Search

The nucleotide sequence of spinach chloroplast methionine elongator tRNA (sp. chl. tRNAm Met) has been determined. This tRNA is considerably more homologous to E. coli tRNAm Met (67% homology) than to the three known eukaryotic tRNAm Met (50-55% homology). Sp. chl. tRNAm Met, like the eight other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.

Two fractions of phenylalanine tRNA (tRNA(Phe) (1) and tRNA(Phe) (2)) were purified by BD-cellulose and RPC-5 chromatography of crude tRNA isolated from barley embryos. Successive RPC-5 rechromatography runs of tRNA(Phe) (2) showed its conversion into more stable tRNA(Phe) (1), suggesting that the two fractions have essentially the same primary structure. Both tRNA(Phe) (1) and tRNA(Phe) (2) had about the same acceptor activity, but tRNA(Phe) (2) was aminoacylated much faster than tRNA(Phe) (1). RPC-5 chromatography of crude aminoacylated tRNA showed higher contents of phe-tRNA(Phe) (2) than of phe-tRNA(Phe) (1) but the ratio of these two fractions estimated by relative fluorescence intensity was about 1. Fluorescence spectra of tRNA(Phe) from barley embryos suggest that it contains Y base similar to Y(w) from wheat tRNA(Phe).

The 3'-terminal sequences of 18S rRNA from chicken reticulocyte, mouse sarcoma, rat liver, rabbit reticulocyte and barley embryo were determined by the direct chemical sequencing method. The regions sequenced show complete homology for the first 73 nucleotides. A sequence 5'-proximal to the m6(2)Am6(2)A residues that is complementary to eukaryotic 5S RNAs is totally conserved. This supports the hypothesis that base-paired interaction between 5S and 18S rRNA, which are present in the large and small ribosomal subunits respectively, may be involved in the reversible association of ribosomal subunits during protein synthesis.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.

The prominent satellites of the Cucurbitaceae Cucumis melo (melon) and Cucumis sativus (cucumber) have been characterized, in actinomycin/CsCl gradients where the satellite sequences can be separated from ribosomal, organelle, and main band DNA the location of the satellites is different indicating a different GC content. The purified satellite of C. melo is cut by HindIII into a repeat unit of 380 bp; AluI digestion gives rise to two bands (about 80 and 220 bp in size). The HindIII repeat unit if cloned into pBR325 exhibits new recognition sites for HpaII leaving two bands with 150 and 80 bp suggesting methylation of the C/CGG cutting site in the uncloned material. The restriction pattern indicates an internal sequence repeat within the 380 bp HindIII fragment. The C. sativus satellite is cut by AluI to a repeat unit of 180 bp showing no other recognition site for the restriction enzymes tested so far. About 10% sequence homology has been determined between the C. melo and C. sativus satellites by cross hybridization studies. A high methylation degree of cytosines has been measured for both satellites and the ribosomal DNA of C. sativus (about 30%). No transcription products of the C. melo satellite were found during seedling development.

Small nuclear ribonucleoprotein particles containing the five major nucleoplasmic snRNAs U1, U2, U4, U5 and U6 as well as two smaller sized snRNAs were purified from broad bean nuclear extracts by anti-m3G, monoclonal antibody, immunoaffinity chromatography. We have so far defined 13 polypeptides of approximate mol. wts. of 11 kd, 11.5 kd, 12.5 kd, 16 kd, 17 kd, 17.5 kd, 18.5 kd, 25 kd (double band), 30 kd, 31 kd, 35 kd, 36 kd and 54 kd. Upon fractionation of the UsnRNPs by anion exchange chromatography, essentially pure U5 snRNPs were obtained, containing the 11 kd, 11.5 kd, 12.5 kd, 16 kd, 17 kd, 17.5 kd, 35 kd and 36 kd polypeptides. These may therefore represent the common snRNP polypeptides and which may also be present in the other snRNPs. By immunoblotting studies, using anti-Sm sera and mouse monoclonal antibodies we show that the 35 kd and 36 kd proteins are immunologically related to the mammalian common B/B' proteins. The broad bean 16 kd and 17 kd proteins appear to share structural elements with the mammalian D protein. The three proteins of mol. wts. 11 kd, 11.5 kd and 12.5 kd probably represent the broad bean polypeptides E, F, and G. Cross-reactivity of proteins of mol. wts of 30 kd and 31 kd with Anti-(U1/U2)RNP antibodies suggests that they may represent the broad bean A and B" polypeptides. The 54 kd protein and the 18.5 kd protein could be candidates for the U1 specific 70 k and C polypeptides. Our results demonstrate a strong similarity between the overall structure of broad bean and mammalian snRNPs.

