABSTRACT FROM AUTHOR]

Rubella virus infection during pregnancy has several effects on the developing fetus. However, little is known about the epidemiology of the infection in Ethiopia. A cross-sectional study was conducted to assess the seroprevalence of rubella virus infection on consecutive 299 pregnant women attending antenatal care clinics in public health facilities in Halaba Town, Southern Ethiopia. Structured questionnaires were used to collect information on socio-demographic and reproductive characteristics. Venous blood samples were collected, and sera were tested for anti-rubella IgM and IgG using the enzyme-linked immunosorbent assay. Anti-rubella IgG and IgM were detected in 265 (88.6%) and 15 (5.0%) of 299 participants, respectively. Pregnant women in their first trimester [crude odds ratio (cOR) = 4.26; 95% CI (1.47, 12.4)] were at increased risk of having anti-rubella IgM compared to those in their second and third trimesters. Urban residents [cOR = 4.06; 95% CI (1.94, 8.47)] were with a higher percentage of IgG positivity compared to rural residents. Anti-rubella IgG positivity was higher in housewives [cOR = 2.94; 95% CI (1.07, 8.04)] compared to self-employed women. Our findings showed a high prevalence of rubella virus exposure, and considerable percentages of recent infection and susceptible women to contracting the infection, emphasizing the importance of congenital rubella syndrome in the research area. [ABSTRACT FROM AUTHOR]

'Staggering disease' is a neurological disease entity considered a threat to European domestic cats (Felis catus) for almost five decades. However, its aetiology has remained obscure. Rustrela virus (RusV), a relative of rubella virus, has recently been shown to be associated with encephalitis in a broad range of mammalian hosts. Here, we report the detection of RusV RNA and antigen by metagenomic sequencing, RT-qPCR, in-situ hybridization and immunohistochemistry in brain tissues of 27 out of 29 cats with non-suppurative meningoencephalomyelitis and clinical signs compatible with'staggering disease' from Sweden, Austria, and Germany, but not in non-affected control cats. Screening of possible reservoir hosts in Sweden revealed RusV infection in wood mice (Apodemus sylvaticus). Our work indicates that RusV is the long-sought cause of feline 'staggering disease'. Given its reported broad host spectrum and considerable geographic range, RusV may be the aetiological agent of neuropathologies in further mammals, possibly even including humans. Rustrela virus (RusV) was detected in the brains of 27 out of 29 domestic cats with 'staggering disease', but not of 29 control cats. This suggests RusV as the long-sought causative agent of 'staggering disease', which had been obscure for 50 years. [ABSTRACT FROM AUTHOR]

Purpose: To compare iris affectation in cytomegalovirus anterior uveitis (CMVAU), rubella virus-associated uveitis (RVU), and healthy contralateral eyes, using swept-source anterior segment optical coherence tomography (SS-AS-OCT). Materials and methods: A comparative, transversal, retrospective study examining 60 eyes from 30 patients—18 eyes (17 patients) with CMVAU, 14 eyes (13 patients) with RVU, and 28 healthy eyes—was performed. Six-millimeter cross-sectional SS-AS-OCT B-scans were obtained in each iris quadrant. Images were exported to ImageJ®. Qualitative and quantitative analyses were done: stromal thickness (ST), smooth index (SI), and optical density (OD) of pigment epithelium. Comparisons between measurements and clinical-demographic parameters were performed using SPSS®. Results: Qualitative analysis showed extensive damage in iris stroma but was unable to differentiate between both uveitis. RVU eyes had a lower mean ST (315.72 μm ± 42.4) compared to those with CMVAU (348.6 μm ± 46) (p = 0.047) and a lower ST in the upper (338.9 μm ± 38.52)/(386.25 μm ± 47.2) (p = 0.005) and temporal (281.5 μm ± 57.3)/(326.43 μm ± 62.3) (p = 0.016) quadrants. Mean (0.94 ± 0.02)/(0.9 ± 0.03) (p = 0.001), temporal (0.94 ± 0.02)/(0.89 ± 0.03) (p < 0.001), and nasal SI (0.094 ± 0.02)/(0.9 ± 0.04) (p = 0.005) were higher in RVU. OD was similar in both uveitis. In healthy eyes, mean ST (376.8 μm ± 39.7) was higher and mean SI was lower (0.87 ± 0.04) than in RVU (p < 0.001) and CMVAU eyes (p = 0.032). Mean OD was higher in healthy eyes (911 ± 130) than in CMVAU eyes (800 ± 200) (p = 0.037). Conclusions: The quantitative analysis of the SS-AS-OCT iris images allows for the differentiation between healthy eyes and those with CMVAU and RVU, as well as between both uveitis. [ABSTRACT FROM AUTHOR]

