Search

Innate and adaptive immunity play a crucial role in allergic bronchopulmonary aspergillosis (ABPA) pathogenesis. We performed next-generation sequencing using the Illumina TruSight One panel (4,811 human disease-associated genes, at least 20 × coverage) and selected 22 known immune genes (toll-like receptors (TLRs), C-type lectin, interleukin-4 receptor, and others). We included ABPA (n = 18), asthma without ABPA (n = 12), and healthy controls (n = 8). We analyzed 3011 SNPs from 22 genes and identified 145 SNPs (13 genes) that were present only in the disease groups and absent in controls. The SNP frequency overall was significantly higher in ABPA than in asthmatics (89/145 [61.4%] vs. 56/145 [38.6%], p = 0.0001). The SNP frequency in the TLR10 gene was also significantly higher in ABPA than in asthma (p = 0.017). Association analysis further revealed three genes having significant associations. Of these, NOS3 and HLA-DQB1 are associated with antimicrobial activity and adaptive immunity. More extensive studies are required to confirm our findings. [ABSTRACT FROM AUTHOR]

Aims: Hypertension (HTN) and Type 2 Diabetes (T2D) often coexist, therefore understanding the relationship between both diseases is imperative to guide targeted prevention/therapy. This study aims to explore the relationship between HTN and T2D using genome-wide association study (GWAS) analysis and biochemical data to understand the implication of both clinical and genetic factors in these pathologies.A total of 2,876 patients were enrolled. Using GWAS and biochemical data, patients with both T2D and HTN were compared to patients with only HTN. Specificity was confirmed by testing the detected genetic variants for associations with HTN development in T2D patients, or with HTN in healthy subjects. Regression models were applied to examine the association of T2D in patients with HTN with cardiovascular risk factors. Replication was performed using UK Biobank dataset with 31,170 subjects.Data showed that females with HTN are at higher risk of developing T2D due to dyslipidemia, while males faced higher risk due to high BMI (body mass index) and family history of T2D. GWAS identified Single Nucleotide Polymorphisms (SNPs) linked to T2D in patients with HTN. Notably, rs7865889, rs7756992, and rs10896290 were positively associated with T2D, whereas rs12737517 yielded negative association. Three SNPs were replicated in the UK Biobank (rs10896290, rs7865889, and rs7756992).Incorporating clinical and genetic screening into risk assessment is important for the detection and prevention of T2D in patients with HTN. The detected SNPs (rs7865889, rs12737517, and rs10896290), especially the protective SNP (rs12737517), provide an opportunity for better diagnosis, prevention, and therapy of patients with T2D and HTN.Methods: Hypertension (HTN) and Type 2 Diabetes (T2D) often coexist, therefore understanding the relationship between both diseases is imperative to guide targeted prevention/therapy. This study aims to explore the relationship between HTN and T2D using genome-wide association study (GWAS) analysis and biochemical data to understand the implication of both clinical and genetic factors in these pathologies.A total of 2,876 patients were enrolled. Using GWAS and biochemical data, patients with both T2D and HTN were compared to patients with only HTN. Specificity was confirmed by testing the detected genetic variants for associations with HTN development in T2D patients, or with HTN in healthy subjects. Regression models were applied to examine the association of T2D in patients with HTN with cardiovascular risk factors. Replication was performed using UK Biobank dataset with 31,170 subjects.Data showed that females with HTN are at higher risk of developing T2D due to dyslipidemia, while males faced higher risk due to high BMI (body mass index) and family history of T2D. GWAS identified Single Nucleotide Polymorphisms (SNPs) linked to T2D in patients with HTN. Notably, rs7865889, rs7756992, and rs10896290 were positively associated with T2D, whereas rs12737517 yielded negative association. Three SNPs were replicated in the UK Biobank (rs10896290, rs7865889, and rs7756992).Incorporating clinical and genetic screening into risk assessment is important for the detection and prevention of T2D in patients with HTN. The detected SNPs (rs7865889, rs12737517, and rs10896290), especially the protective SNP (rs12737517), provide an opportunity for better diagnosis, prevention, and therapy of patients with T2D and HTN.Results: Hypertension (HTN) and Type 2 Diabetes (T2D) often coexist, therefore understanding the relationship between both diseases is imperative to guide targeted prevention/therapy. This study aims to explore the relationship between HTN and T2D using genome-wide association study (GWAS) analysis and biochemical data to understand the implication of both clinical and genetic factors in these pathologies.A total of 2,876 patients were enrolled. Using GWAS and biochemical data, patients with both T2D and HTN were compared to patients with only HTN. Specificity was confirmed by testing the detected genetic variants for associations with HTN development in T2D patients, or with HTN in healthy subjects. Regression models were applied to examine the association of T2D in patients with HTN with cardiovascular risk factors. Replication was performed using UK Biobank dataset with 31,170 subjects.Data showed that females with HTN are at higher risk of developing T2D due to dyslipidemia, while males faced higher risk due to high BMI (body mass index) and family history of T2D. GWAS identified Single Nucleotide Polymorphisms (SNPs) linked to T2D in patients with HTN. Notably, rs7865889, rs7756992, and rs10896290 were positively associated with T2D, whereas rs12737517 yielded negative association. Three SNPs were replicated in the UK Biobank (rs10896290, rs7865889, and rs7756992).Incorporating clinical and genetic screening into risk assessment is important for the detection and prevention of T2D in patients with HTN. The detected SNPs (rs7865889, rs12737517, and rs10896290), especially the protective SNP (rs12737517), provide an opportunity for better diagnosis, prevention, and therapy of patients with T2D and HTN.Conclusion: Hypertension (HTN) and Type 2 Diabetes (T2D) often coexist, therefore understanding the relationship between both diseases is imperative to guide targeted prevention/therapy. This study aims to explore the relationship between HTN and T2D using genome-wide association study (GWAS) analysis and biochemical data to understand the implication of both clinical and genetic factors in these pathologies.A total of 2,876 patients were enrolled. Using GWAS and biochemical data, patients with both T2D and HTN were compared to patients with only HTN. Specificity was confirmed by testing the detected genetic variants for associations with HTN development in T2D patients, or with HTN in healthy subjects. Regression models were applied to examine the association of T2D in patients with HTN with cardiovascular risk factors. Replication was performed using UK Biobank dataset with 31,170 subjects.Data showed that females with HTN are at higher risk of developing T2D due to dyslipidemia, while males faced higher risk due to high BMI (body mass index) and family history of T2D. GWAS identified Single Nucleotide Polymorphisms (SNPs) linked to T2D in patients with HTN. Notably, rs7865889, rs7756992, and rs10896290 were positively associated with T2D, whereas rs12737517 yielded negative association. Three SNPs were replicated in the UK Biobank (rs10896290, rs7865889, and rs7756992).Incorporating clinical and genetic screening into risk assessment is important for the detection and prevention of T2D in patients with HTN. The detected SNPs (rs7865889, rs12737517, and rs10896290), especially the protective SNP (rs12737517), provide an opportunity for better diagnosis, prevention, and therapy of patients with T2D and HTN. [ABSTRACT FROM AUTHOR]

