Search

Objectives: Many surgical materials promoting tissue regeneration have been explored for use in paediatric cardiac surgery. The aim of this study is to evaluate the long-term viability and extensibility of the canine aortic wall regenerated using a novel synthetic hybrid fabric., Methods: The sheet is a warp-knitted fabric of biodegradable (poly-l-lactic acid) and non-biodegradable (polyethylene terephthalate) yarns coated with cross-linked gelatine. This material was implanted as a patch to fill an oval-shaped defect created in the canine descending aorta. The tissue samples were explanted after 12, 24 or 36 months (N = 3, 2, 2, respectively) for histological examination and biomechanical testing., Results: There was no shrinkage, rupture or aneurysmal change after 24 months. The regenerated wall showed prototypical vascular healing without material degeneration, chronic inflammation, calcification or abnormal intimal overgrowth. Bridging tissue across the patch was well-formed and had expanded over time. The biodegradable yarns had completely degraded at 24 months after implantation, as scheduled, but the regenerated aortic wall demonstrated satisfactory levels of mechanical strength and extensibility in tensile strength tests., Conclusions: The sheet achieved good long-term viability and extensibility in the regenerated aortic wall. These findings suggest that it is a promising surgical material for repairing congenital heart defects. Further developments of the sheet are required, including clinical studies., (© The Author(s) 2021. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.)

Background & Aims: The new curcumin derivative Theracurmin® has a 27-fold higher absorption rate than natural curcumin powder. Theracurmin® is an inhibitor of nuclear factor-κB, which mediates the expression of inflammatory cytokines. The effect of Theracurmin® on inflammatory bowel disease in humans has not been explored; therefore, we investigated the efficacy and safety of Theracurmin® in patients with Crohn's disease., Methods: In this randomized, double-blinded study performed at 5 independent medical centers in Japan, Theracurmin® (360 mg/day, n = 20) or placebo (n = 10) was administered to patients with active mild-to-moderate Crohn's disease for 12 weeks. The agent's efficacy was assessed by evaluating clinical and endoscopic remission, healing of anal lesions, and blood levels of inflammatory markers., Results: In the Theracurmin® group, a significant reduction in clinical disease activity was observed in week 12 relative to that in week 0 (p = 0.005). On intention-to-treat analysis, clinical remission rates were 35%, 40%, and 40% at weeks 4, 8, and 12, respectively, which were significantly higher than those in the placebo group (all 0%; p = 0.033, p = 0.020, and p = 0.020, respectively). Furthermore, reduction in endoscopic Crohn's disease severity (p = 0.032) was observed at week 12 in the Theracurmin® group. The endoscopic remission rates were 15% and 0% in the Theracurmin® and placebo groups, respectively. Significant healing of anal lesions (p = 0.017) was observed at week 8 in the Theracurmin® group. No serious adverse events were observed in either group throughout the study., Conclusions: Theracurmin® shows significant clinical and endoscopic efficacy together with a favorable safety profile in patients with active mild-to-moderate Crohn's disease., Clinical Trial Umin Registration Id: UMIN000015770., (© The Author(s) 2020. Published by Oxford University Press on behalf of European Crohn’s and Colitis Organisation. All rights reserved. For permissions, please email: journals.permissions@oup.com.)

Background: Digoxin, a cardiac glycoside used for the treatment of heart failure, was reported to inhibit the retinoid-related orphan receptor gamma t (RORγt) and attenuate the severity of experimental autoimmune encephalomyelitis and arthritis in mice. However, the effects of digoxin in a mice model of inflammatory bowel disease have not been elucidated., Methods: Colitis was induced in severe combined immunodeficiency mice by adoptive transfer of CD45RB CD4 T cells. Digoxin or a vehicle was injected into mice with colitis intraperitoneally every other day and changes in body weight were evaluated. After 6 to 8 weeks, the treated mice were killed and evaluated for histological score, T-cell subset, and cytokine messenger RNA (mRNA) expression in the colonic tissue., Results: Wasting disease and histological damage were significantly attenuated in digoxin-treated mice with colitis compared with those in the vehicle-treated mice. In addition, the mRNAs of Th17-related cytokines were downregulated, whereas those of interleukin-10 were upregulated in the colonic mucosa of digoxin-treated mice. However, unexpectedly, the mRNA expression level of tumor necrosis factor alpha did not decrease in the colonic mucosa of digoxin-treated mice with colitis. This observation suggests that digoxin may ameliorate colitis by a tumor necrosis factor alpha-independent pathway., Conclusions: This study has shown for the first time that treatment with digoxin can ameliorate murine experimental colitis. This finding suggests that the suppression of Th17 using reagents such as digoxin could be effective in treating Crohn's disease refractory to anti-tumor necrosis factor alpha therapy.