Background: A positive MRZ reaction, as defined by intrathecal IgG production against at least two of its constituents, measles virus (M), rubella virus (R) and varicella zoster virus (Z), is detectable in ~ 63% of patients with multiple sclerosis (MS) and is currently considered the laboratory marker with the highest specificity and positive likelihood ratio for MS. However, M, R and Z are only the most well-established constituents of a broader intrathecal humoral immune response in MS. Objective: To identify additional anti-microbial antibodies inclusion of which in the classical MRZ panel may result in increased sensitivity without compromising the marker's high specificity for MS. Methods: We determined the antibody indices (AIs) for 11 viral and bacterial agents (M, R, Z, herpes simplex virus, Epstein–Barr virus, mumps virus, cytomegalovirus, parvovirus B19, Bordetella pertussis, Corynebacterium diphtheriae, and Clostridium tetani) in paired cerebrospinal fluid and serum samples from patients with MS and disease controls. Results: A positive 'classical' MRZ reaction was found in 17/26 (65.4%) MS patients. The five most frequently positive AIs among patients with MS were M (76.9%), Z (61.5%), R (57.7%), parvovirus B19 (42.3%), and mumps (28%). Addition of parvovirus B19 and mumps virus to the MRZ panel resulted in an increase in sensitivity in the MS group from 65.4% to 73.1%, with 22% of the initially MRZ-negative patients exhibiting a de novo-positive response. The extended MRZ panel ('MRZplus') distinguished sharply between MS (≥ 3 AIs in 90% of all positives) and controls (varying diagnoses, from migraine to vasculitis; 0-1 AIs; p < 0.000001). The highest median AI in the MS group was found for parvovirus B19 (3.97), followed by measles virus (2.79). Conclusion: Inclusion of parvovirus B19 and mumps virus in the test panel resulted in an increase in the sensitivity and discriminatory power of MRZ. Our results provide a strong rational for prospective studies investigating the role of extended MRZ panels in the differential diagnosis of MS. [ABSTRACT FROM AUTHOR]

We studied the localization and severity of morphological changes in CNS and internal organs of animals intacerebrally infected with a low-attenuated rubella virus strain "Orlov-14". The data obtained can be used as morphological criteria reflecting low level of attenuation of rubella virus strains to improve the control of the safety of attenuated strains of live rubella vaccines. [ABSTRACT FROM AUTHOR]

Copyright of Spektrum der Augenheilkunde is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The relationship among the Herpes simplex virus, Cytomegalovirus, and Rubella virus with non-small cell lung cancer is still unclear. Herein we analyze the expression of three different viruses in NSCLC and try to identify the relationship of the viruses involved in lung carcinogenesis. This study enrolled 61 patients who underwent surgery between January 2018 and June 2019 at the Department of the Thoracic Surgery at West China Hospital and 55 healthy volunteers during the same period for comparison purposes. The expression of three viruses IgM and IgG were analyzed by plasma ELISA. The experiments were approved by the West China Hospital Ethics committee (No. 2018 (33)) and all patients agreed to participate in the study and signed an informed consent form. In the healthy group, only one patient was Cytomegalovirus IgG positive and two patients were herpes simplex virus IgG positive in the test. With the Rubella virus IgG test, all the healthy volunteers were negative results. In the patient group, however, with the Cytomegalovirus IgG test, all the 61 patients showed the positive results. By testing the herpes simplex virus IgG, there were 60 patients showing the positive results. With the Rubella virus IgG test, exceeding half of total patients displayed the positive consequences. We also found that CMV-IgM and RV-IgM in 61 patients with NSCLC were negative expression in the serum; there were 3 positive cases with HSV-IgM. There were no positive expressions of CMV-IgM, RV-IgM, and HSV-IgM in serum of 55 healthy controls. A significant increase in the level of antibodies to capsid CMV, HSV, and RV antigen was established in patients with NSCLC as compared with healthy controls in our research. But more basic experimental researches need to be done. [ABSTRACT FROM AUTHOR]

Purpose: Nitazoxanide was recently reported as having in vitro effectiveness against the rubella virus. Immunodeficiency-related vaccine-derived rubella occurs in some patients who have an inherited immunodeficiency and who received the MMR vaccine. This study investigated the in vivo effectiveness of nitazoxanide therapy.Methods: This is a retrospective analysis of seven patients treated with nitazoxanide as salvage therapy for immunodeficiency-related vaccine-derived rubella infection. The patients were recruited from an ongoing rubella detection surveillance project.Results: Seven patients with persistent rubella were treated with nitazoxanide and one demonstrated significant clinical improvement. Two additional patients exhibited diminished viral capsid production with one patient having transient slowing of progression. The cohort overall generally had low T cell counts and had a high burden of comorbidities. There were three deaths. Two deaths were from PML and one was related to hematopoietic stem cell transplantation.Conclusions: Nitazoxanide has limited in vivo anti-viral effects for immunodeficiency-related vaccine-derived rubella. Most patients did not exhibit clinical improvement. [ABSTRACT FROM AUTHOR]

