Search

Beet necrotic yellow vein virus (BNYVV) causes one of the most economically destructive diseases of sugar beet (Beta vulgaris), rhizomania, which may reduce sugar yield by 80%. This field investigation was conducted to evaluate the interactions between spinach genotypes and different BNYVV strains, and to determine whether BNYVV is transmitted through spinach seeds. Eight commercial spinach cultivars were planted in two BNYVV-infested fields and two control fields in Salinas, CA in 2009. Spinach plants in the BNYVV-infested fields showed disease symptoms of yellow-green or light-green vein clearing, mottling, or yellow-green chlorotic lesions on younger leaves as early as 28 days after planting (four- to six-true leaf stage). Leaves may also become stiff, more crinkled, and necrotic. There was an increase of lateral roots and leaf number but a decrease in leaf weight compared to healthy plants. Infected plants often became stunted, deformed, wilted, and dead. Symptomatic leaves and roots from plants with or without leaf symptoms in BNYVV-infested fields all tested positive for BNYVV by enzyme-linked immunosorbent assay. A more aggressive (resistance-breaking) strain of BNYVV led to higher disease incidence in spinach than in the wild type. BNYVV was not transmitted through spinach seeds. There were significant differences in disease development among cultivars, with disease incidence ranging from 8 to 44%, suggesting that genetic improvement of BNYVV resistance through spinach breeding should be feasible.

Historically, Beet necrotic yellow vein virus (BNYVV), which causes the disease rhizomania of sugar beet, has caused major reductions in root yield and quality wherever it occurred. In the United States, the disease was first identified in California in 1984 (12), but it now occurs in every major sugar beet production region in the country. Fortunately, strong genetic tolerance to BNYVV, conferred by the Rz1 gene, was identified soon after rhizomania was discovered in the United States, and it has been incorporated into regionally adapted cultivars that allow profitable sugar beet production in areas infested with the pathogen. Plants possessing Rz1 are susceptible to infection by P. betae and BNYVV, but virus titers remain low, and typically, infected plants exhibit normal, asymptomatic growth. However, in the Imperial Valley of California in 2002, plants in a field planted to a rhizomaniatolerant cultivar began to express symptoms of rhizomania (47). Large strips of diseased plants occurred across the field, and it was soon verified that certain isolates of BNYVV from the California Imperial Valley (CIV-BNYVV) had overcome genetic resistance. In other regions of the United States, individual plants, or clusters of plants, in fields planted to rhizomaniatolerant cultivars have also become infected by BNYVV and developed diagnostic symptoms of severe rhizomania. Although patterns of disease development have varied between California fields and those in other production regions in the United States, the breakdown of genetic resistance has caused considerable concern among those involved in sugar beet production. The purpose of this article is to provide an update on rhizomania and the activities that are currently underway to manage this continuing threat to the U.S. sugar beet industry. A review on the detection and distribution of rhizomania and soilborne viruses associated with sugar beet production in the United States (61), and a second more in-depth review on BNYVV and its vector, Polymyxa betae (Keskin) (60), have been published.

Soils naturally infested with cultures of aviruliferous Polymyxa betae and viruliferous P. betae carrying two sugar beet benyviruses, Beet necrotic yellow vein virus (BNYVV) and Beet soilborne mosaic virus (BSBMV), alone and in combination, were compared with noninfested soil for their effects on seedling emergence, plant fresh weight, and virus content as measured by enzyme-linked immunosorbent assay (ELISA). Studies examined sugar beet with and without resistance to the disease rhizomania, caused by BNYVV. The Rz gene, conferring resistance to BNYVV, did not confer resistance to BSBMV. BSBMV ELISA values were significantly higher in single infections than in mixed infections with BNYVV, in both the rhizomania-resistant and -susceptible cultivars. In contrast, ELISA values of BNYVV were high (8 to 14 times the healthy mean) in single and mixed infections in the rhizomania-susceptible cultivar, but were low (approximately three times the healthy mean) in the rhizomania-resistant cultivar. Results indicate BNYVV may suppress BSBMV in mixed infections, even in rhizomania-resistant cultivars in which ELISA values for BNYVV are extremely low. Soils infested with P. betae, and with one or both viruses, showed significantly reduced fresh weight of seedlings, and aviruliferous P. betae significantly decreased sugar beet growth in assays.