Background and Aims: The Ulcerative Colitis Endoscopic Index of Severity (UCEIS) and the Mayo endoscopic score (Mayo ES) are used to evaluate ulcerative colitis (UC) severity. This study compared UCEIS and the Mayo ES for evaluating UC severity and outcomes in patients undergoing remission induction during routine clinical practice with the aim of predicting medium- to long-term prognosis., Methods: Forty-one UC patients who received colonoscopy before and after tacrolimus remission induction therapy were included. An index of clinical activity and endoscopic findings scored by both the UCEIS and the Mayo ES were determined. Changes in UCEIS and Mayo ES before and after induction therapy were compared., Results: The mean UCEIS improved from 6.2±0.9 to 3.4±2.1 (p < 0.001). Based on the UCEIS, a significant reduction was reached in both the response and the remission groups. In contrast, the Mayo ES did not reflect a significant change in the response group. The discrepancy appeared to be due to ulcers becoming smaller and shallower during the early stages of mucosal healing; the Mayo ES seems to miss these early changes. In other words, whereas the UCEIS indicates improvements when ulcers shrink, the Mayo ES does not distinguish deep ulcers from shallow ulcers and is 3 (severe UC) for both deep and shallow ulcers. Additionally, better UCEIS strata after induction therapy were associated with lower incidences of colectomy (p = 0.0001) or relapse (p = 0.0008)., Conclusions: The UCEIS accurately reflects clinical outcomes and predicts the medium- to long-term prognosis in UC patients undergoing induction therapy. These findings should support decision-making in clinical practice settings., (Copyright © 2015 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.)

Background: The Japanese Committee for Clinical Laboratory Standards (JCCLS) has developed a multianalyte conventional reference material (MacRM) for nationwide standardization of laboratory measurements., Methods: To prepare the MacRM, pooled sera were obtained from healthy Japanese individuals. Target values of the pooled sera for 30 analytes were assigned on the basis of the measurement results of 45 certified clinical laboratories whose calibration was verified by measuring certified reference materials (CRMs) provided by the National Institute of Standards and Technology, the Institute for Reference Materials and Measurements, and JCCLS. Commutability of MacRM was assessed by comparison with results for 150 individual inpatients at Fukuoka University Chikushi Hospital. Survey samples were prepared by essentially the same method for MacRM but without target values. The survey samples were used to assess agreement among 165 laboratories that used various assay kits and platforms calibrated with the MacRM., Results: The commutability of MacRM was confirmed for 30 analytes with sera from 150 individual patients. The imprecision (CV) of measurements of survey samples (high and low concentrations) among the 165 laboratories was 0.4%-10.0%. Twenty-six of 30 analytes were within the goals for interinstitutional allowable bias. An aliquot of MacRM stored frozen at -80 °C remained stable for ≥4 years., Conclusions: The MacRM was successfully applied as a calibrator to achieve nationwide standardization for 30 analytes measured by 165 laboratories that used various methods from different manufacturers., (© 2015 American Association for Clinical Chemistry.)