Objectives: The diffuse intrinsic pontine gliomas (DIPGs) are now defined by the type of histone H3 mutated at lysine 27. We aimed to correlate the multimodal MRI features of DIPGs, H3K27M mutant, with their histological and molecular characteristics. Methods: Twenty-seven treatment-naïve children with histopathologically confirmed DIPG H3K27M mutant were prospectively included. MRI performed prior to biopsy included multi-b-value diffusion-weighted imaging, ASL, and dynamic susceptibility contrast (DSC) perfusion imaging. The ADC and cerebral blood flow (CBF) and blood volume (CBV) were measured at the biopsy site. We assessed quantitative histological data, including microvascular density, nuclear density, and H3K27M-positive nuclear density. Gene expression profiling was also assessed in the samples. We compared imaging and histopathological data according to histone subgroup. We correlated MRI quantitative data with histological data and gene expression. Results: H3.1K27M mutated tumors showed higher ADC values (median 3151 μm2/s vs 1741 μm2/s, p = 0.003), and lower perfusion values (DSC-rCBF median 0.71 vs 1.43, p = 0.002, and DSC-rCBV median 1.00 vs 1.71, p = 0.02) than H3.3K27M ones. They had similar microvascular and nuclear density, but lower H3K27M-positive nuclear density (p = 0.007). The DSC-rCBV was positively correlated to the H3K27M-positive nuclear density (rho = 0.74, p = 0.02). ADC values were not correlated with nuclear density nor perfusion values with microvascular density. The expression of gated channel activity–related genes tended to be inversely correlated with ADC values and positively correlated with DSC perfusion. Conclusions: H3.1K27M mutated tumors have higher ADC and lower perfusion values than H3.3K27M ones, without direct correlation with microvascular or nuclear density. This may be due to tissular edema possibly related to gated channel activity–related gene expression. Key Points: • H3.1K27M mutant DIPG had higher apparent diffusion coefficient (p = 0.003), lower α (p = 0.048), and lower relative cerebral blood volume (p = 0.02) than H3.3K27M mutant DIPG at their biopsy sites. • Biopsy samples obtained within the tumor's enhancing portion showed higher microvascular density (p = 0.03) than samples obtained outside the tumor's enhancing portion, but similar H3K27M-positive nuclear density (p = 0.84). • Relative cerebral blood volume measured at the biopsy site was significantly correlated with H3K27M-positive nuclear density (rho = 0.74, p = 0.02). [ABSTRACT FROM AUTHOR]

Apolipoprotein (APOE) e4 genotype is an accepted risk factor for accelerated cognitive aging and dementia, though its neurostructural substrates are unclear. The deleterious effects of this genotype on brain structure may increase in magnitude into older age. This study aimed to investigate in UK Biobank the association between APOE e4 allele presence vs. absence and brain imaging variables that have been associated with worse cognitive abilities; and whether this association varies by cross-sectional age. We used brain magnetic resonance imaging (MRI) and genetic data from a general-population cohort: the UK Biobank (N = 8395 after exclusions). We adjusted for the covariates of age in years, sex, Townsend social deprivation scores, smoking history and cardiometabolic diseases. There was a statistically significant association between APOE e4 genotype and increased (i.e. worse) white matter (WM) hyperintensity volumes (standardised beta = 0.088, 95% confidence intervals = 0.036 to 0.139, P = 0.001), a marker of poorer cerebrovascular health. There were no associations with left or right hippocampal, total grey matter (GM) or WM volumes, or WM tract integrity indexed by fractional anisotropy (FA) and mean diffusivity (MD). There were no statistically significant interactions with age. Future research in UK Biobank utilising intermediate phenotypes and longitudinal imaging hold significant promise for this area, particularly pertaining to APOE e4's potential link with cerebrovascular contributions to cognitive aging. [ABSTRACT FROM AUTHOR]

Metachromatic leukodystrophy (MLD) is an autosomal recessively inherited sulfatide storage disease caused by deficient activity of the lysosomal enzyme arylsulfatase A (ASA). Genetic analysis of the ARSA gene is important in MLD diagnosis and screening of family members. In addition, more information on genotype prevalence will help interpreting MLD population differences between countries. In this study, we identified 31 different ARSA variants in the patient cohort (n = 67) of the Dutch expertise center for MLD. The most frequently found variant, c.1283C > T, p.(Pro428Leu), was present in 43 (64%) patients and resulted in a high prevalence of the juvenile MLD type (58%) in The Netherlands. Furthermore, we observed in five out of six patients with a non-Caucasian ethnic background previously unreported pathogenic ARSA variants. In total, we report ten novel variants including four missense, two nonsense, and two frameshift variants and one in-frame indel, which were all predicted to be disease causing in silico. In addition, one silent variant was found, c.1200C > T, that most likely resulted in erroneous exonic splicing, including partial skipping of exon 7. The c.1200C > T variant was inherited in cis with the pseudodeficiency allele c.1055A > G, p.(Asn352Ser) + ∗96A > G. With this study we provide a genetic base of the unique MLD phenotype distribution in The Netherlands. In addition, our study demonstrated the importance of genetic analysis in MLD diagnosis and the increased likelihood of unreported, pathogenic ARSA variants in patients with non-Caucasian ethnic backgrounds. [ABSTRACT FROM AUTHOR]

In recent years, epidemiologists have increasingly sought to employ genetic data to identify 'causal' relationships between exposures of interest and various endpoints – an instrumental variable approach sometimes termed Mendelian randomization. However, this approach is subject to all of the limitations of instrumental variable analysis and to several limitations specific to its genetic underpinnings, including confounding, weak instrument bias, pleiotropy, adaptation, and failure of replication. Although the approach enjoys some utility in testing the etiological role of discrete biochemical pathways, like folate metabolism, examples like that of alcohol consumption and cardiovascular disease demonstrate that it must be treated with all of the circumspection that should accompany all forms of observational epidemiology. Going forward, we urge the elimination of randomization or causality in reports of its use and suggest that Mendelian randomization instead be termed exactly what it is – genetic instrumental variable analysis. [ABSTRACT FROM AUTHOR]

