Search

The nucleotide sequence of spinach chloroplast methionine elongator tRNA (sp. chl. tRNAm Met) has been determined. This tRNA is considerably more homologous to E. coli tRNAm Met (67% homology) than to the three known eukaryotic tRNAm Met (50-55% homology). Sp. chl. tRNAm Met, like the eight other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.

Physicochemical experiments were performed in order to get further evidence of the formation of complexes between iron-sulfur proteins and flavoproteins from spinach chloroplast and beef adrenal cortex electron-transfer systems. With both spinach and adrenal iron-sulfur protein-flavoprotein systems, characteristic difference circular dichroism (CD) spectra between the sum of CD spectra of the respective proteins and the CD spectrum of a mixture with a molar ratio of one to one were obtained in the visible and far-ultraviolet regions. By differential scanning calorimetry (DSC) measurements, ferredoxin and ferredoxin-NADP reductase were found to be stabilized against heat treatment upon mixing: (1) the apparent denaturation temperatures of ferredoxin and the reductase increased by about 18 and 5 degree C, respectively, and (2) the activation energy of the denaturation reaction increased by about 50%. These results lead to the conclusion that the iron-sulfur protein and flavoprotein from a tightly bound complex, and suggest that the complex formation alters both the environments of the iron-sulfur and flavin chromophores and the contents of the ordered structures, resulting in stabilization of the proteins.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

Short base-paired RNA fragments, and fragments containing intra-RNA cross-links, were isolated from E. coli 23S rRNA or 50S ribosomal subunits by two-dimensional gel electrophoresis. The interactions thus found were used as a first basis for constructing a secondary structure model of the 23S rRNA. Sequence comparison with the 23S rDNA from Z. mays chloroplasts, as well as with the 16S (large subunit) rDNA from human and mouse mitochondria, enabled the experimental model to be improved and extrapolated to give complete secondary structures of all four species. The structures are organized in well-defined domains, with over 450 compensating base changes between the two 23S species. Some ribosomal structural "'switches" were found, one involving 5S rRNA.

We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

A rapid and simple method for constructing restriction maps of large DNAs (100-200 kb) is presented. The utility of this method is illustrated by mapping the Sal I, Sac I, and Hpa I sites of the 152 kb Atriplex triangularis chloroplast genome, and the Sal I and Pvu II sites of the 155 kb Cucumis sativa chloroplast genome. These two chloroplast DNAs are very similar in organization; both feature the near-universal chloroplast DNA inverted repeat sequence of 22-25 kb. The positions of four different genes have been localized on these chloroplast DNAs. In both genomes the 16S and 23S ribosomal RNAs are encoded by duplicate genes situated at one end of the inverted repeat, while genes for the large subunit of ribulose-1,5-bisphosphate carboxylase and a 32 kilodalton photosystem II polypeptide are separated by 55 kb of DNA within the large single copy region. The physical and genetic organization of these DNAs is compared to that of spinach chloroplast DNA.

The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.

The nucleotide sequence of 16S rDNA from Euglena gracilis chloroplasts has been determined representing the first complete sequence of an algal chloroplast rRNA gene. The structural part of the 16S rRNA gene has 1491 nucleotides according to a comparative analysis of our sequencing results with the published 5'- and 3'-terminal "T1-oligonucleotides" from 16S rRNA from E. gracilis. Alignment with 16S rDNA from Zea mays chloroplasts and E. coli reveals 80 to 72% sequence homology, respectively. Two deletions of 9 and 23 nucleotides are found which are identical in size and position with deletions observed in 16S rDNA of maize and tobacco chloroplasts and which seem to be characteristic for all chloroplast rRNA species. We also find insertions and deletions in E. gracilis not seen in 16S rDNA of higher plant chloroplasts. The 16S rRNA sequence of E. gracilis chloroplasts can be folded by base pairing according to the general 16S rRNA secondary structure model.

A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch.

The nucleotide sequence of a spinach chloroplast proline tRNA (sp. chl. tRNApro) has been determined. This tRNA shows more overall homology to phage T4 proline tRNA (61% homology) than to eukaryotic proline tRNAs (53% homology) or mitochondrial proline tRNAs (36-49% homology). Sp. chl. tRNApro, like all other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihyrouridine loop and lacks unusual structural features which have been found in many mitochondrial tRNAs.