Background: Patients with multiple sclerosis (MS) frequently have an intrathecal production of antibodies to different common viruses, which can be detected by elevated antiviral antibody indices (AIs). There is a strong and consistent association of MS and Epstein–Barr virus (EBV) infection.Objective: To systematically compare the frequencies of intrathecal antibody production to EBV, measles virus, rubella virus, varicella zoster virus (VZV) and herpes simplex virus (HSV) in patients with MS.Methods: Review of the English and German literature on the frequencies of intrathecal immunoglobulin (Ig)G antibody production, as defined by an elevated AI, to EBV, measles virus, rubella virus, VZV and HSV in adult and pediatric patients with MS.Results: In nine original studies identified, the frequencies of an intrathecal production of antibodies to Epstein–Barr nuclear antigen-1 (33/340, 9.7%), EBV viral capsid antigen (12/279, 4.3%) and antigens from EBV-infected cell lines (14/90, 15.6%) in adult patients with MS were clearly lower (p ≤ 0.03 for all pairwise comparisons) than the frequencies of an intrathecal production of antibodies to measles virus (612/922, 66.4%), rubella virus (521/922, 56.5%), VZV (470/922, 51%; data from 17 original studies) and HSV (78/291, 26.8%; data from 6 original studies). Though based on a lower number of original studies and patients, findings in children with MS were essentially similar. As in adults and children with MS the seroprevalence of EBV is higher than the seroprevalences of the other investigated viruses, the lower frequency of elevated EBV AIs became even more pronounced after correction of the frequencies of elevated antiviral AIs for the seroprevalences of the respective viruses.Conclusions: Given the very high seroprevalence of EBV in MS, the frequency of intrathecally produced antibodies to EBV in patients with MS is paradoxically low compared to that of other common viruses. These findings are compatible with the recently proposed hypothesis that in individuals going on to develop MS antiviral antibody-producing cells may invade the brain predominantly at the time of and triggered by acute primary EBV infection, before anti-EBV IgG producing cells have yet occurred. [ABSTRACT FROM AUTHOR]

The emergence of Zika-virus-associated congenital microcephaly has engendered renewed interest in the pathogenesis of microcephaly induced by infectious agents. Three of the original 'TORCH' agents are associated with an appreciable incidence of congenital microcephaly: cytomegalovirus, rubella virus, and Toxoplasma gondii. The pathology of congenital microcephaly is characterized by neurotropic infectious agents that involve the fetal nervous system, leading to brain destruction with calcifications, microcephaly, sensorineural hearing loss, and ophthalmologic abnormalities. The inflammatory reaction induced by these four agents has an important role in pathogenesis. The potential role of 'strain differences' in pathogenesis of microcephaly by these four pathogens is examined. Specific epidemiologic factors, such as first and early second trimester maternal infection, and the manifestations of congenital infection in the infant, shed some light on the pathogenesis. Immune aspects of normal pregnancy and their role in congenital infections is examined. In this review, we integrate all these findings to create a unified hypothesis of the pathogenesis of congenital microcephaly induced by these infectious agents. [ABSTRACT FROM AUTHOR]

Copyright of Der Ophthalmologe is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Background: It has long been known that the majority of patients with multiple sclerosis (MS) display an intrathecal, polyspecific humoral immune response to a broad panel of neurotropic viruses. This response has measles virus, rubella virus and varicella zoster virus as its most frequent constituents and is thus referred to as the MRZ reaction (MRZR). Objective: Re-evaluation of the specificity of MRZR as a marker of MS. Methods: Structured review of the existing English-, German- and Spanish-language literature on MRZR testing, with evaluation of MRZR in a cohort of 43 unselected patients with MS and other neurological diseases as a proof of principle. Results: A positive MRZ reaction, defined as a positive intrathecal response to at least two of the three viral agents, was found in 78% of MS patients but only in 3% of the controls ( p < 0.00001), corresponding to specificity of 97%. Median antibody index values were significantly lower in non-MS patients (measles, p < 0.0001; rubella, p < 0.006; varicella zoster, p < 0.02). The 30 identified original studies on MRZR reported results from 1478 individual MRZR tests. A positive MRZR was reported for 458/724 (63.3%) tests in patients with MS but only for 19/754 (2.5%) tests in control patients ( p < 0.000001), corresponding to cumulative specificity of 97.5% (CI 95% 96-98.4), cumulative sensitivity of 63.3% (CI 95% 59.6-66.8) (or 67.4% [CI 95% 63.5-71.1] in the adult MS subgroup), a positive likelihood ratio of 25.1 (CI 95% 16-39.3) and a negative likelihood ratio of 0.38 (CI 95% 0.34-0.41). Of particular note, MRZR was absent in 52/53 (98.1%) patients with neuromyelitis optica or MOG-IgG-positive encephalomyelitis, two important differential diagnoses of MS. Conclusion: MRZR is the most specific laboratory marker of MS reported to date. If present, MRZR substantially increases the likelihood of the diagnosis of MS. Prospective and systematic studies on the diagnostic and prognostic impact of MRZR testing are highly warranted. [ABSTRACT FROM AUTHOR]

Although teratogenic rubella virus (RV) causes a vaccine-preventable disease, it is still endemic in several countries worldwide. Thus, there is a constant risk of RV importation into non-endemic areas. RV monitoring, especially during measles and Zika virus outbreaks, requires reliable diagnostic tools. For this study, a TaqMan-based one-step reverse transcription-quantitative PCR (RT -qPCR) assay, with the p90 gene as a novel and so far unexplored target for detection of clade I and II genotypes, was developed and evaluated. Automated nucleic acid extraction was carried out. Performance characteristics of the TaqMan RT -qPCR assay were determined for a RV plasmid standard and RNA extracted from virus-infected cell culture supernatants representing clade I and II genotypes. Diagnostic specificity and sensitivity were validated against other RNA and DNA viruses, relevant for RV diagnostic approaches and for RV-positive clinical samples, respectively. The assay is specific and highly sensitive with a limit of detection as low as five to one copies per reaction or 200 infectious virus particles per ml. The coefficients of variation (CV) were specified as intra- (within one run) and inter- (between different runs) assay variation, and calculated based on the standard deviations for the obtained Ct values of the respective samples. Intra- and inter-assay CV values were low, with a maximum of 3.4% and 2.4%, respectively. The assay was shown to be suitable and specific for the analysis of clinical samples. With p90 as a novel target, the highly sensitive and specific TaqMan assay outlined in this study is suitable for RV diagnosis worldwide. [ABSTRACT FROM AUTHOR]

