Search

Bacillus licheniformis is recognised as an exceptional expression platform in biomanufacturing due to its ability to produce high-value products. Consequently, metabolic engineering of B. licheniformis is increasingly pursued to enhance its utility as a biomanufacturing vehicle. Effective B. licheniformis cell factories require promoters that enable regulated expression of target genes. This review discusses recent advancements in the characterisation, synthesis, and engineering of B. licheniformis promoters. We highlight the application of constitutive promoters, quorum sensing promoters, and inducible promoters in protein and chemical synthesis. Additionally, we summarise efforts to expand the promoter toolbox through hybrid promoter engineering, transcription factor-based inducible promoter engineering, and ribosome binding site (RBS) engineering.

Background: Selenium (Se) pollution poses serious threats to terrestrial ecosystems. Mushrooms are important sources of Se with the potential for bioremediation. Pre-eminent Se resources must possess the ability to tolerate high levels of Se. To obtain Se-accumulating fungi, we isolated selenite-tolerance-enhanced Ganoderma lucidum JNUSE-200 through adaptive evolution. Methods: The molecular mechanism responsible for selenite tolerance and accumulation was explored in G. lucidum JNUSE-200 by comparing it with the original strain, G. lucidum CGMCC 5.26, using a combination of physiological and transcriptomic approaches. Results: G. lucidum JNUSE-200 demonstrated tolerance to 200 mg/kg selenite in liquid culture and exhibited normal growth, whereas G. lucidum CGMCC 5.26 experienced reduced growth, red coloration, and an unpleasant odor as a result of exposure to selenite at the same concentration. In this study, G. lucidum JNUSE-200 developed a triple defense mechanism against high-level selenite toxicity, and the key genes responsible for improved selenite tolerance were identified. Conclusions: The present study offers novel insights into the molecular responses of fungi towards selenite, providing theoretical guidance for the breeding and cultivation of Se-accumulating varieties. Moreover, it significantly enhances the capacity of the bio-manufacturing industry and contributes to the development of beneficial applications in environmental biotechnology through fungal selenite transformation bioprocesses.

Washing machines are one of the tools that bring great convenience to people’s daily lives. However, washing machines that have been used for a long time often develop issues such as odor and mold, which can pose health hazards to consumers. There exists a conspicuous gap in our understanding of the microorganisms that inhabit the inner workings of washing machines. In this study, samples were collected from 22 washing machines in Shanghai, China, including both water eluted from different parts of washing machines and biofilms. Quantitative qualitative analysis was performed using fluorescence PCR quantification, and microbial communities were characterized by high-throughput sequencing (HTS). This showed that the microbial communities in all samples were predominantly composed of bacteria. HTS results showed that in the eluted water samples, the bacteria mainly included Pseudomonas, Enhydrobacter, Brevibacterium, and Acinetobacter. Conversely, in the biofilm samples, Enhydrobacter and Brevibacterium were the predominant bacterial microorganisms. Correlation analysis results revealed that microbial colonies in washing machines were significantly correlated with years of use and the type of detergent used to clean the washing machine. As numerous pathogenic microorganisms can be observed in the results, effective preventive measures and future research are essential to mitigate these health problems and ensure the continued safe use of these household appliances.

Catabolite control protein A (CcpA) is a critical regulator in Gram-positive bacteria that orchestrates carbon metabolism by coordinating the utilization of different carbon sources. Although it has been widely proved that CcpA helps prioritize the utilization of glucose over other carbon sources, this global regulator’s precise mechanism of action remains unclear. In this study, a mutant Bacillus licheniformis deleted for CcpA was constructed. Cell growth, carbon utilization, metabolites and the transcription of key enzymes of the mutant strain were compared with that of the wild-type one. It was found that CcpA is involved in the regulation of glucose concentration metabolism in Bacillus. At the same time, CcpA regulates glucose metabolism by inhibiting acetic acid synthesis and pentose phosphate pathway key gene zwF. The conversion rate of acetic acid is increased by about 3.5 times after ccpA is deleted. The present study provides a new mechanism of carbon metabolism and acetic acid balance regulated by CcpA. On the one hand, this work deepens the understanding of the regulatory function of CcpA and provides a new view on the regulation of glucose metabolism. On the other hand, it is helpful to the transformation of B. licheniformis chassis microorganisms.