Congenital hyperinsulinism (CHI) is a clinically, genetically, and morphologically heterogeneous disorder. 18F DOPA-PET CT scanning greatly improves its clinical outcome. Here, we presented the first Chinese 18F DOPA-PET CT scanning-based CHI cohort highlighting the variable ethic clinical phenotypes and genotypes. Fifty CHI patients were recruited. Median age at presentation was 2 days. Median fasting time was 2 h. Mean insulin level was 25.6 μIU/ml. Fifty-two percent of patients were diazoxide-unresponsive with significantly shorter fasting tolerance time and higher serum insulin level compared with the responsive patients. Seventy-four percent of patients experienced at least one adverse drug reaction. Tremendously increased focal lesions (32%) were detected and 75% of them were cured through surgery. Thirty-one nucleotide sequence changes were identified in 48% patients. Four novel variants (Q608X, Q1347X, Q289X, F1489S) in ABCC8 gene and 2 novel variants (G132A, V138E) in KCNJ11 gene were detected. Of the variants, 87.1% harbored in ABCC and KCNJ11 genes. T1042Qfs*75 in ABCC8 gene was the most common mutation.Conclusion: Highly increased portion of focal lesion was presented in Chinese CHI patients compared with that of the previous reports. Intolerance to diazoxide was much more evident in Chinese or East Asian than other populations. Certain hotspot mutations harbored in Chinese CHI patients. What is Known: • 18F DOPA-PET CT scanning can provide informative guidance for surgical procedure when medical therapy is not well responded in CHI patients. What is New: • Intolerance to diazoxide is much more evident in Chinese and East Asian CHI patients compared with the other ethnic populations. • Novel mutations were detected in ABCC8 and KCNJ11 gene. Hotspot mutations such as T1042Qfs*75, I1511K, E501K, G111R in ABCC8 gene, and R34H in KCNJ11 gene are predominantly responsible for Chinese CHI patients. [ABSTRACT FROM AUTHOR]

Genome-wide association studies have identified the CYP4V2 polymorphism (rs13146272) as a risk factor associated with venous thromboembolism (VTE). However, due to the small sample size and variance in genetic analysis models, the relationship between VTE and rs13146272 remains unclear. Here, we performed a case-control study to analyse the associations between rs13146272 and VTE in a Chinese population and to compare the differences among various ethnicities. In this study, 226 VTE patients and 205 healthy controls were recruited, and the allele frequency of variant rs13146272 was analysed by a MassARRAY SNP genotyping assay. In addition, 9 case-control cohorts from 5 studies involving 6667 VTE-affected individuals and 8716 control subjects were included in this meta-analysis. Pooled ORs and 95% CIs were calculated to assess the association between rs13146272 and VTE by using different genetic models. Our case-control study results showed that there was no significant association between VTE and rs13146272 under the additive model (OR = 0.92, 95% CIs: 0.70-1.21, p = 0.55) in this Chinese population. However, the results of the meta-analysis performed by merging all cohorts showed that rs13146272 was significantly associated with VTE under the additive model, recessive model and dominant model. In the additive and recessive models, the association reached the threshold for genome-wide significance (p < 5.0e−08). In conclusion, our pooled systematic study results indicated that individuals with the A allele had a higher risk of developing VTE than those with the C allele of the rs13146272 variant, but the risk was inconsistent among different ethnicities. Further validation of this association with larger sample sizes and multiple ethnicities is warranted. [ABSTRACT FROM AUTHOR]

Since the pioneering finding of Caspi and co-workers in 2002 that exposure to childhood maltreatment predicted later antisocial behaviour (ASB) in male carriers of the low-activity MAOA-uVNTR allele, frequent replication studies have been published. Two meta-analyses, one in 2006 and the other in 2014, confirmed the original findings by Caspi and co-workers. In the present paper, we review the literature, note some methodological aspects of candidate gene-environment interaction (cG×E) studies and suggest some future directions. Our conclusions are as follows. (1) The direction of the effect in a cG×E model may differ according to the positive and negative environmental background of the population. (2) There is a predictor-intersection problem such that when measuring one type of maltreatment in a person, other kinds of maltreatment often co-occur. Other forms of abuse are implicitly considered in statistical models; therefore, it is difficult to draw conclusions about the effects of timing and the severity of different forms of stressful life events in relation to ASB. (3) There is also an outcome-intersection problem because of the major intersection of ASB and other forms of mental health problems. It is likely that the G×E with MAOA is related to a common unmeasured factor. (4) For the G×E model, in which the effect of the gene on the outcome variable is dependent on other predictor variables, theoretically, hypothesis-driven statistical modelling is needed. [ABSTRACT FROM AUTHOR]

Gallbladder carcinoma (GBC) is one of the common malignancy of the biliary tract. Several genome wide and candidate gene studies have reported associations between multiple cancer types and single-nucleotide polymorphisms on 5p15.33 and 8q24.21 loci. However, predisposition potential of these genetic variants has not been assessed in GBC. We performed the present study to assess the potential of five polymorphisms on 5p15.33 and one on 8q24.21 locus in GBC risk and treatment response in patients undergoing chemoradiotherapy. We extracted genomic DNA from peripheral blood and genotyped selected SNPs using TaqMan allelic discrimination assays in 523 GBC cases and 274 controls from the north-Indian population. Statistical tests were performed to assess the association of selected common genetic variants with gallbladder cancer susceptibility and prognosis. Binary logistic regression analysis showed significant association of TERT rs2736100C > A [OR(CI) = 0.690(0.515-0.924), p value = 0.013], CLPTM1L rs401681C > T [OR(CI) = 0.586(0.405-0.847), p value = 0.004], and CASC8 rs6983267G > T [OR(CI) = 1.629(1.215-2.186), p value = 0.001] with GBC risk. Further, using multivariate logistic regression, we observed that haplotype CLPTM1L Crs401681Crs31489 TERT Trs2853676Ars2736100 MIR4457 Grs4635969 [OR(CI) = 7.52 (1.79-31.52), p value = 0.0064] is significantly associated with poor treatment response. In survival analysis, Kaplan-Meier survival curves showed significantly poor survival and COX regression suggested significantly higher hazard ratio in TT genotype carriers of CASC8 rs6983267 [OR(CI) = 4.28(1. 07-17.10), p value = 0.040] as compared to major allele and heterozygous (GG+GT) genotypes in metastatic GBC cases. The study revealed that 5p15.33 and 8q24.21 genetic variants significantly influence GBC risk and treatment response in north-Indian population. [ABSTRACT FROM AUTHOR]

Purpose: This systematic review evaluates the completeness of dosimetric features and their inclusion as covariates in genetic-toxicity association studies.Materials and Methods: Original research studies associating genetic features and normal tissue complications following radiotherapy were identified from PubMed. The use of dosimetric data was determined by mining the statement of prescription dose, dose fractionation, target volume selection or arrangement and dose distribution. The consideration of the dosimetric data as covariates was based on the statement mentioned in the statistical analysis section. The significance of these covariates was extracted from the results section. Descriptive analyses were performed to determine their completeness and inclusion as covariates.Results: A total of 174 studies were found to satisfy the inclusion criteria. Studies published ≥2010 showed increased use of dose distribution information (p = 0.07). 33% of studies did not include any dose features in the analysis of gene-toxicity associations. Only 29% included dose distribution features as covariates and reported the results. 59% of studies which included dose distribution features found significant associations to toxicity.Conclusion: A large proportion of studies on the correlation of genetic markers with radiotherapy-related side effects considered no dosimetric parameters. Significance of dose distribution features was found in more than half of the studies including these features, emphasizing their importance. Completeness of radiation-specific clinical data may have increased in recent years which may improve gene-toxicity association studies. [ABSTRACT FROM AUTHOR]