Many active principles produced by animals, plants and microorganisms have been employed in the development of new drugs for the treatment of human diseases. Among animals known to produce pharmacologically active molecules that interfere in human cell physiology. Rubella virus (genus Rubivirus, family Togaviridae) is a single stranded RNA virus of positive genome polarity. Rubella virus infection of susceptible women during the first trimester of pregnancy often results in long-term virus persistence in the fetus causing multiple organ abnormalities. Potent antiviral activity against rubella virus (RV) has been observed in the hemolymph of Podalia sp. (Lepidoptera: Megalopygidae). This study evaluated the effect of hemolymph on RV infected Statens Serum Institute Rabbit Cornea (SIRC) cells. Results of cell viability and cell proliferation assays indicated that hemolymph was not toxic to cultured SIRC cells. Viral binding assay, antiviral assay, PCR, real-time PCR, and transmission electron microscopy were used to demonstrate that hemolymph in post-treatment could inhibit the production of infectious RV particles. Specifically, hemolymph was found to inhibit RV adsorption to the SIRC cells. [ABSTRACT FROM AUTHOR]

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes ( PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion ( t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers ( t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. [ABSTRACT FROM AUTHOR]

This paper presents an analysis of samples from 75 patients for the presence of rubella virus, viral RNA, and specific antibodies. For all samples, RNA detection was higher than virus isolation. It was found that it was not possible to isolate rubella virus in every sixth clinical sample containing the viral RNA. Primary structures of the site (from the 8072nd to 8291st nucleotide) of the rubella virus genome from 14 samples were determined. This paper shows that all the samples of rubella virus belong to the first genotype, subgroups 1h, and very likely to subgroups 1a and 1F. For the first time, the circulation of rubella virus of the genotype has been shown both prior to the start of mass vaccination in Western Siberia and after. [ABSTRACT FROM AUTHOR]

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination. [ABSTRACT FROM AUTHOR]

Autophagy is a cellular catabolic process implicated in numerous physiological processes and pathological conditions, including infections. Viruses have evolved different strategies to modulate the autophagic process. Since the effects of rubella virus (RV) on autophagy have not yet been reported, we evaluated the autophagic activity in the Statens Seruminstitut Rabbit Cornea cell line infected with the To336 strain of RV. Our results showed that RV lowered the levels of microtubule-associated protein 1 light chain 3 B-II (LC3B-II) and the autophagy-related gene 12-autophagy-related gene 5 conjugate, inhibited the autophagic flux, suppressed the intracellular redistribution of LC3B, decreased both the average number and the size of autophagosomes per cell and impeded the formation of acidic vesicular organelles. Induction of autophagy by using rapamycin decreased both the viral yields and the apoptotic rates of infected cultures. Besides its cytoprotective effects, autophagy furnishes an important antiviral mechanism, inhibition of which may reorchestrate intracellular environment so as to better serve the unique requirements of RV replication. Together, our observations suggest that RV utilizes a totally different strategy to cope with autophagy than that evolved by other positive-stranded RNA viruses, and there is considerable heterogeneity among the members of the Togaviridae family in terms of their effects on the cellular autophagic cascade. [ABSTRACT FROM AUTHOR]

The aim of the present study was to identify the rubella virus (RV) and enterovirus (EV) genotypes detected during the Epidemiological Surveillance on Exanthematic Febrile Diseases (VIGIFEX) study and to perform phylogenetic analysis. Ten RV- and four EV-positive oropharyngeal samples isolated from cell culture were subjected to RT-PCR and sequencing. Genotype 1G and echovirus 9 (E-9) was identified in RV- and EV-positive samples, respectively. The RV 1G genotype has been persisting in Brazil since 2000-2001. No evidence of E-9 being involved in exanthematic illness in Brazil has been reported previously. Differential laboratory diagnosis is essential for management of rash and fever disease. [ABSTRACT FROM AUTHOR]