Carbon-based nanoprobes, with excellent physicochemical performance and biocompatibility, are a kind of ideal nanomaterial for biosensing. Herein, we designed and prepared novel oxygen-doped nitrogen-enrichment carbon nanoribbons (ONCNs) with an excellent optical performance and uniform morphology, which could be used as a dual-mode fluorescence probe for the detection of Ag+ ion and captopril (Ctl) based on the synergism of photo-induced electron transfer and aggregation-induced quenching mechanisms. By recording the changes in fluorescent intensities of ONCNs, the Ag+ ion and Ctl concentrations can be easily tested in real samples. The results displayed that two good linear relationships existed between the change in fluorescent intensity of ONCNs and the concentrations of Ag+ ion and Ctl in the ranges of 3 μM to 30 μM and 1 μM to 30 μM, with the detection limit of 0.78 µM and 74 nM, respectively. The proposed sensing platform has also been successfully applied for the Ctl analysis in commercial tablet samples based on its high selectivity, proving its value in practical applications.

Bacillus genetics need more versatile promoters for gene circuit engineering. UP elements are widely distributed in noncoding regions and interact with the α-subunit of RNA polymerase (RNAP). They can be applied as a standard element for synthetic biology. Characterization of the binding motif between UP elements and RNAP may assist with rational and effective engineering. In this study, 11 Bacillus constitutive promoters were screened for strength in Bacillus licheniformis. The motif in UP elements from a strong native promoter, PLan, was characterized. The influence of specific sequences on RNAP binding and expression strength was investigated both in vitro and in vivo. It was found that sequences up to 50 base pairs upstream of the consensus motif significantly contributed to α-CTD (the alpha subunit carboxy-terminal domain) association. Meanwhile, two repeats of a proximal subsite were able to more strongly activate the expression (by 8.2-fold) through strengthening interactions between UP elements and RNAP. Based the above molecular basis, a synthetic UP element, UP5-2P, was constructed and applied to nine wild-type promoters. Fluorescence polarization results demonstrated that it had an apparent effect on promoter–α-CTD interactions, and elevated expression strength was observed for all the engineered promoters. The highest improved core promoter, Pacpp, was more strongly activated by 7.4-fold. This work thus develops a novel strategy for Bacillus promoter engineering.

Angiogenetic inhibitors are crucial in tumor therapy, and endogenous angiogenesis inhibitors have attracted considerable attention due to their effectiveness, safety, and multi-targeting ability. Arresten and canstatin, which have anti-angiogenesis effects, are the c-terminal fragments of the α1 and α2 chains of type IV collagen, respectively. In this study, human arresten and canstatin were recombinantly expressed in Escherichia coli (E. coli), and their effects on the proliferation, migration and tube formation of human umbilical vein endothelial cells (HUVECs) were evaluated. Regarding the cell cycle distribution test and 5-ethynyl-2′-deoxyuridine (EdU) assays, arresten and canstatin could repress the proliferation of HUVECs at a range of concentrations. Transwell assay indicated that the migration of HUVECs was significantly decreased in the presence of arresten and canstatin, while tube formation assays suggested that the total tube length and junction number of HUVECs were significantly inhibited by these two proteins; moreover, they could also reduce the expression of vascular endothelial growth factor (VEGF) and the phosphorylation levels of PI3K and Akt, which indicated that the activation of the 3-kinase/serine/threonine-kinase (PI3K/Akt) signaling pathway was inhibited. These findings may have important implications for the soluble recombinant expression of human arresten and canstatin, and for the related therapy of cancer.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Pleurotus eryngii var. ferulae, a fungus of the genus Pleurotus, efficiently degrades lignin, especially during co-cultivation with other fungi. However, low transformation efficiency and heterologous gene expression restrict systematic studies of the molecular mechanisms and metabolic control of natural products in this mushroom. In this study, the homologous resistance marker carboxin (cbx) was used to establish a polyethylene glycol-mediated transformation (PMT) system in P. eryngii var. ferulae. Optimization of the transformation process greatly improved the number of positive transformants. In particular, we optimized: (i) protoplast preparation and regeneration; (ii) screening methods; and (iii) transformation-promoting factors. The optimized transformation efficiency reached 72.7 CFU/μg, which is higher than the average level of Pleurotus sp. (10–40 CFU/μg). Moreover, three endogenous promoters (Ppfgpd1, Ppfgpd2, and Ppfsar1) were screened and evaluated for different transcription initiation characteristics. A controllable overexpression system was established using these three promoters that satisfied various heterologous gene expression requirements, such as strong or weak, varied, or stable expression levels. This study lays the foundation for recombinant protein expression in P. eryngii var. ferulae and provides a method to investigate the underlying molecular mechanisms and secondary metabolic pathway modifications.

