Search

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.

Dry fermented sausage innovation trends are linked to consumer preferences for clean label and sodium-reduced foods. This study aims to evaluate the effect of the formulation and production process temperature on the dynamics of bacterial communities in fuet-type dry fermented sausages using metataxonomics. Six fuet batches were manufactured, including formulations without and with the addition of nitrifying salts (replaced or not by pork liver auto-hydrolysate as a colouring agent), processed at 3 to 12 °C, and a partial replacement of NaCl by KCl, processed at 12 °C. Fermentation was performed spontaneously or by a starter culture. Physicochemical characterisation and culture-dependent and independent bacterial analyses were performed at day 0, 4 and 12, at the end of ripening (aw < 0.90) and after storage. Temperature was the most important factor determining the change in pH, aw and lactic acid bacteria levels while the presence of a starter culture promoted a pH decrease. Metataxonomic analysis showed that low temperature processes and the absence of nitrifying salts allowed the growth of spoilage-related species, while sausages submitted to a mild temperature containing a starter culture and nitrifying salts showed less bacterial diversity. Liver auto-hydrolysate added putative probiotic species to the product. This study provides valuable information to manufacturers who want to innovate safely.

Edible mushrooms contain biologically active compounds with antioxidant, antimicrobial, immunomodulatory and anticancer properties. The link between their anticancer and immunomodulatory properties with their possible prebiotic activity on gut micro-organisms has been the subject of intense research over the last decade. Lyophilized Pleurotus eryngii (PE) mushrooms, selected due to their strong lactogenic effect and anti-genotoxic, immunomodulatory properties, underwent in vitro static batch fermentation for 24 h by fecal microbiota from eight elderly apparently healthy volunteers (>65 years old). The fermentation-induced changes in fecal microbiota communities were examined using Next Generation Sequencing of the hypervariable regions of the 16S rRNA gene. Primary processing and analysis were conducted using the Ion Reporter Suite. Changes in the global metabolic profile were assessed by 1H NMR spectroscopy, and metabolites were assigned by 2D NMR spectroscopy and the MetaboMiner platform. PLS-DA analysis of both metataxonomic and metabolomic data showed a significant cluster separation of PE fermented samples relative to controls. DEseq2 analysis showed that the abundance of families such as Lactobacillaceae and Bifidobacteriaceae were increased in PE samples. Accordingly, in metabolomics, more than twenty metabolites including SCFAs, essential amino acids, and neurotransmitters discriminate PE samples from the respective controls, further validating the metataxonomic findings.

Vermicomposting is the process of organic waste degradation through interactions between earthworms and microbes. A variety of organic wastes can be vermicomposted, producing a nutrient-rich final product that can be used as a soil biofertilizer. Giving the prolific invasive nature of the Australian silver wattle Acacia dealbata Link in Europe, it is important to find alternatives for its sustainable use. However, optimization of vermicomposting needs further comprehension of the fundamental microbial processes. Here, we characterized bacterial succession during the vermicomposting of silver wattle during 56 days using the earthworm species Eisenia andrei. We observed significant differences in α- and β-diversity between fresh silver wattle (day 0) and days 14 and 28, while the bacterial community seemed more stable between days 28 and 56. Accordingly, during the first 28 days, a higher number of taxa experienced significant changes in relative abundance. A microbiome core composed of 10 amplicon sequence variants was identified during the vermicomposting of silver wattle (days 14 to 56). Finally, predicted functional profiles of genes involved in cellulose metabolism, nitrification, and salicylic acid also changed significantly during vermicomposting. This study, hence, provides detailed insights of the bacterial succession occurring during vermicomposting of the silver wattle and the characteristics of its final product as a sustainable plant biofertilizer.