Interaction detection in large-scale genetic association studies has attracted intensive research interest, since many diseases have complex traits. Various approaches have been developed for finding significant genetic interactions. In this article, we propose a novel framework SRMiner to detect interacting susceptible and protective genotype patterns. SRMiner can discover not only probable combination of single nucleotide polymorphisms (SNPs) causing diseases but also the corresponding SNPs suppressing their pathogenic functions, which provides a better prospective to uncover the underlying relevance between genetic variants and complex diseases. We have performed extensive experiments on several real Wellcome Trust Case Control Consortium (WTCCC) datasets. We use the pathway-based and the protein-protein interaction (PPI) network-based evaluation methods to verify the discovered patterns. The results show that SRMiner successfully identifies many disease-related genes verified by the existing work. Furthermore, SRMiner can also infer some uncomfirmed but highly possible disease-related genes. [ABSTRACT FROM AUTHOR]

The disrupted-in-schizophrenia-1 ( DISC1) gene is known for its role in the development of mental disorders. It is also involved in neurodevelopment, cognition, and memory. To investigate the association between DISC1 variants and brain morphology, we analyzed the influence of the three common non-synonymous polymorphisms in DISC1 on specific brain structures in healthy young adults. The volumes of brain regions were determined in 145 subjects by magnetic resonance imaging and automated analysis using FreeSurfer. Genotyping was performed by high resolution melting of amplified products. In an additive genetic model, rs6675281 (Leu607Phe), rs3738401 (Arg264Gln), and rs821616 (Ser704Cys) significantly explained the volume variance of the amygdala ( p = 0.007) and the pallidum ( p = 0.004). A higher cumulative portion of minor alleles was associated with larger volumes of the amygdala ( p = 0.005), the pallidum ( p = 0.001), the caudate ( p = 0.024), and the putamen ( p = 0.007). Sex-stratified analysis revealed a strong genetic effect of rs6675281 on putamen and pallidum in females but not in males and an opposite influence of rs3738401 on the white cortical surface in females compared to males. The strongest single association was found for rs821616 and the amygdala volume in male subjects ( p < 0.001). No effect was detected for the nucleus accumbens. We report-to our knowledge-for the first time a significant and sex-specific influence of common DISC1 variants on volumes of the basal ganglia, the amygdala and on the cortical surface area. Our results demonstrate that the additive model of all three polymorphisms outperforms their single analysis. [ABSTRACT FROM AUTHOR]

On macroevolutionary timescales, extensive mutations and phylogenetic uncertainty mask the signals of genotype-phenotype associations underlying convergent evolution. To overcome this problem, we extended the widely used framework of non-synonymous to synonymous substitution rate ratios and developed the novel metric ω C , which measures the error-corrected convergence rate of protein evolution. While ω C distinguishes natural selection from genetic noise and phylogenetic errors in simulation and real examples, its accuracy allows an exploratory genome-wide search of adaptive molecular convergence without phenotypic hypothesis or candidate genes. Using gene expression data, we explored over 20 million branch combinations in vertebrate genes and identified the joint convergence of expression patterns and protein sequences with amino acid substitutions in functionally important sites, providing hypotheses on undiscovered phenotypes. We further extended our method with a heuristic algorithm to detect highly repetitive convergence among computationally non-trivial higher-order phylogenetic combinations. Our approach allows bidirectional searches for genotype-phenotype associations, even in lineages that diverged for hundreds of millions of years., (© 2023. The Author(s).)

Aims/hypothesis: Genome-wide association studies (GWAS) have identified more than 65 genetic loci associated with risk of type 2 diabetes. However, the contribution of distorted parental transmission of alleles to risk of type 2 diabetes has been mostly unexplored. Our goal was therefore to search for parent-of-origin effects (POE) among type 2 diabetes loci in families. Methods: Families from the Botnia study ( n = 4,211, 1,083 families) were genotyped for 72 single-nucleotide polymorphisms (SNPs) associated with type 2 diabetes and assessed for POE on type 2 diabetes. The family-based Hungarian Transdanubian Biobank (HTB) ( n = 1,463, >135 families) was used to replicate SNPs showing POE. Association of type 2 diabetes loci within families was also tested. Results: Three loci showed nominal POE, including the previously reported variants in KCNQ1, for type 2 diabetes in families from Botnia (rs2237895: p = 0.037), which can be considered positive controls. The strongest POE was seen for rs7578597 SNP in the THADA gene, showing excess transmission of the maternal risk allele T to diabetic offspring (Botnia: p = 0.01; HTB p = 0.045). These data are consistent with previous evidence of allelic imbalance for expression in islets, suggesting that the THADA gene can be imprinted in a POE-specific fashion. Five CpG sites, including those flanking rs7578597, showed differential methylation between diabetic and non-diabetic donor islets. Conclusions/interpretation: Taken together, the data emphasise the need for genetic studies to consider from which parent an offspring has inherited a susceptibility allele. [ABSTRACT FROM AUTHOR]

When assessing the combined action of genes on the quantitative or qualitative phenotype we encounter a phenomenon that could be named the 'paradox of the risk score summation.' It arises when the search of risk allele and assessment of their combined action are performed with the same single dataset. Too often such methodological error occurs when calculating the so called genetic risk score (GRS), which refers to the total number of alleles associated with the disease. Examples from numerous published genetic association studies are considered in which the claimed statistically significant effects can be attributed to the 'risk score summation paradox.' In the second section of the review we discuss the current modifications of multiple regression analysis addressed to the so called ' n ≪ p problem' (the number of points is much smaller than the number of possible predictors). Various algorithms for the model selection (searching the significant predictor combinations) are considered, beginning from the common marginal screening of the 'top' predictors to LASSO and other modern algorithms of compressed sensing. [ABSTRACT FROM AUTHOR]

Objectives: We sought to identify associations between aldehyde dehydrogenase 2 ( ALDH2), alcohol consumption, and hypertension in Japanese men. Methods: The study participants were 1,225 male Japanese workers. We collected lifestyle information, body measurements, blood biochemical parameters, blood pressure measurements, and ALDH2 genotyping data during medical examinations conducted between March 2004 and January 2005 at a work facility and an affiliated company. Lifestyle data on alcohol intake and smoking were collected using self-administered questionnaires at the same time as when the aforementioned measurements were obtained. Results: The genotype frequencies of ALDH2 genetic polymorphisms were 62.6, 32.7, and 4.7 % for *1/*1, *1/*2, and *2/*2, respectively. Systolic blood pressure and diastolic blood pressure in the *1/*2 or *2/*2 group were significantly lower than those in the *1/*1 group ( P < 0.001). Multiple regression analysis (stepwise method) for blood pressure according to ALDH2 genetic polymorphism revealed that the amount of daily alcohol intake affected systolic blood pressure in participants who harbored the ALDH2 genetic polymorphism *1/*2 or *2/*2. Conclusions: The interaction between alcohol intake and ALDH2 genetic polymorphisms might affect systolic blood pressure in adult male workers. [ABSTRACT FROM AUTHOR]