Amino acid efflux and influx transport systems play vital roles in industrial microorganisms’ cell growth and metabolism. However, although biochemically characterized, most of them remain unknown at the molecular level in Bacillus licheniformis. In this study, three proteins, namely, YdgF, YvbW, and YveA, were predicted to be involved in the active transport of L-aspartate (L-Asp). This was verified by manipulating their encoding genes. When growing in the minimal medium with L-Asp as the only carbon and nitrogen source, the growth of strains lacking proteins YdgF, YvbW, and YveA was significantly inhibited compared with the wild-type strains, while supplementing the expression of the corresponding proteins in the single-gene knockout strains could alleviate the inhibition. Upon overexpression, the recombinant proteins mediated the accumulation of L-aspartate to varying degrees. Compared with the wild-type strains, the single knockout strains of the three protein genes exhibited reduced absorption of L-aspartate. In addition, this study focused on the effects of these three proteins on the absorption of β-alanine, L-glutamate, D-serine, D-alanine, and glycine.

Selenium biofortification of edible and medicinal mushrooms is an effective way to produce selenium-enriched food supplements. Ganoderma lucidum is the typical one with excellent biological activity. This study investigated G. lucidum growth and bioactive metabolites alterations during liquid culture with different concentrations of selenite. Low selenium levels did not affect growth and mycelia morphology, whereas high selenium levels negatively influenced growth, dramatically decreased biomass, caused nucleic acid and protein leakage, damaged cell walls and membranes, and resulted in indicators such as degraded cells, a red color, and an unpleasant odor. Through headspace-solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS) analysis, ten volatile Se compounds were identified in G. lucidum with 200 ppm selenite, which led to an odor change, whereas only three with 50 ppm selenite. SeMet was the major selenoamino acid in the 50 ppm selenite group by high-performance liquid chromatography-inductively coupled plasma mass spectrometry (HPLC-ICP-MS), but more MeSeCys was produced with 200 ppm selenite. Polysaccharide yields were promoted and inhibited with 50 and 200 ppm selenite, respectively. These results provide comprehensive insights into the effects of selenite on G. lucidum in liquid culture and are beneficial for functional selenium-enriched mushroom production and improving nutritive values.

Bacillus licheniformis is widely used to produce multiple enzymes and chemicals in industrial fermentation. It is also an organism that is hard to genetically manipulate, which is mainly attributed to its extremely low transformation efficiency. The lack of genetic modification technology severely limits its further application. In this study, an all-in-one conditional clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 plasmid was developed for B. licheniformis with the cas9 gene under the control of a xylose-inducible promoter. By means of this design, the expression of the cas9 gene could be repressed without xylose, which significantly improved the transformation ratio from less than 0.1 cfu/μg to 2.42 cfu/μg DNA. Compared with this conditional system, a constitutive overexpression system led to significant growth retardation in bacterial cells. Both the biomass and specific growth rate decreased greatly. After transformation, successful genome editing could be triggered by 0.5% xylose. When the α-amylase gene amyL was used as a genomic target, the efficiencies of its disruption using three different protospacer-adjacent motif (PAM) sequences were 64.3%, 70.9%, and 47.1%, respectively. Moreover, temperature plays a pivotal role in the function of the constructed CRISPR system. The maximum success rate reached 97% at 20 °C, while higher temperatures negatively impacted the function of the system. These results suggested that the design with a cas9 gene under the strict control of a xylose-inducible promoter significantly improved the success rate of genome editing in this host. This work contributes to the development of genetic manipulation and furthers the use of B. licheniformis as an efficient industrial workhorse.

The xylose operon is an efficient biological element used for the regulation of gene expression in Bacillus licheniformis. Although the mechanism underlying the xylose-mediated regulation of this operon has been elucidated, the transcriptional changes that occur under various fermentation conditions remain unclear. In this study, the effects of different conditions on xylose operon expression were investigated. Significant upregulation was observed during the transition from the logarithmic phase to the stationary phase (2.5-fold, n = 3, p < 0.01). Glucose suppressed transcription over 168-fold (n = 3, p < 0.01). Meanwhile, the inhibitory effect of glucose hardly strengthened at concentrations from 20 to 180 g/L. Furthermore, the transcription of the xylose operon increased at elevated temperatures (25−42 °C) and was optimal at a neutral pH (pH 6.5−7.0). Based on these findings, relevant fermentation strategies (delaying the induction time, using dextrin as a carbon source, increasing the fermentation temperature, and maintaining a neutral pH) were proposed. Subsequently, these strategies were validated through the use of maltogenic amylase as a reporter protein, as an 8-fold (n = 3, p < 0.01) increase in recombinant enzyme activity compared to that under unoptimized conditions was observed. This work contributes to the development of fermentation optimization and furthers the use of the xylose operon as an efficient expression element.