Marine sponges commonly host a repertoire of bacterial-associated organisms, which significantly contribute to their health and survival by producing several anti-predatory molecules. Many of these compounds are produced by sponge-associated bacteria and represent an incredible source of novel bioactive metabolites with biotechnological relevance. Although most investigations are focused on tropical and temperate species, to date, few studies have described the composition of microbiota hosted by Antarctic sponges and the secondary metabolites that they produce. The investigation was conducted on four sponges collected from two different sites in the framework of the XXXIV Italian National Antarctic Research Program (PNRA) in November–December 2018. Collected species were characterized as Mycale (Oxymycale) acerata, Haliclona (Rhizoniera) dancoi, Hemigellius pilosus and Microxina sarai by morphological analysis of spicules and amplification of four molecular markers. Metataxonomic analysis of these four Antarctic sponges revealed a considerable abundance of Amplicon Sequence Variants (ASVs) belonging to the phyla Proteobacteria, Bacteroidetes, Actinobacteria and Verrucomicrobia. In particular, M. (Oxymycale) acerata, displayed several genera of great interest, such as Endozoicomonas, Rubritalea, Ulvibacter, Fulvivirga and Colwellia. On the other hand, the sponges H. pilosus and H. (Rhizoniera) dancoi hosted bacteria belonging to the genera Pseudhongella, Roseobacter and Bdellovibrio, whereas M. sarai was the sole species showing some strains affiliated to the genus Polaribacter. Considering that most of the bacteria identified in the present study are known to produce valuable secondary metabolites, the four Antarctic sponges could be proposed as potential tools for the discovery of novel pharmacologically active compounds.

This study focused on the potential relationships between midgut microbiota of the common cockchafer Melolontha melolontha larvae and their resistance to entomopathogenic nematodes (EPN) infection. We investigated the bacterial community associated with control and unsusceptible EPN-exposed insects through nanopore sequencing of the 16S rRNA gene. Firmicutes, Proteobacteria, Actinobacteria, and Bacteroidetes were the most abundant bacterial phyla within the complex and variable midgut microbiota of the wild M. melolontha larvae. The core microbiota was found to include 82 genera, which accounted for 3.4% of the total number of identified genera. The EPN-resistant larvae differed significantly from the control ones in the abundance of many genera belonging to the Actinomycetales, Rhizobiales, and Clostridiales orders. Additionally, the analysis of the microbiome networks revealed different sets of keystone midgut bacterial genera between these two groups of insects, indicating differences in the mutual interactions between bacteria. Finally, we detected Xenorhabdus and Photorhabdus as gut residents and various bacterial species exhibiting antagonistic activity against these entomopathogens. This study paves the way to further research aimed at unravelling the role of the host gut microbiota on the output of EPN infection, which may contribute to enhancement of the efficiency of nematodes used in eco-friendly pest management.

Campylobacter is the most frequent foodborne zoonotic bacteria worldwide, with chicken meat being overwhelmingly the most important reservoir for human infections. Control measures implemented at the farm level (i.e., biosecurity or vaccination), which have been successfully applied to limit other pathogens, such as Salmonella, have not been effective in reducing Campylobacter occurrence. Thus, new approaches are needed to fully understand the ecological interactions of Campylobacter with host animals to effectively comprehend its epidemiology. The objective of this study was to analyse longitudinally the gut microbiota composition of Campylobacter-infected and non-infected farms to identify any difference that could potentially be indicative of gut colonization by Campylobacter spp. Differences in the colonization rate and timing were observed at the farms that became positive for Campylobacter jejuni over the investigated time points, even though in positive tests, the occurrence of Campylobacter jejuni gut colonization was not observed before the second week of the life of the birds. Significant differences were observed in the abundances of specific bacterial taxa between the microbiota of individuals belonging to farms that became Campylobacter positive during the study and those who remained negative with particular reference to Bacteroidales and Clostridiales, respectively. Moreover, Campylobacter colonization dramatically influenced the microbiota richness, although to a different extent depending on the infection timing. Finally, a key role of Faecalibacterium and Lactobacillus genera on the Campylobacter microbial network was observed. Understanding the ecology of the Campylobacter interaction with host microbiota during infection could support novel approaches for broiler microbial barrier restoration. Therefore, evidence obtained through this study can be used to identify options to reduce the incidence of infection at a primary production level based on the targeted influence of the intestinal microbiota, thus helping develop new control strategies in order to mitigate the risk of human exposure to Campylobacter by chicken meat consumption.