Background: To characterise the polyspecific intraocular antibody synthesis in aqueous humor of patients with Fuchs uveitis and other types of non-infectious uveitis. Methods: Aqueous and serum samples collected from 24 patients with Fuchs uveitis, 21 patients with non-infectious uveitis, and 27 healthy subjects undergoing elective cataract surgery (control group) were analysed. In addition, vitreous samples, collected from seven uveitis patients (five Fuchs and two panuveitis) during retinal surgery, were examined. Specific immunoglobulin G antibodies against cytomegalovirus (CMV), rubella virus, herpes simplex virus (HSV), and varicella zoster virus (VZV) were investigated, and Goldmann-Witmer coefficients (GWCs) were calculated. Real-time PCR was performed to detect viral genome for HSV, VZV, and CMV, while nested PCR was conducted to detect rubella RNA. Results: None of the control samples tested positive for any of the viral antibodies investigated. Intraocular antibody production was found in eight samples of patients affected by Fuchs uveitis (6/8 positive for rubella virus and 2/8 positive for herpes virus). Among patients with non-infectious uveitis, three tested positive for intraocular antibody production (one RV, one HSV and one for VZV). PCR was positive for RV in two patients with Fuchs uveitis, in three patients with non-infectious uveitis (one for RV and two for HSV), and in three control subjects (one for CMV and one for HSV). Conclusions: Our series confirmed the presence of specific viral antibodies, especially against rubella virus, in the subgroup of patients affected by Fuchs uveitis, suggesting that this virus may be responsible for this chronic inflammatory condition. Rubella virus is probably the main causative agent of Fuchs uveitis, but other viruses may also be involved in the pathogenesis of this disease. [ABSTRACT FROM AUTHOR]

Little is known about the three-dimensional organization of rubella virus, which causes a relatively mild measles-like disease in children but leads to serious congenital health problems when contracted in utero. Although rubella virus belongs to the same family as the mosquito-borne alphaviruses, in many respects it is more similar to other aerosol-transmitted human viruses such as the agents of measles and mumps. Although the use of the triple MMR (measles, mumps and rubella) live vaccine has limited its incidence in western countries, congenital rubella syndrome remains an important health problem in the developing world. Here we report the 1.8?Å resolution crystal structure of envelope glycoprotein E1, the main antigen and sole target of neutralizing antibodies against rubella virus. E1 is the main player during entry into target cells owing to its receptor-binding and membrane-fusion functions. The structure reveals the epitope and the neutralization mechanism of an important category of protecting antibodies against rubella infection. It also shows that rubella virus E1 is a class II fusion protein, which had hitherto only been structurally characterized for the arthropod-borne alphaviruses and flaviviruses. In addition, rubella virus E1 has an extensive membrane-fusion surface that includes a metal site, reminiscent of the T-cell immunoglobulin and mucin family of cellular proteins that bind phosphatidylserine lipids at the plasma membrane of cells undergoing apoptosis. Such features have not been seen in any fusion protein crystallized so far. Structural comparisons show that the class II fusion proteins from alphaviruses and flaviviruses, despite belonging to different virus families, are closer to each other than they are to rubella virus E1. This suggests that the constraints on arboviruses imposed by alternating cycles between vertebrates and arthropods resulted in more conservative evolution. By contrast, in the absence of this constraint, the strictly human rubella virus seems to have drifted considerably into a unique niche as sole member of the Rubivirus genus. [ABSTRACT FROM AUTHOR]

In the surveillance of the incidence of rubella in the northwestern region of Russia, an analysis was conducted of swabs from the noses and pharynxes of 37 patients with rubella treated in Solovev District Military Clinical Hospital No. 442. To isolate the virus, the RK-13 cell line was used, in total 22 strains were allocated. The strains of the Rubella virus isolated in St. Petersburg during the 2007 outbreak belong to the 1E genotype. In the culture of RK-13 cells, changes of cellular morphogenesis and the formation of replicative complexes, as well as the shells of virions of rubella viruses, were detected. [ABSTRACT FROM AUTHOR]

Live attenuated vaccine is used for vaccination. The temperature-sensitive (ts) phenotype is characteristic for almost all vaccinal rubella strains. The acquisition of the temperature-sensitive phenotype during adaptation to cold is strongly correlated with attenuation of the wild-type virus. Nevertheless, the molecular mechanisms of rubella virus attenuation have been insufficiently studied. Hence, it is still urgent to study the mechanisms of wild-type virus attenuation and search for key mutations leading to attenuation, as well as detect phenotypic signs that may serve as attenuation markers and be used, along with sequencing, for vaccinal strain genetic stability supervision. This study presents complete genome sequencing of the wild-type (wt) and cold-adapted (ca) C-77 rubella strain variants isolated in Russia; probable genetic determinants have been revealed. After comparison of the wt and ca genomes of the C-77 strain, 13 nucleotide differences were detected, of which six resulted in amino acid substitutions; four differences out of the six that result in these substitutions virtually do not occur in wild-type strains of the rubella virus. Tyr1042Cys substitution is of special interest in the protease domain of the C-77 strain, which likely plays a crucial role in cold-adapted phenotype acquisition by the C-77 strain. [ABSTRACT FROM AUTHOR]

Rubella virus (RUBV), a small, plus-strand RNA virus that is an important human pathogen, has the unique feature that the GC content of its genome (70%) is the highest (by 20%) among RNA viruses. To determine the effect of this GC content on genomic evolution, base and codon usage were analyzed across viruses from eight diverse genotypes of RUBV. Despite differences in frequency of codon use, the favored codons in the RUBV genome matched those in the human genome for 18 of the 20 amino acids, indicating adaptation to the host. Although usage patterns were conserved in corresponding genes in the diverse genotypes, within-genome comparison revealed that both base and codon usages varied regionally, particularly in the hypervariable region (HVR) of the P150 replicase gene. While directional mutation pressure was predominant in determining base and codon usage within most of the genome (with the strongest tendency being towards C's at third codon positions), natural selection was predominant in the HVR region. The GC content of this region was the highest in the genome (>80%), and it was not clear if selection at the nucleotide level accompanied selection at the amino acid level. Dinucleotide frequency analysis of the RUBV genome revealed that TpA usage was lower than expected, similar to mammalian genes; however, CpG usage was not suppressed, and TpG usage was not enhanced, as is the case in mammalian genes. [ABSTRACT FROM AUTHOR]