Ethanolamine oxidase was screened with the aim of using it to establish a novel enzymatic phosphatidylethanolamine assay. Ethanolamine oxidase activity was detected in the crude extract of Arthrobacter sp., and the enzyme was purified more than 15-fold in three steps with a 54% yield. SDS-PAGE revealed the presence of only one band, which migrated, with an apparent molecular mass of 70 kDa. Biochemical characterization of the enzyme showed phenylethylamine to be the preferred substrate, with the highest kcat/Km value. The primary structure, determined by sequencing the cloned gene, showed a high degree of identity to Cu-containing phenylethylamine oxidase (64%). When heterologously overexpressed in Escherichia coli, the enzyme exhibited only a trace of amine oxidase activity, but high levels of activity emerged after exposure to Cu2+, as is typical of recombinant copper amine oxidases. Preliminary application of this enzyme coupled with phospholipase D for determination of phosphatidylethanolamine is also described. This is the first enzymatic method for the measurement of phosphatidylethanolamine.

We investigated the degradation pathways and kinetics of 2,4-dichlorophenol (DCP) by an endemic soil fungus, Mortierella sp. (Zygomycetes). Mortierella sp. degraded 32% of added DCP (final concentration, 250 microM) within 1 h. We identified four aromatic metabolites and found two DCP degradation pathways (a hydroxylation pathway and a dechlorination pathway). This is the first report of a dechlorination pathway in Zygomycetes.

Most of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and a part of nuclear 28S ribosomal RNA gene were sequenced for 14 species of ground beetles belonging to the genus Leptocarabus. In both the ND5 and the 28S rDNA phylogenetic trees of Leptocarabus, three major lineages were recognized: (1) L. marcilhaci/L. yokoael/Leptocarabus sp. from China, (2) L. koreanus/L. truncaticollis/L. seishinensis/L. semiopacus/L. canaliculatus/L. kurilensis from the northern Eurasian continent including Korea and Hokkaido, Japan, and (3) all of the Japanese species except L. kurilensis. Clustering of the species in the trees is largely linked to their geographic distribution and does not correlate with morphological characters. The species belonging to different species groups are clustered in the same lineages, and those in the same species group are scattered among the different lineages. One of the possible interpretations of the present results would be that morphological transformations independently took place in the different lineages, sometimes with accompanying parallel morphological evolution, resulting in the occurrence of the morphological species belonging to the same species group (= type) in the different lineages.

Genealogical trees have been constructed using mitochondrial ND5 gene sequences of 78 Damaster (s. str.) specimens from all over the Japanese Islands. Eight lineages (called races in this paper) have been recognized. The races are tightly linked to geography with sharp distribution boundaries between them. The races and their distribution ranges do not coincide with those of classical morphology. Based on the observed distribution of the mitochondrial DNA haplotypes and the geohistorical data, we propose a diversification scenario of Damaster.

We characterized six self-indicating substrates, synthesized as the derivative compounds of acetylphenyl phosphate, for serum prostatic acid phosphatase (PAP) activity. One of the substrates, 2,6-dichloro-4-acetylphenyl phosphate (DCAPP), is superior to others in terms of stability, affinity, and low Km for PAP. The hydrolyzed product, 2,6-dichloro-4-acetylphenol (DCAP), has a maximum absorption at 334.2 nm, a pKa of 4.15, and a molar absorptivity at 340 nm of 21,490 L.mol-1.cm-1 in citrate-HCl buffer, pH 5.4. PAP activity was assessed by subtracting tartaric acid-inhibited acid phosphatase activity from total acid phosphatase activity. Our assay system involving DCAPP is a unique kinetic method that shows good reproducibility, wide analytical dynamic range, and high specificity for PAP. Moreover, it is easily adaptable to automated analyzers because the product, DCAP, can be monitored at 340 nm.

It has been reported that CUG, a universal leucine codon, is read as serine in an asporogenic yeast, Candida cylindracea. The distribution of this non-universal genetic code in various yeast species was studied using an in vitro translation assay system with a synthetic messenger RNA containing CUG codons in-frame. It was found that CUG is used as a serine codon in six out of the fourteen species examined, while it is used for leucine in the remaining eight. The tRNA species responsible for the translation of codon CUG as serine was detected in all the six species in which CUG is translated as serine. The grouping according to the CUG codon assignments in these yeast species shows a good correlation with physiological classification by the chain lengths of the isoprenoid moiety of ubiquinone and the cell-wall sugar contained in the yeasts. The six Candida species examined in which CUG is used as serine belong to one distinct group in Hemiascomycetes.