We have re-examined the nucleotide sequence of Vicia faba (broad bean) 5.8S rRNA using partial chemical degradation and a new approach to high temperature (65-80 degrees C) sequencing gels. The results indicate that the secondary structure was not completely disrupted in previous studies (Tanaka, Y., Dyer, T.A. and Brownlee, G.G. (1980) Nucleic Acid Res. 8, 1259-1272) and explain ambiguities between the nucleotide sequence and T1 ribonuclease digests. Despite this revision, estimates in the secondary structure suggest that this 5.8S rRNA differs from previously examined examples in two respects, more open conformations in both the "GC-rich" and "AU-rich" stems. The secondary structure was probed under a variety of ionic conditions using limited pancreatic and T1 ribonuclease digestion and rapid gel sequencing techniques. These studies and theoretical considerations generally supported the "burp gun" model previously proposed for all 5.8S rRNAs and were inconsistent with the recently suggested "cloverleaf" configuration. More importantly, they were also consistent with more open stem structures in this higher plant.

5S rRNAs from Spinacea oleracea cytoplasmic and chloroplastic ribosomes have been subjected to digestion with the single strand specific nuclease S1 and to chemical modification of cytidines by sodium bisulphite in order to probe the RNA structure. According to these data, cytoplasmic 5S rRNA can be folded as proposed in the general eukaryotic 5S rRNA structure (1) and 5S rRNA from chloroplastides is shown to be more related to the general eubacterial structure (2).

A low molecular weight allergen fragment present in the pea dialysate fraction was purified by ion-exchange chromatography and gel filtration. The highly purified allergen fragment inhibits both antigen-indiced passive cutaneous anaphlaxix reactions in guinea-pigs sensitized with rabbit anti-pea extract sera and Prausnitz-Küstner reactions in non-allergic volunteers sensitized with the sera of patients sensitive to green peas. Preliminary analysis of the purified allergen fragment indicates that it is a glycoprotein with a molecular weight of 1800 +/- 250.

Two small nuclear RNA species (U6 RNA and a 4.5SI-like RNA) not described so far for plants were detected in broad bean (Vicia faba L.) nuclei. U6 RNA is 98 nucleotides long, contains psi and methylated nucleotides and shows a surprisingly high degree of sequence homology (80%) with its rat counterpart, particularly in the middle part (a 57 nucleotide-long stretch) of the molecule, where it amounts to 98%. The 4.5SI-like RNA, similar in its structure to 4.5SI RNA detected so far only in rodent nuclei, is 94 nucleotides long, contains psi and an unidentified nucleotide and exhibits 52% overall sequence homology with rat 4.5SI RNA. A block of 20 consecutive nucleotides at the 5' end of the molecule is conserved between broad bean 4.5SI-like RNA and rat 4.5SI RNA. The presence of the two RNA polymerase III internal promoter consensus sequences in 4.5SI-like RNA suggests that it is an RNA polymerase III transcript.

Short base-paired RNA fragments, and fragments containing intra-RNA cross-links, were isolated from E. coli 23S rRNA or 50S ribosomal subunits by two-dimensional gel electrophoresis. The interactions thus found were used as a first basis for constructing a secondary structure model of the 23S rRNA. Sequence comparison with the 23S rDNA from Z. mays chloroplasts, as well as with the 16S (large subunit) rDNA from human and mouse mitochondria, enabled the experimental model to be improved and extrapolated to give complete secondary structures of all four species. The structures are organized in well-defined domains, with over 450 compensating base changes between the two 23S species. Some ribosomal structural "'switches" were found, one involving 5S rRNA.

We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

A rapid and simple method for constructing restriction maps of large DNAs (100-200 kb) is presented. The utility of this method is illustrated by mapping the Sal I, Sac I, and Hpa I sites of the 152 kb Atriplex triangularis chloroplast genome, and the Sal I and Pvu II sites of the 155 kb Cucumis sativa chloroplast genome. These two chloroplast DNAs are very similar in organization; both feature the near-universal chloroplast DNA inverted repeat sequence of 22-25 kb. The positions of four different genes have been localized on these chloroplast DNAs. In both genomes the 16S and 23S ribosomal RNAs are encoded by duplicate genes situated at one end of the inverted repeat, while genes for the large subunit of ribulose-1,5-bisphosphate carboxylase and a 32 kilodalton photosystem II polypeptide are separated by 55 kb of DNA within the large single copy region. The physical and genetic organization of these DNAs is compared to that of spinach chloroplast DNA.