AimsTo assess the possible role of virus infection in patients with unexplained anterior uveitis (AU).MethodsIntraocular fluid and plasma samples of 30 HIV-negative AU patients who were unresponsive or poorly responsive to topical steroid therapy were analyzed for nucleic acid of cytomegalovirus (CMV), herpes simplex virus (HSV), and varicella zoster virus (VZV) by real-time polymerase chain reaction (PCR) and for intraocular antibodies against these viruses by Goldmann-Witmer coefficient (GWC) analysis. Of these 30 cases, 21 were tested for rubella virus by GWC analysis, 16 of which also had PCR assessment of aqueous for rubella virus.ResultsViral uveitis determined by either real-time PCR and/or GWC was documented in 20 out of 30 patients (67%). Of 30 paired samples tested by both methods for HSV, CMV, and VZV, 15 showed positive results (CMV (10), HSV (4), and VZV (1)). Real-time PCR was positive in 8/15 (53%), whereas GWC was positive in 10/15 (67%). Out of 10 CMV-positive patients, four had endotheliitis, two had Posner-Schlossman syndrome, and one Fuchs heterochromic uveitis syndrome (FHUS). Five out of 21 (24%) samples tested by GWC for Rubella virus were positive, three of which exhibited clinical features of FHUS.ConclusionsOur results indicate that CMV is a major cause of AU in Thailand and show that FHUS can be caused by both CMV and Rubella virus. [ABSTRACT FROM AUTHOR]

A molecular epidemiological study of novel strain of Rubella virus isolated during the outbreak in Western Siberia in 2004 is described. A detailed phylogenetic analysis performed based upon entire SP-section, which encodes all three Rubella structural proteins (C, E2, and El), is implemented. This analysis provides characterization of this strain and classifies it in the 1H genotype, thereby correcting a previous classification of this strain based upon a shorter nucleotide sequence only encoding El protein. Therefore, this study identified the genotype of the Rubella virus not previously detected in western Siberia (and even the entire Russian Federation), which highlights the importance of more extensive characterization of genetic variability of the Rubella virus, especially with regard to the potential influence of vaccination on the Rubella virus mutagenesis. [ABSTRACT FROM AUTHOR]

The reason why abnormal immune response exists in acute rheumatic fever is not exactly explained. The influence of co-pathogens like certain viruses were mentioned regarding the initiation of the immunological reaction in acute rheumatic fever patients by several authors since 1970. This study was designed to find the role or effect of some viral infections in the development of rheumatic fever. In this study, 47 cases with acute rheumatic fever (acute rheumatic arthritis, acute rheumatic carditis, and chorea), 20 cases with chronic rheumatic fever, 20 cases with streptococcal pharyngitis, and 20 healthy age- and gender-matched control cases were involved. Serological and molecular tests were made including hepatitis B virus, hepatitis C virus, rubella virus, herpes simplex virus (HSV group 1), and Epstein-Barr virus (EBV). HBsAg, rubella IgM and EBV IgM positivity were not seen in any of patients with rheumatic fever. Although antiHBs seropositivity was higher in the control group, it was not statistically significant ( p > 0.05). There was no difference in rubella IgG, HSV IgM seropositivity, either ( p > 0.05). EBV DNA was searched by the polymerase chain reaction technique; due to the latent nature of the virus, no significant difference was found between the control group and the other groups ( p > 0.05). In this study, no positive correlation could be found to support the synergism theories regarding the streptoccocus infection and viral infections in the development of acute rheumatic fever. Only EBV DNA positivity was found in all acute rheumatic fever cases but not in the control group may lead to further studies with larger series of patients. [ABSTRACT FROM AUTHOR]

Background: To determine whether rubella virus is involved in the pathogenesis of Fuchs heterochromic iridocyclitis (FHI). Methods: Fourteen patients (14 eyes) diagnosed with FHI based on characteristic ocular manifestations and eight control subjects were studied. Aqueous humor (AH) samples from 14 FHI patients and one vitreous sample from a FHI patient were analyzed for intraocular antibody production against rubella virus by calculation of the Goldmann–Witmer coefficient (GWC). Viral detection by nested polymerase chain reaction and isolation by culture in RK-13 cells were conducted in nine FHI patients. In addition to laboratory examinations, medical history of rubella virus vaccination was also obtained. Results: Ten patients with FHI examined showed intraocular synthesis of rubella virus antibodies (GWC > 3). A high index of rubella virus antibody production was also found in the vitreous sample (GWC = 30.6). GWC in all control subjects were below detectable level. The rubella genome was detected in two of nine patients, and rubella virus was isolated from one of nine patients with FHI. None of the patients with FHI had been vaccinated against rubella. Conclusions: Our laboratory data strongly suggest a relationship between FHI and rubella virus. [ABSTRACT FROM AUTHOR]