In Mycoplasma capricolum, a relative of Gram-positive eubacteria with a high genomic AT-content (75%), codon UGA is assigned to tryptophan instead of termination signal. Thus, in this bacterium the release factor 2 (RF-2), that recognizes UAA and UGA termination codons in eubacteria such as Escherichia coli and Bacillus subtilis, would be either specific to UAA or deleted. To test this, we have constructed a cell-free translation system using synthetic mRNA including codon UAA [mRNA(UAA)], UAG [mRNA(UAG)] and UGA [mRNA(UGA)] in-frame. In the absence of tryptophan, the translation of mRNA(UGA) ceased at UGA sites without appreciable release of the synthesized peptides from the ribosomes, whereas with mRNA(UAA) or mRNA(UAG) the bulk of the peptides was released. Upon addition of the E.coli S-100 fraction or B.subtilis S-100 fraction to the translation system, the synthesized peptides with mRNA(UGA) were almost completely released from the ribosomes, presumably because of the presence of RF-2 active to UGA in the added S-100 fraction. These data suggest that RF-2 is deleted or its activity to UGA is strongly weakened in M.capricolum.

Transfer RNAs of Mycoplasma capricolum were separated by two-dimensional polyacrylamide gel electrophoresis, and the relative abundance of each of the 28 known tRNA species was measured. There existed a correlation between the relative amount of isoacceptor tRNAs and the frequency in choosing synonymous codons that could be translated by the isoacceptors. Furthermore, it was observed that the total amount of tRNAs for a particular amino acid was paralleled by the composition of the amino acid in ribosomal proteins. A similar relationship was obtained from reexamination of the previous data on Escherichia coli tRNAs, suggesting that the amount of tRNAs for an amino acid is affected by the usage of the amino acid in proteins.

The genes for presumably all the tRNA species in Mycoplasma capricolum, a derivative of Gram-positive eubacteria, have been cloned and sequenced. There are 30 genes encoding 29 tRNA species. This number is the smallest in all the known genetic systems except for mitochondria. The sequences of 9 tRNA genes of them have been previously reported (1-3). Twenty-two genes are organized in 5 clusters consisting of nine, five, four and two genes (2 sets), respectively. The other eight genes exist as a single transcription unit. All the tRNAs are encoded each by a single gene, except for the occurrence of two tRNA(Lys)(TTT) genes. The arrangement of tRNA genes in the 9-gene cluster, the 5-gene cluster, the 4-gene cluster and one of the 2-gene clusters reveals extensive similarity with a part of the 21-tRNA gene cluster and/or the 16-tRNA gene cluster in Bacillus subtilis, respectively. The results suggest that the present M. capricolum tRNA genes have evolved from large tRNA gene clusters in the ancestral Gram-positive bacterial genome common to M. capricolum and B. subtilis, by discarding genes for redundant as well as non-obligate tRNAs, so that all the codons may be translated by as small a number of tRNAs as possible.

The GC (G + C, or G or C)-contents of codon silent positions in all two-codon sets and three codons AUY/A (IIe), and in most of the family boxes of Micrococcus luteus (genomic GC-content: 74%) are 95% to 100% in both the highly and weakly expressed genes. In some family boxes, there is a decrease in NNC codons and an increase in NNG codons from the highly expressed to weakly expressed genes without apparent involvement of NNU and NNA codons. From these observations, we conclude that the selective use of synonymous codons in M. luteus may be largely determined by GC-biased mutation pressure and that in the highly expressed genes tRNAs would act as a weak selection pressure in some family boxes. Available data suggest that the effect of selection pressure by tRNAs on the synonymous codon choice becomes more apparent in the highly expressed genes in eubacteria with intermediate GC-contents such as Escherichia coli and Bacillus subtilis, and that the U/C ratio of the codon third positions in NNU/C-type two-codon sets in the weakly expressed genes would represent the approximate magnitude of directional mutation pressure throughout eubacteria.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.