Aims: To evaluate the association of rs7578597 in THADA, rs10886471 in GRK5, rs7403531 in RASGRP1, and rs6723108 in TMEM163 with type 2 diabetes among the Japanese we performed a replication study of the association of these single nucleotide polymorphism (SNP) loci. Methods: We genotyped these 4 SNPs for 10,287 Japanese participants (7,478 type 2 diabetes, 2,809 controls) and used logistic regression analysis to examine the association of these SNPs with type 2 diabetes. Results: Rs6723108 was not polymorphic in our control group, and was excluded from the analysis. Rs7578597 was nominally associated with type 2 diabetes ( p = 0.0186, odds ratio = 0.55, 95 % confidence interval = 0.33-0.90 adjusted for age, sex, and body mass index); however this association was not significant after Bonferroni correction ( p ≥ 0.0125) and the effect direction was not consistent with that in the original report. There was significant heterogeneity in the allele frequency of rs7578597 among our control groups, and the nominal association was no longer observed ( p = 0.58) after excluding a control collection in which the risk allele frequency was significantly higher than those in the other control collections. The remaining 2 SNP loci were not associated with type 2 diabetes in this Japanese population ( p ≥ 0.05). We did not observe a significant association between the 3 SNPs and glycemic traits. Conclusions: The 4 loci have no significant effect on susceptibility to type 2 diabetes among the Japanese, although further evaluation with larger cohorts is necessary, especially for rs7578597 in THADA. [ABSTRACT FROM AUTHOR]

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes ( PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion ( t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers ( t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future. [ABSTRACT FROM AUTHOR]

Recent studies have described a number of genes that are frequently altered in medulloblastoma tumors and that have putative key roles in the development of the disease. We hypothesized that common germline genetic variations in these genes may be associated with medulloblastoma development. Based on recent publications, we selected 10 genes that were frequently altered in medulloblastoma: CCND2, CTNNB1, DDX3X, GLI2, SMARCA4, MYC, MYCN, PTCH1, TP53, and MLL2 (now renamed as KMT2D). Common genetic variants (single nucleotide polymorphisms) annotating these genes ( n = 221) were genotyped in germline DNA (neonatal dried blood spot samples) from 243 childhood medulloblastoma cases and 247 control subjects from Sweden and Denmark. Eight genetic variants annotating three genes in the sonic hedgehog signaling pathway; CCND2, PTCH1, and GLI2, were found to be associated with the risk of medulloblastoma ( P < 0.05). The findings were however not statistically significant following correction for multiple testing by the very stringent Bonferroni method. The results do not support our hypothesis that common germline genetic variants in the ten studied genes are associated with the risk of developing medulloblastoma. [ABSTRACT FROM AUTHOR]

Objective: Prostate cancer (PCa) is one of the major causes of death among men. Our study investigated the association of ESR1 and ESR2 genotypes with susceptibility to PCa in relation to smoking status in Japanese. Method: A case-control study was performed with 750 Japanese prostate cancer patients and 870 healthy controls. After age-matching in case-controls, 352 controls and 352 cases were enrolled in this study. By using logistic regression analysis, the different genotypes from ESR1 and ESR2 were analyzed according to case/control status. Result: ESR2 rs4986938 AG and AG + AA genotypes were associated with significantly decreased risk of PCa (AG: OR = 0.68, 95 % CI 0.47-0.97, P < 0.05 and AG + AA: OR = 0.67, 95 % CI 0.47-0.94, P < 0.05). However, there was no significant association between ESR1 rs2234693 and PCa risk. When patients were grouped according to smoking status, the ESR2 rs1256049 AA genotype (OR = 0.48, 95 % CI 0.25-0.95, P < 0.05) and ESR2 rs4986938 AG + AA genotype (OR = 0.64, 95 % CI 0.41-1.00, P < 0.05) showed significantly decreased PCa risk in the ever-smoker group. Conclusion: Our results suggest that the estrogen receptor ESR2 has a very important function to predict PCa and that different SNPs have different predictive values. Smoking may influence estrogenic activity and may influence PCa together with the estrogen receptor. [ABSTRACT FROM AUTHOR]

Background/aim: Gene variants encoding for proteins involved in homeostatic processes within tendons may influence its material and mechanical properties in humans. The purpose of this study was to examine the association between three polymorphisms of the MMP3 gene, (rs679620, rs591058 and rs650108) and patellar tendon dimensional and mechanical properties in vivo. Methods: One hundred and sixty, healthy, recreationally-active, Caucasian men and women, aged 18-39 were recruited. MMP3 genotype determined using real-time PCR was used to select 84 participants showing greatest genetic differences to complete phenotype measurements. Patellar tendon dimensions (volume) and functional (elastic modulus) properties were assessed in vivo using geometric modelling, isokinetic dynamometry, electromyography and ultrasonography. Results: No significant associations were evident between the completely linked MMP3 rs591058 and rs679620 gene variants, and closely linked rs650108 gene variant, and either patellar tendon volume (rs679620, P = 0.845; rs650108, P = 0.984) or elastic modulus (rs679620, P = 0.226; rs650108, P = 0.088). Similarly, there were no associations with the Z-score that combined those dimension and functional properties into a composite value (rs679620, P = 0.654; rs650108, P = 0.390). Similarly, no association was evident when comparing individuals with/without the rarer alleles ( P > 0.01 in all cases). Conclusions: Patellar tendon properties do not seem to be influenced by the MMP3 gene variants measured. Although these MMP3 gene variants have previously been associated with the risk of tendon pathology, that association is unlikely to be mediated via underlying tendon dimensional and functional properties. [ABSTRACT FROM AUTHOR]

Although a genetic contribution to the complex aetiology of suicidal behaviour has been suggested since many years, the attempt to identify specific genes related to suicide has led to contrasting results. In a post-mortem study on suicide, we previously detected several differentially expressed genes which, however, have not been subsequently associated with suicidal behaviour, or only nominally. Therefore, personality traits may represent good intermediate endophenotypes. Our primary aim was to investigate the potential modulation of several single-nucleotide polymorphisms (SNPs) of the same previously investigated genes (S100A13, EFEMP1, PCDHB5, PDGFRB, CDCA7L, SCN2B, PTPRR, MLC1 and ZFP36) on personality traits, as measured with the Temperament and Character Inventory (TCI), in a German sample composed of 287 healthy subjects (males: 123, 42.9 %; mean age: 45.2 ± 14.9 years) and in 111 psychiatric patients who attempted suicide (males: 43, 38.6 %; mean age: 39.2 ± 13.6 years). Multivariate analysis of covariance was used to test possible influence of single SNPs on TCI scores. Genotypic, allelic and haplotypic analyses have been performed. Controlling for sex, age and educational level, genotypic analyses showed a modulation of EFEMP1 rs960993 and rs2903838 polymorphisms on both harm avoidance and self-directedness in healthy subjects. Interestingly, we could replicate these associations in haploblocks within controls ( p < 0.0001) and in the independent sample of suicide attempters for harm avoidance ( p < 0.00001), a phenotype highly associated with suicidal behaviour. This study suggests that EFEMP1 SNPs, never investigated in association with suicidal behaviour and related personality, could be involved in its modulation in healthy subjects as well as in suicide attempters. [ABSTRACT FROM AUTHOR]