Rubella Virus (RUBV) is a common cause of childhood rash and fever in non-immunized populations, and its public health importance relates to teratogenic effects of primary rubella infection in women with early pregnancy. Infection of the fetus may lead to congenital rubella syndrome (CRS). This work aimed to assess the degree of risk associated in acquiring rubella virus infection by the women during pregnancy and developing CRS among their children in Bangladesh. The study population ( n = 275) included pregnant mothers (15-38 years) from various socioeconomic backgrounds attending a women health care based hospital. All subjects were personally interviewed, clinically examined and a standardized questionnaire was filled up for each of them. From each participant 3 ml blood was taken and serum was separated. Commercially available ELISA kit was used for the qualitative and quantitative determination of IgM and IgG class antibodies against RUBV in collected serum samples. 209 women were found to contain detectable level of antiRUBV IgG antibodies, but did not possess IgM antibodies against rubella. Only 9% participants were vaccinated previously against rubella virus among the whole antenatal population studied. Ninety-two percent of these vaccinated pregnant women contained serum anti-rubella IgG antibody which was significantly ( P = 0.05) higher than that of the nonvaccinated study population (75%). Pregnant women from lower middle and poor socioeconomic class had significantly ( P = 0.05) more intra uterine growth retardation (IUGR) of fetus than the upper middle class. 20% of the women of child bearing age examined in this work were not yet exposed to RUBV and at risk of acquiring this virus during pregnancy and subsequently transmitting the virus to the fetus. Our work demonstrates rubella attack rate among antenatal population in Bangladesh as 14.5 in 1000 during pregnancy. A proper and reliable vaccination policy against rubella virus is not yet adopted at the national level in many developing countries including Bangladesh. This work identifies the requirement of detailed study for the identification of intrauterine rubella infection and its related influence on perinatal morbidity and mortality. Thorough epidemiological studies are also considered necessary prior to the development and acceptance of national immunization program against rubella virus in Bangladesh. [ABSTRACT FROM AUTHOR]

Fuchs' heterochromic cyclitis (FHC) is a common intraocular disease of uncertain etiology that has recently been related to rubella virus (RV) infection. We investigated the synthesis of RV-specific IgG using aqueous humor and serum samples from 63 consecutive patients with FHC. In addition, intraocular immunoglobulin G production against herpes simplex virus (HSV), varicella zoster virus (VZV), cytomegalovirus (CMV) and toxoplasma gondii was determined. In 20 patients, the detection of RV RNA was additionally performed by RT-PCR on the E1 gene. Forty-six patients with HSV- and VZV-associated uveitis, HLA B-27 positive anterior uveitis, and Posner–Schlossman syndrome served as controls. Specific intraocular antibody synthesis against RV was confirmed in all 63 FHC patients, whereas none of the 46 controls was positive for RV IgG. Interestingly, in 11 patients with positive RV IgG synthesis, additional HSV (eight), VZV (one) and CMV (two) specific antibodies could be detected. Only twice was viral RNA detectable by PCR in a patient with FHC. In this largest reported series of FHC patients, we detected a strong association between FHC and intraocular antibody synthesis against rubella virus. Furthermore, in 11 patients, it was possible to confirm an additional intraocular antibody synthesis, in particular HSV. PCR-positive results in the aqueous humor were exclusively obtained for RV. In contrast to other studies, the RV genome could only be identified in two patients (10%). [ABSTRACT FROM AUTHOR]

Quantum dot is a special kind of nanomaterial composed of periodic groups of II–VI, III–V or IV–VI materials. Their high quantum yield, broad absorption with narrow photoluminescence spectra and high resistance to photobleaching, make them become a promising labeling substance in biological analysis. Here, we report a quick and parallel analytical method based on quantum dots for ToRCH-related antibodies including Toxoplasma gondii, Rubella virus, Cytomegalovirus and Herpes simplex virus type 1 (HSV1) and 2 (HSV2). Firstly, we fabricated the microarrays with the five kinds of ToRCH-related antigens and used CdTe quantum dots to label secondary antibody and then analyzed 100 specimens of randomly selected clinical sera from obstetric outpatients. The currently prevalent enzyme-linked immunosorbent assay (ELISA) kits were considered as “golden standard” for comparison. The results show that the quantum dots labeling-based ToRCH microarrays have comparable sensitivity and specificity with ELISA. Besides, the microarrays hold distinct advantages over ELISA test format in detection time, cost, operation and signal stability. Validated by the clinical assay, our quantum dots-based ToRCH microarrays have great potential in the detection of ToRCH-related pathogens. [ABSTRACT FROM AUTHOR]

Copyright of Bundesgesundheitsblatt - Gesundheitsforschung - Gesundheitsschutz is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

The role that virus infections play in autism is not known. Others have reported that antibodies against measles virus are higher in the sera/plasma of children with autism versus controls. The authors investigated antibody titers to measles, mumps, and rubella viruses and diphtheria toxoid in children with autism, both classic onset (33) and regressive onset (26) forms, controls (25, healthy age- and gender-matched) and individuals with Tourette's syndrome (24) via enzyme-linked immunosorbent assays. No significant differences in antibody titers to measles, mumps, and rubella viruses and diphtheria toxoid were found among the four groups. Additionally, there were no significant differences between the four groups for total immunoglobulin (Ig)G or IgM. Interestingly, the authors did find a significant number (15/59) of autism subjects (classic and regressive onset combined) who had a very low or no antibody titer against rubella virus, compared to a combine control/Tourette's group (2/49). [ABSTRACT FROM AUTHOR]