RPC 5 (Reversed Phase Chromatography) of aminoacyl-tRNA's from healthy and crown gall (induced by Agrobacterium tume-faciens strain B6) tobacco tissues were compared for eleven amino acids. For ten amino acids: alanine, arginine, glutamic acid, glycine, isoleucine, leucine, lysine, methionine, tyrosine, and valine, no qualitative or quantitative differences could be detected between aminoacyl-tRNA's from both sources. Phenylalanyl-tRNA's from crown gall tissues gave two peaks on RPC 5; the minor early eluting species (peak 1) was always absent in elution profiles of phenylalanyl-tRNA's from healthy tissues or from tobacco leaves. After the "Y" base was removed by pH 2.9 treatment, peak 2 of phenylalanine tRNA was shifted to the position of peak 1.

The nucleotide sequence of a spinach chloroplast valine tRNA (sp. chl. tRNA Val) has been determined. This tRNA shows essentially equal homology to prokaryotic valine tRNAs (58-65% homology) and to the mitochondrial valine tRNAs of lower eukaryotes (yeast and N. crassa, 61-62% homology). Sp. chl. tRNA Val shows distinctly lower homology to mouse mitochondrial valine tRNA (53% homology) and to eukaryotic cytoplasmic valine tRNAs (47-53% homology). Sp. chl. tRNA Val, like all other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihydrouridine loop and lacks unusual structural features which have been found in several mitochondrial tRNAs.

This paper describes the minimum length of the turnip yellow mosaic virus (TYMV) RNA necessary to fulfill the tRNA-like properties of the viral RNA: 50 to 75 nucleotides and 86 nucleotides from the 3' end of TYMV RNA are sufficient for adenylation and valylation respectively by the Escherichia coli system. The size of the tRNA-like fragments obtained in vitro in the presence of an E. coli, a reticulocyte or a chinese cabbage leaf extract has also been determined. Among the major fragments liberated from the 3' end of TYMV RNA by the three systems are fragments of 117 and 112 nucleotides. In addition, the E. coli extract liberates fragments of 139 and 61 nucleotides, and the reticulocyte lysate fragments of 109, 94, 84, 73 and 46 nucleotides. The cleavage of the viral RNA by several systems in vitro to yield RNA fragments encompassing the tRNA-like sequence suggests that such fragments might also be liberated in vivo.

Digestion of plant chromatin from Brassica pekinensis and Matthiola incana with staphylococcus nuclease leads to a DNA repeat of 175 plus or minus 8 and a core size of 140 base pairs. DNase I digestion results in multiples of 10 bases. Ribosomal RNN genes were studied as a model system for active plant chromatin because of their great redundancy and their high transcriptional activity in growing and differentiating tissues. The actively transcribed genes were identified by nascent RNA of ribosomal origin still attached to its matrix DNA. Hybridization techniques were used to demonstrate that even transcriptionally active gene sequences are present in nuclease generated chromatin subunits. Comparison of the DNase I kinetics of chromatin digestion with the amount of ribosomal RNA genes which is available for hybridization at the given times indicated that ribosomal RNA genes are digested, but not preferentially degraded by DNase I.

A method is presented for the rapid isolation of high molecular weight plant DNA (50,000 base pairs or more in length) which is free of contaminants which interfere with complete digestion by restriction endonucleases. The procedure yields total cellular DNA (i.e. nuclear, chloroplast, and mitochondrial DNA). The technique is ideal for the rapid isolation of small amounts of DNA from many different species and is also useful for large scale isolations.

The nucleotide sequence of 16S rDNA from Euglena gracilis chloroplasts has been determined representing the first complete sequence of an algal chloroplast rRNA gene. The structural part of the 16S rRNA gene has 1491 nucleotides according to a comparative analysis of our sequencing results with the published 5'- and 3'-terminal "T1-oligonucleotides" from 16S rRNA from E. gracilis. Alignment with 16S rDNA from Zea mays chloroplasts and E. coli reveals 80 to 72% sequence homology, respectively. Two deletions of 9 and 23 nucleotides are found which are identical in size and position with deletions observed in 16S rDNA of maize and tobacco chloroplasts and which seem to be characteristic for all chloroplast rRNA species. We also find insertions and deletions in E. gracilis not seen in 16S rDNA of higher plant chloroplasts. The 16S rRNA sequence of E. gracilis chloroplasts can be folded by base pairing according to the general 16S rRNA secondary structure model.