Levels of beet necrotic yellow vein virus (BNYVV), as measured by triple-antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), were compared with biological evaluations in representative commercial and experimental sugar beet cultivars developed for production in the United States and ranging in their reactions to rhizomania from uniformly susceptible to highly resistant. TAS-ELISA was specific for BNYVV and did not react with related soilborne sugar beet viruses. Differences in absorbance (A405nm) values measured in eight cultivars closely correlated with the dosage and frequency of the Rz allele, which conditions resistance to BNYVV. A diploid (Rzrz) hybrid had a significantly lower absorbance value (less virus) than a similar triploid (Rzrzrz) hybrid. Cultivars that segregated (Rzrz:rzrz) had higher absorbance values than uniformly resistant (Rzrz) hybrids, as was expected. For all cultivars, absorbance values decreased as the season progressed. Absorbance value was significantly positively correlated with rhizomania disease index score and negatively correlated with individual root weight, plot root weight, and sugar yield. This information should be useful in resistance-breeding and -evaluation programs and in the sugar industry when considering cultivar choice, inoculum production, and future crop rotations.

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

Calibrachoa mottle virus (CbMV), a tentative carmovirus, was first isolated and reported by Liu et al. (1) from infected Calibrachoa plants. During the spring of 2003, petunia samples from Florida and California sent to testing services at Agdia, Inc (Elkhart IN) tested positive for CbMV by enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay (ImmunoStrips). These samples also tested positive by carmovirus group-specific polymerase chain reaction (PCR) primers and by immunocapture PCR (2). RNA extracted from these samples with the RNeasy Plant Kit (Qiagen Inc., Valencia, CA) hybridized with a digoxigenin labeled probe derived from purified CbMV viral RNA. All plant samples that tested positive for CbMV were symptomless except one symptomatic sample that also tested positive for Tobacco mosaic virus. From samples that tested positive for CbMV only, mechanical inoculations were made to Chenopodium quinoa at a USDA-ARS greenhouse in Salinas, CA. Representative single, local lesions were used to inoculate additional C. quinoa plants. The resulting local lesions from these inoculations were freeze-dried and further used as virus inoculum (CbMV petunia). Similar inoculum was made with CbMV isolated from Calibrachoa plants (CbMV calibrachoa). Virus-free Petunia hybrida cultivars Surfinia ‘Baby Pink’ and Surfinia ‘Violet’ (Jackson and Perkins Inc., Somis, CA) were mechanically inoculated with CbMV petunia and CbMV calibrachoa. Four weeks postinoculation, all plants were tested using ELISA for the presence of CbMV. In greenhouse conditions, 14.3% of ‘Baby Pink’ plants were positive for CbMV petunia, whereas none were positive for CbMV calibrachoa. ‘Violet’ plants were 64.3 and 33.3% positive for CbMV petunia and CbMV calibrachoa, respectively. None of the positive plants expressed virus-like symptoms. Virus particles resembling those of CbMV were observed from infected petunia plants with transmission electron microscopy in leaf-dip preparations. To our knowledge, this is the first report of CbMV infecting petunia. Commercial reproduction of petunia plants and maintenance of genetic mother stock are usually by vegetative propagation. CbMV can be transmitted mechanically and is readily propagated along with its host. To produce healthy petunia plants, virus-free mother stock should be used, which requires regular screening of mother stock for CbMV. Reference: (1) H.-Y. Liu et al. Plant Dis. 87:167, 2003. (2) A. M. Harness et al. (Abstr.) Phytopathology 92:S34, 2002.

Tomato infectious chlorosis virus (TICV) is a newly described closterovirus. Virions purified from TICV-infected plants contained two single-stranded (ss) RNAs, one of approximately 7,800 (RNA 1) and the other 7,400 (RNA 2) nucleotides. Double-stranded (ds) RNA analysis showed two prominent dsRNAs of approximately 7,800 and 7,400 bp, as well as several smaller dsRNAs. The TICV virion ssRNAs were used for cDNA cloning. Of 200 cDNA clones analyzed, 10 clones containing cDNAs ranging in size from about 900 to 1,500 nucleotides were used to generate digoxigenin-UTP-labeled transcripts. These transcripts hybridized with the TICV ssRNAs in Northern blot hybridization analyses and were used in dot-blot analyses to confirm TICV infection in several host plants including tomato, potato, Physalis wrightii, Nicotiana clevelandii, and artichoke. None of the probes reacted with any uninfected host plant tested or with plants infected with four other clostero- or clostero-like viruses including lettuce infectious yellows closterovirus, lettuce chlorosis virus, cucurbit yellow stunting disorder virus, and beet pseudo yellows virus. Northern blot hybridization analyses using selected riboprobes showed no detectable homology between TICV dsRNA 1 and 2, or between subsets of smaller dsRNAs. Inclusion bodies, characteristic of the closteroviruses, were consistently associated with the phloem of TICV-infected N. clevelandii.

Collections of Bemisia tabaci from California desert regions have been shown to be a mixture of biotypes. These whitefly biotypes differ in a number of ways including their ability to induce silverleaf of squash. The physiological differences of the newly found whitefly biotype, including host preference, larval development, transmission of lettuce infectious yellows virus, and the induction of silverleaf symptoms, clearly distinguish it from the previously occurring biotype (...)