Purpose: Gene variants encoding for proteins involved in homeostatic processes within tendons may influence its material and mechanical properties in humans. The purpose of this study was to examine the association between one such gene variant, gene encoding collagen type V alpha 1 chain ( COL5A1) rs12722, and patellar tendon dimensions and mechanical properties in vivo. Methods: Eighty-four recreationally active, Caucasian, men and women, aged 18-39, with no history of injuries to the knee and a body mass index between 18.5 and 30 were recruited. Women were not recruited if they were pregnant or using any form of hormone-based contraception. The COL5A1 rs12722 genotype was determined using real-time polymerase chain reaction. Patellar tendon dimensions (volume) and functional (elastic modulus) properties were assessed in vivo using geometric modelling, isokinetic dynamometry, electromyography and ultrasonography. Results: After adjustments for non-genetic factors, no significant associations were evident between the COL5A1 rs12722 gene variant and either patellar tendon volume ( P = 0.933) or elastic modulus ( P = 0.206), nor with a calculated Z score that combined these dimensional and functional properties into a composite value ( P = 0.647). Similarly, no association was evident when comparing individuals with/without the rare C allele (volume, P = 0.883; elastic modulus, P = 0.129; Z score, P = 0.631). Conclusions: Tendon properties do not seem to be influenced by the COL5A1 rs12722 gene variant. Although the COL5A1 rs12722 polymorphism has previously been associated with the risk of tendon pathology, that association is unlikely to be mediated via underlying tendon dimensional and functional properties. [ABSTRACT FROM AUTHOR]

A set of formulas for the indices of the performance and predictive ability of the binary genetic tests is presented. Their dependence on disease prevalence and the population frequency of a genetic marker is characterized. It is shown that a marker with the odds ratio OR < 2.2 has an initially low prognostic efficiency in every sense and at any frequencies of the disease and the marker. A marker can be a good classifier, when OR > 5.4, but only in case its population frequency is rather high ( p > 0.3). The formulas are presented that allow obtaining indirect estimates of the absolute and relative risk of the disease for the carrier of a marker in the case-control studies. [ABSTRACT FROM AUTHOR]

Copyright of Der Internist is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Copyright of Der Internist is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Aims/hypothesis: Short and long sleep duration are associated with increased risk of type 2 diabetes. We aimed to investigate whether genetic variants for fasting glucose or type 2 diabetes associate with short or long sleep duration and whether sleep duration modifies the association of genetic variants with these traits. Methods: We examined the cross-sectional relationship between self-reported habitual sleep duration and prevalence of type 2 diabetes in individuals of European descent participating in five studies included in the Candidate Gene Association Resource (CARe), totalling 1,474 cases and 8,323 controls. We tested for association of 16 fasting glucose-associated variants, 27 type 2 diabetes-associated variants and aggregate genetic risk scores with continuous and dichotomised (≤5 h or ≥9 h) sleep duration using regression models adjusted for age, sex and BMI. Finally, we tested whether a gene × behaviour interaction of variants with sleep duration had an impact on fasting glucose or type 2 diabetes risk. Results: Short sleep duration was significantly associated with type 2 diabetes in CARe (OR 1.32; 95% CI 1.08, 1.61; p = 0.008). Variants previously associated with fasting glucose or type 2 diabetes and genetic risk scores were not associated with sleep duration. Furthermore, no study-wide significant interaction was observed between sleep duration and these variants on glycaemic traits. Nominal interactions were observed for sleep duration and PPARG rs1801282, CRY2 rs7943320 and HNF1B rs4430796 in influencing risk of type 2 diabetes ( p < 0.05). Conclusions/interpretation: Our findings suggest that differences in habitual sleep duration do not mediate or modify the relationship between common variants underlying glycaemic traits (including in circadian rhythm genes) and diabetes. [ABSTRACT FROM AUTHOR]

Hypertension has become a major global health burden due to its high prevalence and associated increase in risk of cardiovascular disease and premature death. It is well established that hypertension is determined by both genetic and environmental factors and their complex interactions. Recent large-scale meta-analyses of genome-wide association studies (GWAS) have successfully identified a total of 38 loci which achieved genome-wide significance ( P < 5 × 10 -8) for their association with blood pressure (BP). Although the heritability of BP explained by these loci is very limited, GWAS meta-analyses have elicited renewed optimism in hypertension genomics research, highlighting novel pathways influencing BP and elucidating genetic mechanisms underlying BP regulation. This review summarizes evolving progress in the rapidly moving field of hypertension genetics and highlights several promising approaches for dissecting the remaining heritability of BP. It also discusses the future translation of genetic findings to hypertension treatment and prevention. [ABSTRACT FROM AUTHOR]

Copyright of Der Gynäkologe is the property of Springer Nature and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. This abstract may be abridged. No warranty is given about the accuracy of the copy. Users should refer to the original published version of the material for the full abstract. (Copyright applies to all Abstracts.)

Henoch-Schönlein purpura (HSP) is the most common form of systemic vasculitis of unknown etiology. This study aimed at reviewing published studies investigating the association of genetic polymorphisms with HSP and its severity. We systematically reviewed all published data on genetic risk factors for HSP by searching MEDLINE. We also performed a meta-analysis of association studies of HLA- DRB1- 01, 07, and 11, angiotensin I- converting enzyme ( ACE) insertion/deletion (I/D) polymorphism. We identified 45 studies investigating polymorphisms in 39 genes in association with HSP and/or its severity. Most of these genes are involved in immunological and/or inflammatory responses or vasomotor regulation. Most results were negative. The most convincing finding is the association of HLA- DRB1*01, 07, and 11 with HSP susceptibility. The overall odds ratios (ORs) for the three loci were significant for HSP: HLA-DRB1*01 (OR = 1.805, 95 % CI 1.259-2.588, p = 0.0012); HLA-DRB1*07 (OR = 0.671, 95 % CI 0.469-0.961, p = 0.058); HLA-DRB1*11 (OR = 2.001, 95 % CI 1.50-2.67, p = 0.027). Genetic regulation of endothelial function, such as polymorphisms in genes coding rennin-angiotensin system (RAS) components, endothelial nitric oxide synthases, Inter- Cellular Adhesion Molecule 1, and vascular endothelial growth factor, could also confer effect on HSP. In addition, MEFV, whose mutations cause familial Mediterranean fever, could be an important candidate gene for HSP. Further large studies are required to investigate the association between genetic polymorphisms and HSP. Alternative approaches, such as genome-wide association study, are necessary to help to identify genetic risks for HSP. [ABSTRACT FROM AUTHOR]

The multiple autoimmune syndromes (MAS) consist on the presence of three or more well-defined autoimmune diseases (ADs) in a single patient. The aim of this study was to analyze the clinical and genetic characteristics of a large series of patients with MAS. A cluster analysis and familial aggregation analysis of ADs was performed in 84 patients. A genome-wide microsatellite screen was performed in MAS families, and associated loci were investigated through the pedigree disequilibrium test. Systemic lupus erythematosus (SLE), autoimmune thyroid disease (AITD), and Sjögren's syndrome together were the most frequent ADs encountered. Three main clusters were established. Aggregation for type 1 diabetes, AITD, SLE, and all ADs as a trait was found. Eight loci associated with MAS were observed harboring autoimmunity genes. The MAS represent the best example of polyautoimmunity as well as the effect of a single genotype on diverse phenotypes. Its study provides important clues to elucidate the common mechanisms of ADs (i.e., autoimmune tautology). [ABSTRACT FROM AUTHOR]