Two approaches were used to study the possible role of calmodulin in the regulation of synthesis of testosterone by Leydig cells: trifluoperazine was used as an inhibitor of calmodulin and liposomes were used to deliver calmodulin into the cells. The inhibitor prevented the expected responses of Leydig cells to LH and to cAMP. First the increase in synthesis of testosterone produced when these agents are added to Leydig cells was inhibited by the drug. Second, increased transport of cholesterol to mitochondria produced by LH and cAMP was inhibited by trifluoperazine. Third, increased side-chain cleavage of cholesterol (cholesterol leads to pregnenolone) produced by these agents in isolated mitochondria was also inhibited by the drug. When Leydig cells were incubated with liposomes containing calmodulin, production of testosterone, transport of cholesterol to mitochondria, and side-chain cleavage of cholesterol were all stimulated. The effect of calmodulin is greater if Ca2+ is added before incorporation into liposomes than if calmodulin and Ca2+ are introduced into the Leydig cells from separate liposomes. Stimulation of testosterone synthesis does not occur if calmodulin is dialyzed against EGTA, if calmodulin with excess anticalmodulin is present in the liposomes, if either calmodulin or Ca2+ is added to the medium (no liposomes), or if Ca2+ alone is present in liposomes. These observations suggest that calmodulin is involved in regulating the transport of cholesterol to mitochondria, a process that is stimulated by LH and cAMP and one that may account for the increased steroid synthesis produced by these agents.

The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the red algae are phylogenically distinct from green and brown algae, and they, Porphyra in particular, are evolutionally most ancient among the eukaryotes of which 5S rRNA sequence has been determined.

The nucleotide sequence of the 1.3 kilobase-pair DNA segment, which contains the genes for ribosomal proteins S8 and L6, and a part of L18 of Mycoplasma capricolum, has been determined and compared with the corresponding sequence in Escherichia coli (Cerretti et al., Nucl. Acids Res. 11, 2599, 1983). Identities of the predicted amino acid sequences of S8 and L6 between the two organisms are 54% and 42%, respectively. The A + T content of the M. capricolum genes is 71%, which is much higher than that of E. coli (49%). Comparisons of codon usage between the two organisms have revealed that M. capricolum preferentially uses A- and U-rich codons. More than 90% of the codon third positions and 57% of the first positions in M. capricolum is either A or U, whereas E. coli uses A or U for the third and the first positions at a frequency of 51% and 36%, respectively. The biased choice of the A- and U-rich codons in this organism has been also observed in the codon replacements for conservative amino acid substitutions between M. capricolum and E. coli. These facts suggest that the codon usage of M. capricolum is strongly influenced by the high A + T content of the genome.

The nucleotide sequences of 5S rRNAs from two Annelida species, Perinereis brevicirris and Sabellastarte japonica, and an Echiura species, Urechis unicinctus have been determined. Their sequences are all 120 nucleotides long. The sequence similarity percents are 88% (Perinereis/Sabellastarte), 90% (Sabellastarte/Urechis) and 92% (Perinereis/Urechis), indicating that the Echiura is indistinguishable from the Annelida by their 5S rRNAs. The 5S rRNA sequences from the Annelida/Echiura are most related to those from the Nemertinea (87%), the Mollusca (87%) and the Rotifera (88%).

The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

The nucleotide sequences of cytoplasmic 5S rRNA from four bryophytes, Marchantia polymorpha, Lophocolea heterophylla, Plagiomnium trichomanes and Anthoceros punctatus have been determined. These RNAs are 119 nucleotides long except for the Anthoceros RNA that has 118 nucleotides. Their sequences are highly similar to each other (91-99% identity) and are more related to those from seed plants (78-83% identity) than to those from green algae (61-73% identity).

The nucleotide sequences of 5S rRNAs from two nemerteans (ribbon worms), Lineus geniculatus and Emplectonema gracile have been determined. Emplectonema has two 5S rRNA species that are composed of 119 and 120 nucleotides, respectively. The sequences of these two 5S rRNAs differ at 22 positions. On the other hand, only a single 5S rRNA species was found in Lineus. The sequence similarity percents are 88% (Lineus/Emplectonema longer 5S rRNA), 82% (Emplectonema longer/Emplectonema shorter) and 80% (Lineus/Emplectonema shorter). The comparisons of these sequences with those of other organisms suggest that the phylum Nemertinea is most related to the Mollusca (91%) and the Rotifera (89%), but not to fresh-water planarias (72%).