50 to 55% of tobacco and barley nuclear DNA is accessible to micrococcal endonuclease digestion. The DNA fragments resulting from a mild endonuclease treatment are multiples of a basic unit of 194 +/- 6 base pairs in tobacco and 195 +/- 6 base pairs in barley. After extensive digestion, a DNA fragment of approximately 140 base pairs is predominant. Hence the "extra-core" or "linker"-DNA is 55 base pairs long. Other fragments having 158 and less than 140 base pairs are present as well. Treatment with DNase I results in multiples of 10 bases when analysed under denaturating conditions. These results show that the general organization of the DNA within the nucleosomes is about the same in higher plants as in other higher eukaryotes.

Secondary structure models are presented for three pairs of small subunit ribosomal RNA molecules. These are the 16S rRNA from E. coli cytoplasmic and Z. mays chloroplast ribosomes, the 18S rRNA from S. cerevisiae and X. laevis cytoplasmic ribosomes, and the 12S rRNA from human and mouse mitochondrial ribosomes. Using the experimentally-established secondary structure of the E. coli 16S rRNA as a basis, the models were derived both by searching for primary structural homology between the three classes of sequence (12S, 16S, 18S), and also by searching for compensating base changes in putative helical regions of each pair of sequences. The models support the concept that secondary structure of ribosomal RNA has been extensively conserved throughout evolution, differences in length between the three classes of sequence being accommodated in distinct regions of the molecules.

A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch.

The ribosomal DNA (DNA complementary to ribosomal RNA) content of twelve different wheat genotypes has been studied. Some of these genotypes are aneuploids with deletions or additions of chromosomes bearing nucleolar organisers. The rDNA contents of these genotypes provide several examples of a clear departure from a correlation between the number of rRNA cistrons and the number of nucleolar organisers. Thus the number of rRNA cistrons per nucleolar organiser is not constant in wheat. Wheat DNA was found to have a mean buoyant density of approximately 1.702 g/cc for all genotypes studied and rRNA hybridized selectively to DNA of buoyant density approximately 1.710 g/cc. The thermal stabilities of all the rRNA/DNA hybrids were essentially identical.

Supercoiled mitochondrial DNA (mtDNA) has been isolated in preparative amounts from five different plant species and compared on agarose gels. The gels reveal considerable mtDNA size heterogeneity within each species as well as substantial differences in the range and frequency of the mtDNA size classes among the different plants. The two lowest size classes of three of the plants have been extracted and their molecular weights determined. Comparison of two N. tabacum W38 culture lines has revealed significant differences in their mtDNA size classes. However, despite the totally different supercoil patterns, these two lines have almost identical restriction digests. The availability of preparative amounts of separated mtDNA size classes will make it possible to carry out a detailed analysis of plant mitochondrial genomes.

We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences which interrupt the two coding sequences in identical positions. The 5' and 3' flanking sequences in both genes contain conserved sequences similar to those found in corresponding positions in other eukaryotic genes. Thus, the general DNA sequence organization of these plant genes is similar to that of other eukaryotic genes.

Küntzel et al. (1981) (Nucleic Acids Res. 9, 1451-1461) recently concluded that the sequence of wheat mitochondrial 5S rRNA is significantly more related to prokaryotic than to eukaryotic 5S rRNA sequences, and displays an especially high affinity to that of the thermophilic Gram-negative bacterium, Thermus aquaticus. However, the sequence on which this conclusion was based, although attributed to us, differs in several places from the one determined by us. We show here that the correct sequence (Spencer, D.F., Bonen, L. and Gray, M.W. (1981) Biochemistry, in press) does not support the conclusions of Küntzel et al. about potential secondary structure in wheat mitochondrial 5S rRNA and its phylogenetic significance. We further show that when the wheat mitochondrial 5S rRNA sequence is matched against published alignments for E. coli, T. aquaticus, and wheat cytosol 5S rRNAs, the mitochondrial sequence shows no greater homology to the T. aquaticus sequence than to the E. coli sequence, and only slightly more homology to these two sequences than to wheat cytosol 5S rRNA. This analysis confirms our original view (Biochemistry, in press) that wheat mitochondrial 5S rRNA is neither obviously prokaryotic nor eukaryotic in nature, but shows characteristics of both classes of 5S rRNA, as well as some unique features.

The nucleotide sequence of a spinach chloroplast proline tRNA (sp. chl. tRNApro) has been determined. This tRNA shows more overall homology to phage T4 proline tRNA (61% homology) than to eukaryotic proline tRNAs (53% homology) or mitochondrial proline tRNAs (36-49% homology). Sp. chl. tRNApro, like all other chloroplast tRNAs sequenced, contains a methylated GG sequence in the dihyrouridine loop and lacks unusual structural features which have been found in many mitochondrial tRNAs.