Otitis media is one of the most common childhood infections leading to doctor's visits and a leading cause of antibiotic prescriptions in children. Twin and family studies have confirmed that the predisposition of developing a bacterial middle ear infection is genetically determined. Several case-control studies have been performed to analyze genes involved in inflammatory processes in search of potential associations. Modern genome-wide association approaches that require no prior assumptions of the involvement of a given gene locus in the risk of otitis media are currently being used to identify otitis media genes, and will hopefully give more detailed information on the pathogenesis of childhood otitis media. That information could be used in finding the high-risk patient, in the prevention of the disease, and in the design of new treatments. [ABSTRACT FROM AUTHOR]

Introduction: The pathogenesis of delayed cerebral ischemia (DCI) after subarachnoid hemorrhage (SAH) remains obscure. The authors assessed the relationship of tumor necrosis factor alpha (TNF-α) and TNF-α gene polymorphisms with occurrence of DCI and poor outcome at 3 months. Methods: Serum levels of TNF-α were measured every other day until discharge in 67 patients and the mean serum levels per patient during days 0-12 were dichotomized at the median value of the whole group. TNF-α genotyping was available in 31 patients and related to serum TNF-α by means of one-way ANOVA analysis. The authors calculated hazard ratio's (HR) with corresponding 95% confidence intervals (CI) for the association with DCI by means of Cox proportional hazard analysis and odds ratio's (OR) for the association with poor clinical outcome by means of logistic regression analysis. In both analyses the authors adjusted for sex, age, amount of blood, and clinical condition at admission. Leukocytes and CRP were investigated similarly for comparison. Results: For high-serum TNF-α levels during days 0-12 adjusted HR was 0.6 (95%CI: 0.1-2.4) for DCI and adjusted OR 2.0 (95%CI: 0.4-9.0) for clinical outcome. Serum TNF-α levels were 11.4 pg/ml for wildtype TNF-α genotype and 9.7 pg/ml for the non-wildtype TNF-α genotype ( P = 0.15). For the non-wildtype TNF-α genotype the HR for DCI was 0.4 (95%CI: 0.1-2.6) and the OR for clinical outcome was 0.8 (95%CI: 0.1-4.0). Conclusion: It is unlikely that serum TNF-α or TNF-α genotype play an important role in the occurrence of DCI after SAH. [ABSTRACT FROM AUTHOR]

SLX4 coordinates three structure-specific endonucleases in the DNA damage response. One subtype of Fanconi anaemia, FA-P, has recently been attributed to biallelic SLX4 gene mutations. To investigate whether monoallelic SLX4 gene defects play some role in the inherited component of breast cancer susceptibility, in this study we resequenced the whole SLX4 coding region and flanking untranslated sections in genomic DNA samples obtained from a total of 52 German or Byelorussian patients with familial breast cancer. Selected variants were subsequently screened by RFLP or TaqMan-based assays in an extended set of 965 German breast cancer cases and 985 healthy female controls. The resequencing study uncovered four new SLX4 missense substitutions, each of them in a single breast cancer patient. Three missense substitutions (p.V197A, p.G700R and p.R1034H) were not found in a subsequent screening of 240 additional breast cancer patients, while one missense substitution (p.R237Q) was more common and was detected in a total of 12 cases (1.3%) and seven controls (0.7%) in the Hannover breast cancer study. The rare missense substitution, p.G700R, resides in the conserved BTB domain and was in silico predicted to be pathogenic. Seven additional missense polymorphisms were correlated and formed one haplotype which was, however, neither associated with breast cancer risk nor with survival from breast cancer. In summary, this study did not reveal truncating or clearly pathogenic mutations, but unravelled four new unclassified missense variants at a low frequency. We conclude that there is no evidence for a major role of SLX4 coding variants in the inherited susceptibility towards breast cancer in German and Byelorussian patients, although very rare mutations such as the p.G700R substitution could make a minor contribution. [ABSTRACT FROM AUTHOR]

Background: Obstructive sleep apnea syndrome (OSAS) is a complex disease with a strong genetic basis. One of the primary molecular domains affected by OSAS is sympathetic activity. Neuropeptide S (NPS) plays an important role in the regulation of the sleep-wakefulness cycle, anxiety states, and daytime sleepiness. It is important to study neuropeptides related to sympathetic activity regulation and how their function could be modified by genetic variants affecting the expression of these molecules. Objectives: We investigated the association of the non-synonymous polymorphism rs4751440 in the NPS precursor gene with OSAS and certain variables related to OSAS (daytime sleepiness, body mass index (BMI), insulin resistance, and blood pressure). This polymorphism causes an amino acid substitution in exon 3 of the human NPS precursor gene. Patients and methods: We included 253 OSAS patients and 70 healthy subjects. Genotyping was done by polymerase chain reaction using specific flanking primers and agarose gel electrophoresis. Daytime sleepiness, BMI, plasma levels of high-density lipoprotein, glucose, total cholesterol, insulin, triglycerides, and the homeostasis model assessment index were also determined. Results: A similar genotypic and allelic distribution was found in OSAS patients and controls. The risk of OSAS was not associated with the rs4751440 polymorphism. There was no significant interaction between daytime sleepiness or metabolic variables and the rs4751440 polymorphism. Conclusion: Genotypic and allelic frequency distribution of the rs4751440 polymorphism was similar in OSAS patients and controls. In this population-based study, we could not show a significant association between rs4751440 polymorphism and susceptibility to OSAS or certain phenotypes related to OSAS (daytime sleepiness, BMI, systolic blood pressure, and insulin resistance) with the exception of diastolic blood pressure. [ABSTRACT FROM AUTHOR]

The last decade of human genetic research witnessed the completion of hundreds of genome-wide association studies (GWASs). However, the genetic variants discovered through these efforts account for only a small proportion of the heritability of complex traits. One explanation for the missing heritability is that the common analysis approach, assessing the effect of each single-nucleotide polymorphism (SNP) individually, is not well suited to the detection of small effects of multiple SNPs. Gene set analysis (GSA) is one of several approaches that may contribute to the discovery of additional genetic risk factors for complex traits. Complex phenotypes are thought to be controlled by networks of interacting biochemical and physiological pathways influenced by the products of sets of genes. By assessing the overall evidence of association of a phenotype with all measured variation in a set of genes, GSA may identify functionally relevant sets of genes corresponding to relevant biomolecular pathways, which will enable more focused studies of genetic risk factors. This approach may thus contribute to the discovery of genetic variants responsible for some of the missing heritability. With the increased use of these approaches for the secondary analysis of data from GWAS, it is important to understand the different GSA methods and their strengths and weaknesses, and consider challenges inherent in these types of analyses. This paper provides an overview of GSA, highlighting the key challenges, potential solutions, and directions for ongoing research. [ABSTRACT FROM AUTHOR]