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

With the aid of two monospecific antibodies raised in rabbits (antimouse erythrocyte spectrin and antimouse brain spectrin), the presence of a spectrin-like protein was demonstrated in mouse adrenal tumor (Y-1) cells. Y-1 cells contain two large polypeptides, with mol wt characteristic of nonerythroid spectrin alpha- and beta-subunits (240,000 and 235,000). When proteins from plasma membranes of Y-1 cells were electrophoretically transferred to a nitrocellulose membrane, two polypeptides with mol wt of 240,000 and 225,000 were specifically stained with antimouse erythrocyte (rbc) spectrin immunoglobulin G (IgG). The rbc spectrin antibody was used to immunoprecipitate Y-1 spectrin from a neutral detergent (physiological ionic strength) cell extract. The 240,000 (alpha)- and 235,000 (beta)-dalton polypeptides were immunoprecipitated in a 1:1 molar ratio, despite the fact that the antibody recognizes only the alpha-subunit. Two-dimensional chymotryptic peptide-mapping analysis indicated that the 240,000- and 235,000-dalton subunits of Y-1 adrenal tumor spectrin are structurally unique and share limited homology with mouse rbc spectrin alpha- and beta-subunits, but are nearly identical to the mouse brain spectrin 240,000-dalton alpha-subunit and 235,000-dalton beta-subunit. Indirect immunofluorescence with anti-rbc or antibrain spectrin IgG and goat antirabbit IgG conjugated with rhodamine demonstrated intense staining at the plasma membrane and throughout the cytoplasm of Y-1 cells, with little staining within the nucleus.

The nucleotide sequences of 5S rRNA from a multicellular green alga Ulva pertusa, and multicellular brown algae Eisenia bicyclis and Sargassum fulvellum, have been determined. The 5S rRNA from Ulva is composed of 120 nucleotides, and those from Eisenia and Sargassum have 118 nucleotides. The nucleotide sequence of Ulva 5S rRNA is rather similar to 5S rRNAs from unicellular green algae and higher plants, while those of Eisenia and Sargassum 5S rRNAs are unique.

The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average).

The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

Sertoli cells prepared from rats ages 15 and 25 days were shown to contain a spectrin-like protein. Indirect immunofluorescence with monospecific antimouse erythrocyte immunoglobulin G (IgG) and with monospecific antimouse brain spectrin IgG revealed specific staining in Sertoli cells. Both antibodies precipitated two spectrin-like peptides of 240,000 and 235,000 daltons from cells solubilized with octyl glucoside. Proteins from Sertoli cell membranes were separated by electrophoresis on polyacrylamide gels containing sodium dodecyl sulfate and electrophoretically transferred to nitrocellulose membrane. Incubation of nitrocellulose membrane with either of the two antibodies, followed by horseradish peroxidase conjugated to second antibody, revealed only the larger, or alpha, spectrin subunit (Western blots). Both antibodies were used to provide immunoautoradiographic identification of the spectrin-like protein. In this procedure, spectrin and Sertoli cell membranes were shown to compete with [125I]-labeled spectrin from mouse erythrocytes for binding to antimouse erythrocyte spectrin IgG. Finally, two-dimensional proteolytic mapping of the 240,000- and 235,000-dalton peptides demonstrated limited spot homology with rat erythrocyte spectrin. However, subcellular fractions from Sertoli cells all contained a spectrin-like protein showing high homology from fraction to fraction. It is concluded that Sertoli cells contain a spectrin-like protein that is seen in cell fractions prepared by centrifugation, i.e., mitochondria, microsomes, nuclei, cytoplasm, and plasma membranes. Although homology with spectrin from erythrocytes or brain is not seen in peptide maps, the alpha subunit shares antigenic determinants with spectrin from erythrocytes. The beta subunit is believed to be precipitated by antispectrin as the result of binding to the alpha subunit, since the beta subunit shows no detectable antigenic homology with that of spectrin.