The substrate requirement for rubella virus protease trans-activity is unknown. Here, we analyzed the cleavability of RV P200-derived substrates varying in their N-terminal lengths (72-475 amino acids) from the cleavage site by the RV protease trans-activity. Only substrates with at least 309 amino acid residues N-terminal to the cleavage site were able to undergo cleavage. Further, rubella sequence was found to be necessary in the N-terminal region of the substrate, whereas a heterologous sequence C-terminal to the cleavage site was tolerated. These results demonstrated a requirement for residues located between amino acids 994-1102 of the RV P200 polyprotein, besides its cleavage site for RV protease trans-activity. This region overlaps with the starting site of the essential cis-protease activity of RV P200 polyprotein. This is a novel observation for a viral protease of the family Togaviridae. [ABSTRACT FROM AUTHOR]

The subgenomic (SG) mRNA of rubella virus (RUB) contains the structural protein open reading frame (SP-ORF) that is translated to produce the three virion structural proteins: capsid (C) and glycoproteins E2 and E1. RUB expression vectors have been developed that express heterologous genes from the SG RNA, including replicons which replace the SP-ORF with a heterologous gene, and these expression vectors are candidate vaccine vectors. In the related alphaviruses, translational enhancing elements have been identified in both the 5′ untranslated region (UTR) of the SG RNA and the N-terminal region of the C gene. To optimize expression from RUB vectors, both the 5′UTR of the SG RNA and the C gene were surveyed for translational enhancing elements using both plasmids and replicons expressing reporter genes from the SG RNA. In replicons, the entire 5′UTR was necessary for translation; interestingly, when plasmids were used the 5′UTR was dispensable for optimal translation. The RUB C gene contains a predicted long stem-loop starting 62 nts downstream from the initiation codon (SLL) that has a structure and stability similar to SL’s found in the C genes of two alphaviruses, Sindbis virus (SIN) and Semliki Forest virus, that have been shown to enhance translation of the SG RNA in infected cells. However, a series of fusions of various lengths of the N-terminus of the RUB C protein with reporter genes showed that the SLL had an attenuating effect on translation that was overcome by mutagenesis that destabilized the SLL or by adding downstream sequences of the C gene to the fusion. Thus, for optimal expression efficiency from RUB expression vectors, only the 5′UTR of the SG RNA is required. Further investigation of the differing effects of the SLL on RUB and alphavirus SG RNA translation revealed that the SIN and RUB SLLs could enhance translation when expressed from a SIN cytopathic replicon, but not when expressed from a plasmid, a RUB replicon, or a SIN noncytopathic replicon. Thus, the SLL only functions in a “cytopathic environment” in which cell translation has been altered. [ABSTRACT FROM AUTHOR]

In order to ascertain the epidemiology of rubella infections in Austria, a seroepidemiological study was performed. Data collected from 115 cases diagnosed at the Institute of Hygiene and Social Medicine of the University of Innsbruck during 2001 were evaluated. The results indicate this infection can no longer be categorised as a paediatric disease (mean age, 18.5 years), and several other findings were particularly striking: (i) 47% of the patients had elevated C-reactive protein levels and 50% had increased anti-streptolysin 0 titres; (ii) only a few patients complained of fever, while symptoms such as rash and lymphadenopathy, which are also associated with several other viral infections, including HIV, were found frequently; and (iii) the 115 rubella cases detected in the 1- year study period represented an incidence of >13 per 100,000 population. This high incidence of infection underlines the need for further improvement of diagnostic tests and more successful vaccine strategies. [ABSTRACT FROM AUTHOR]

Summary. In utero infection of developing fetus by Rubella virus (RV) causes cell division inhibition of critical precursor cells in organogenesis, CNS-associated birth defects and induction of apoptosis in cell culture. The underlying mechanisms of RV-induced congenital abnormalities are not known. Here, we identified a novel interaction between RV replicase P90 protein and a cytokinesis-regulatory protein, the Citron-K kinase (CK), in a yeast two-hybrid cDNA library screen. Aberrations in cytokinesis and subsequent apoptosis do occur in specific cell types when the CK gene is knocked out or, its regulatory function is perturbed. Our analysis found that full-length P90 binds CK and in RV-infected cells P90 colocalizes with CK in the cytoplasm. Furthermore, during RV infection as well as cellular expression of P90 alone, we identified a discrete subpopulation of cells containing 4N DNA content, indicating that these cells are arrested in the cell cycle following S phase, suggesting that cellular expression of viral P90 during RV infection perturbs cytokinesis. Previous reports by others established that RV infection leads to apoptosis in cell culture. These observations together taken to the fetal organogenesis level, favor the idea that RV P90, by binding to cellular CK, invokes cell cycle aberrations resulting in the cell- and organ-specific growth inhibition and programmed cell death during RV infection in utero, which commonly is referred to as RV-induced teratogenesis. [ABSTRACT FROM AUTHOR]