In an attempt to identify common disease susceptibility alleles for breast cancer, we performed a combined analysis of three genome-wide association studies (GWAS), involving 2,702 women of European ancestry with invasive breast cancer and 5,726 controls. Tests for association were performed for 285,984 SNPs. Evidence for association with SNPs in genes in specific pathways was assessed using a permutation-based approach. We confirmed associations with loci reported by previous GWAS on 1p11.2, 2q35, 3p, 5p12, 8q24, 10q23.13, 14q24.1 and 16q. Six SNPs with the strongest signals of association with breast cancer, and which have not been reported previously, were typed in two further studies; however, none of the associations could be confirmed. Suggestive evidence for an excess of associations was found for genes involved in the regulation of actin cytoskeleton, glycan degradation, alpha-linolenic acid metabolism, circadian rhythm, hematopoietic cell lineage and drug metabolism. Androgen and oestrogen metabolism, a pathway previously found to be associated with the development of postmenopausal breast cancer, was marginally significant ( P = 0.051 [unadjusted]). These results suggest that further analysis of SNPs in these pathways may identify associations that would be difficult to detect through agnostic single SNP analyses. More effort focused in these aspects of oncology can potentially open up promising avenues for the understanding of breast cancer and its prevention. [ABSTRACT FROM AUTHOR]

To elucidate a genetic predisposition to major depressive disorder, we investigated two polymorphisms (−31T/C and −511C/T) in the interleukin-1beta promoter region in patients who suffered from major recurrent depression. The aim of the current work was to compare alleles and genotype layout between patients with major recurrent depression and healthy people. We would like to indicate such combination of genotypes which corresponds with major recurrent depression. Correlations between genotypes for analyzed polymorphisms and number of episodes, number of points in Hamilton Depression Rating Scale, and age of onset were investigated as well. The study group consisted of 94 patients diagnosed with major recurrent depression. The control group included 206 healthy individuals. Both groups involved representatives of Caucasian population. Genotyping of polymorphisms was performed by using PCR-RFLP technique. A specific haplotype, composed of the C allele at −31 and the T allele at −511, has a tendency to have a statistically significant difference ( p = 0.064) between patients and control group. Correspondence analysis revealed that genotype T/T at −31 and genotype C/C at −511 are associated with major recurrent depression. No association was found between genotypes for studied polymorphic sites and number of episodes, number of points in Hamilton Depression Rating Scale, and age of onset. [ABSTRACT FROM AUTHOR]

The aim of our study was to investigate whether genetic variants in the hypocretin receptor 1 ( HCRTR1) gene could modify the occurrence and the clinical features of migraine. Using a case-control strategy we genotyped 384 migraine patients and 259 controls for three SNPs in the HCRTR1 gene. Genotypic and allelic frequencies of the rs2271933 non-synonymous polymorphism resulted different ( χ = 9.872, p = 0.007; χ = 8.108, p = 0.004) between migraineurs and controls. The carriage of the A allele was associated with an increased migraine risk (OR 1.42, 95% CI 1.11-1.81). When we divided the migraine patients into different subgroups, the difference reached the level of statistical significance only in migraine without aura. The different genotypes had no significant effect on the examined clinical characteristics of the disease. In conclusion, our data supports the hypothesis that the HCRTR1 gene could represent a genetic susceptibility factor for migraine without aura and suggests that the hypocretin system may have a role in the pathophysiology of migraine. [ABSTRACT FROM AUTHOR]

The understanding of patterns of genetic variation within and among human populations is a prerequisite for successful genetic association mapping studies of complex diseases and traits. Some populations are more favorable for association mapping studies than others. The Saami from northern Scandinavia and the Kola Peninsula represent a population isolate that, among European populations, has been less extensively sampled, despite some early interest for association mapping studies. In this paper, we report the results of a first genome-wide SNP-based study of genetic population structure in the Finnish Saami. Using data from the HapMap and the human genome diversity project (HGDP-CEPH) and recently developed statistical methods, we studied individual genetic ancestry. We quantified genetic differentiation between the Saami population and the HGDP-CEPH populations by calculating pair-wise FST statistics and by characterizing identity-by-state sharing for pair-wise population comparisons. This study affirms an east Asian contribution to the predominantly European-derived Saami gene pool. Using model-based individual ancestry analysis, the median estimated percentage of the genome with east Asian ancestry was 6% (first and third quartiles: 5 and 8%, respectively). We found that genetic similarity between population pairs roughly correlated with geographic distance. Among the European HGDP-CEPH populations, FST was smallest for the comparison with the Russians (FST=0.0098), and estimates for the other population comparisons ranged from 0.0129 to 0.0263. Our analysis also revealed fine-scale substructure within the Finnish Saami and warns against the confounding effects of both hidden population structure and undocumented relatedness in genetic association studies of isolated populations. [ABSTRACT FROM AUTHOR]

Aims/hypothesis: This meta-analysis assessed the pooled effect of each genetic variant reproducibly associated with diabetic nephropathy. Methods: PubMed, EMBASE and Web of Science were searched for articles assessing the association between genes and diabetic nephropathy. All genetic variants statistically associated with diabetic nephropathy in an initial study, then independently reproduced in at least one additional study, were selected. Subsequently, all studies assessing these variants were included. The association between these variants and diabetic nephropathy (defined as macroalbuminuria/proteinuria or end-stage renal disease [ESRD]) was calculated at the allele level and the main measure of effect was a pooled odds ratio. Pre-specified subgroup analyses were performed, stratifying for type 1/type 2 diabetes mellitus, proteinuria/ESRD and ethnic group. Results: The literature search yielded 3,455 citations, of which 671 were genetic association studies investigating diabetic nephropathy. We identified 34 replicated genetic variants. Of these, 21 remained significantly associated with diabetic nephropathy in a random-effects meta-analysis. These variants were in or near the following genes: ACE, AKR1B1 (two variants), APOC1, APOE, EPO, NOS3 (two variants), HSPG2, VEGFA, FRMD3 (two variants), CARS (two variants), UNC13B, CPVL and CHN2, and GREM1, plus four variants not near genes. The odds ratios of associated genetic variants ranged from 0.48 to 1.70. Additional variants were detected in subgroup analyses: ELMO1 (Asians), CCR5 (Asians) and CNDP1 (type 2 diabetes). Conclusions/interpretation: This meta-analysis found 24 genetic variants associated with diabetic nephropathy. The relative contribution and relevance of the identified genes in the pathogenesis of diabetic nephropathy should be the focus of future studies. [ABSTRACT FROM AUTHOR]

Efron (1997) considered several approximations of p-values for simultaneous hypothesis testing. An extension of his approaches is considered here to approximate various probabilities of correlated events. Compared with multiple-integrations, our proposed method, the parallelogram formulas, based on a one-dimensional integral, not only substantially reduces the computational complexity but also maintains good accuracy. Applications of the proposed method to genetic association studies and group sequential analysis are investigated in detail. Numerical results including real data analysis and simulation studies demonstrate that the proposed method performs well. [ABSTRACT FROM AUTHOR]