The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average).

A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae.

Preparations of cytoskeleton from Y-1 cells were found to phosphorylate various cytoskeletal proteins when incubated with [gamma-32P]ATP. When cAMP was added to the cytoskeleton, a rapid increase in phosphorylation of cytoskeletal protein was observed, and changes were seen in the phosphorylation of individual proteins; four additional proteins were phosphorylated (mol wt, 165,000, 92,000, 45,000, and 24,000) and three proteins were more intensely phosphorylated than without cAMP (mol wt, 125,000, 51,000, and 38,000). In addition, one protein (mol wt, 96,000) that was intensely phosphorylated without cAMP was not phosphorylated with the cyclic nucleotide, and a second (mol wt, 48,000) was less phosphorylated. The increased level of total phosphorylation returned to the unstimulated level within 10 min. The increased phosphorylation of proteins produced by cAMP was inhibited by protein kinase inhibitor. cAMP-dependent protein kinase activity was closely associated with the cytoskeleton, since it was not removed by Triton X-100 (1%, wt/vol), although some activity could be extracted with buffer containing high concentrations of salt. When the cytoskeleton of Y-1 cells was subjected to treatments that disrupt the cytoskeleton before the cells were extracted (cytochalasin B, colchicine, and sonication), no change was seen in cAMP-dependent protein kinase activity. However, cytochalasin B increased phosphorylation of two proteins that were not phosphorylated by cAMP-dependent kinase (mol wt, 63,000 and 43,000). Sonication of the cytoskeleton before addition of [gamma-32P]ATP caused a number of changes in cAMP-independent phosphorylation, but did not affect cAMP-dependent phosphorylation. cAMP-dependent phosphorylation required Mg2+ and was inhibited by Ca2+. It is concluded that the cytoskeleton of Y-1 cells contains bound cAMP-dependent protein kinase that phosphorylates certain cytoskeleton proteins. The cytoskeleton also contains one or more cAMP-independent kinase systems. It is suggested that the cAMP-dependent protein kinase described here may be important in the cytoskeletal responses to ACTH.

Highly purified plasma membranes from Y-1 adrenal tumor cells were incubated with [gamma-32P]ATP with and without cAMP to determine whether endogenous protein substrates are phosphorylated by a cAMP-dependent protein kinase. Three membrane proteins (mol wt 270,000, 35,000, and 17,000) were phosphorylated without cAMP and, to a greater extent, with the nucleotide (0.05-20 microM). Phosphorylation was rapid (less than 60 sec), specific for cAMP, and occurred exclusively at serine residues. Two of the three proteins (35,000 and 17,000) were phosphorylated in whole cells under the influence of cAMP when the cells were incubated with [32P]orthophosphate. The cAMP-dependent protein kinase of these plasma membranes was not extracted by Triton X-100 (0.5% wt/vol) nor by KCl (0.4 M) but was almost completely extracted by the two agents together. By means of photoactivation of 8-azido-[32P]cAMP, it was found that both regulatory subunits RI and RII are present in the membranes. To the extent that the second messenger acts only by way of protein kinase enzymes, these changes in the three proteins are likely to be important in the responses of the plasma membranes of adrenal cells to ACTH.

The nucleotide sequences of 5S rRNA from seven denitrifying bacteria have been determined. Based on these sequences and those reported in the literature (including two denitrifiers), a phylogenic tree of 104 eubacterial 5S rRNA sequences has been constructed to establish the position of the denitrifying bacteria. These bacteria belong to either one of the three major subgroups of gram-negative bacteria. The grouping based on 5S rRNA sequences is almost compatible with the type of the nitrite reductases, with the one apparent exception of Paracoccus denitrificans ATCC 13543. Moreover, the separation time of most of the denitrifying bacteria from other non-denitrifying bacteria belonging to the same subgroup is recent. These results suggest that the denitrifying systems in these bacteria would have developed polyphyletically, and not so anciently, during eubacterial evolution.

The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates.