Search

Simple Summary: The low laying performance of geese has significantly hindered the development of the goose breeding industry. The growth and development of goose follicle granulosa cells (GCs) directly influence normal ovulation in geese, which in turn impacts egg production. Our previous data suggest that de novo lipogenesis (DNL) occurs within the GCs of goose follicles. In this study, we investigated the potential mechanism of action of the PLIN1 gene in goose GCs for the first time, using cell culture, transfection, and transcriptome sequencing technologies. The results of the transcriptome analysis indicated that PLIN1 may regulate oxidative stress in goose follicular granulosa cells through the TGF-β signaling pathway, thereby inducing cell proliferation or apoptosis. Additionally, nine candidate genes were identified as potentially involved in this process. These findings enhance the understanding of the molecular regulatory mechanisms in goose follicular GCs and provide a theoretical foundation for future in-depth studies on these molecular mechanisms. PLIN1, a member of the PAT family, is expressed in both adipocytes and steroidogenic cells. In this study, we used cell transfection technology combined with transcriptome sequencing to investigate the regulatory mechanism of PLIN1 in goose follicular GCs. Gene Ontology (GO) analysis revealed that in the four groups (phGC: over_vs_over-NC; hGC: over_vs_over-NC; phGC: si_vs_si-NC; hGC: si_vs_si-NC), most differentially expressed genes (DEGs) were significantly enriched (p < 0.05) in pathways related to biological processes (BPs), particularly those associated with the regulation of cellular lipid metabolism and oxidative stress. KEGG analysis further identified significant enrichment (p < 0.05) in pathways related to cell apoptosis and the cell cycle. A joint analysis of KEGG and PPI on the upregulated and downregulated DEGs revealed that the TGF-β signaling pathway was the only pathway significantly enriched among both upregulated and downregulated DEGs after PLIN1 overexpression in hGCs and phGCs. Based on these findings, we hypothesize that PLIN1 overexpression may promote granulosa cell proliferation and apoptosis by activating the TGF-β signaling pathway in goose follicular GCs. Additionally, nine potential candidate genes were identified: PPARγ, MGLL, PTEN, BAMBI, BMPR2, JUN, FST, ACSF3, and ACSL4. These results address a significant research gap concerning the role of this gene in granulosa cells and contribute to the understanding of its molecular regulatory mechanisms. [ABSTRACT FROM AUTHOR]

Simple Summary: The broody behavior of geese has seriously impacted egg production performance and hindered the development of the industry. However, the principal regulators and underlying physiological mechanisms of this biological process are not well understood. Consequently, this study aimed to identify key proteins by assessing the antioxidant levels in the ovary in conjunction with proteomic analysis to elucidate the mechanisms underlying geese broodiness and offer new insights to improve egg production performance. Studies have demonstrated significant alterations in ovarian oxidative stress levels, ovarian degeneration, and follicular atresia during the broody period in geese. The results of this study showed that during the broody period, geese exhibited degraded ovarian tissues, disrupted follicular development, a thinner granulosa cell layer, and lower levels of ovarian hormones E2, P4, and AMH. Antioxidant activity (GSH, CAT, SOD, T-AOC, and the content of H2O2) and the mRNA expression levels of antioxidant genes (GPX, SOD-1, SOD-2, CAT, COX-2, and Hsp70) were significantly higher in pre-broody geese compared to laying geese, while the expression of apoptosis-related genes (p53, Caspase-3, and Caspase-9) increased and the anti-apoptotic gene Bcl-2 decreased. Additionally, proteomic analysis identified 703 differentially expressed proteins (DEPs), primarily concentrated in the GO categories of the biological process (biological regulation, response to stimulus, etc.) and enriched in the KEGG pathways (PI3K-Akt signaling pathway, etc.). Among them, XDH was central to the regulatory network. Furthermore, Western blotting revealed higher expression of XDH in the ovaries of pre-broody geese than those of laying geese. Pearson correlation analysis indicated a significant correlation between XDH expression and oxidative stress markers in the ovaries of geese (r > 0.75). Overall, these results demonstrated that geese experience ovarian atrophy and remarkably increased oxidative stress during the broody period, suggesting that XDH may be a key driver of broodiness in geese. [ABSTRACT FROM AUTHOR]

Simple Summary: The aim of this research was to characterize the structure, expression, and function of unc-13d in the process of sex reversal in Monopterus albus. The expression profile of unc-13d suggested that unc-13d plays an important role in sex reversal. Additionally, the DNA methylation of the promoter of unc-13d exhibited negative correlation with gene expression, especially at site 114. Furthermore, we found that dmrt1 antagonistically regulates foxl2 expression through unc-13d. Monopterus albus is a protogynous hermaphroditic fish that changes from female to male, but the underlying sex change mechanism remains as-yet unknown. In this study, we firstly cloned and characterized the sequence and protein structure of unc-13d of M. albus. We found that the genomic structure of unc-13d was different from other species. Expression was detected in the developing gonad by applying qRT-PCR and in situ hybridization. We found that the expression of unc-13d in the ovotestis was higher than in the ovary and testes. A strong signal of unc-13d was detected in oocytes and granulosa cells in the ovary and spermatogonia and primary spermatocytes in the testes. We found that the promoter methylation of unc-13d was negatively correlated with gene expression in developing gonads, especially at site 114. A dual-luciferase assay was designed and revealed that dmrt1 regulates promoter activity opposite to foxl2. In summary, during sex reversal, DNA methylation affects the binding of the transcription factor dmrt1 and foxl2 in the promoter region through methylation and demethylation interactions to regulate the expression of unc-13d during gonadal development. [ABSTRACT FROM AUTHOR]

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. [ABSTRACT FROM AUTHOR]

Background/Objectives: The avascular nature of the follicle creates a hypoxic microenvironment, establishing a niche where granulosa cells (GCs) rely on glycolysis to produce energy in the form of lactate (L-lactate). Autophagy, an evolutionarily conserved stress-response process, involves the formation of autophagosomes to encapsulate intracellular components, delivering them to lysosomes for degradation. This process plays a critical role in maintaining optimal follicular development. However, whether hypoxia regulates autophagy in GCs via lactate remains unclear. Methods: In this study, we investigated lactate-induced autophagy under hypoxia by utilizing glycolysis inhibitors or silencing related genes. Results: We observed a significant increase in autophagy in ovarian GCs under hypoxic conditions, indicated by elevated LC3II levels and reduced P62 levels. Suppressing lactate production through glycolytic inhibitors (2-DG and oxamate) or silencing lactate dehydrogenase (LDHA/LDHB) effectively reduced hypoxia-induced autophagy. Further investigation revealed that the HIF1-α/BNIP3/Beclin-1 axis is essential for lactate-induced autophagy under hypoxic conditions. Inhibiting HIF-1α activity using siRNAs or PX-478 downregulated BNIP3 expression and subsequently suppressed autophagy. Similarly, BNIP3 silencing with siRNAs repressed lactate-induced autophagy in hypoxic conditions. Mechanistically, immunoprecipitation experiments showed that BNIP3 disrupted pre-existing Bcl-2/Beclin-1 complexes by competing with Bcl-2 to form Bcl-2/BNIP3 complexes. This interaction released Beclin-1, which subsequently triggered lactate-induced autophagy under hypoxic conditions. Conclusions: These findings unveil a novel mechanism by which hypoxia regulates GC autophagy through lactate production, highlighting its potential role in sustaining follicular development under hypoxic conditions. [ABSTRACT FROM AUTHOR]

The specific expression profile and function of circular RNA (circRNA) in follicular atresia remain largely unknown. Here, the circRNA expression profiles of granulosa cells derived from healthy follicles (HFs) and antral follicles (AFs) in buffalo were analyzed by RNA-seq, and the mechanism of a differentially expressed circRNA (DEcircRNA) circTEC regulating the granulosa cell function that affects follicular atresia was further explored. RNA-seq results showed that a total of 112 DEcircRNAs were identified. Among them, circTEC was highly expressed in HF, and its circular structure was confirmed by RNase R digestion assay, reversed PCR and Sanger sequencing. Functional experiments demonstrated that circTEC promotes the proliferation and steroid hormone synthesis of buffalo granulosa cells (bGCs), and it also inhibits their apoptosis. In-depth mechanism analysis showed that the expression level of circTEC in bGCs from AFs was adversely related to miR-144-5p and consistent with FZD3. CircTEC acts as an endogenous sponge of miR-144-5p to regulate the expression of the target gene FZD3 in AFs, which promotes the proliferation of bGCs and inhibits bGCs apoptosis, thereby inhibiting follicular atresia in buffalo. In summary, our study revealed the regulatory role of the circTEC/miR-144-5p/FZD3 axis during follicular atresia in buffalo. These results provided new insights into the biological mechanism underlying follicular atresia. [ABSTRACT FROM AUTHOR]

Ovarian aging significantly impacts female fertility, with mitochondrial dysfunction emerging as a key factor. This study investigated the effects of recombinant follicle-stimulating hormone (FSH) and luteinizing hormone (LH) on mitochondrial function and metabolism in aging female reproductive cells. Human granulosa cells (HGL5) were treated with FSH/LH or not. Mitochondrial function was assessed through various assays, including mitochondrial mass, membrane potential, ROS levels, and ATP production. Mitochondrial dynamics and morphology were analyzed using MitoTracker staining. Cellular respiration was measured using a Seahorse Bioenergetics Analyzer. Metabolic reprogramming was evaluated through gene expression analysis and metabolite profiling. In vivo effects were studied using aging mouse oocytes. FSH/LH treatment significantly improved mitochondrial function in aging granulosa cells, increasing mitochondrial mass and membrane potential while reducing ROS levels. Mitochondrial dynamics showed a shift towards fusion and elongation. Cellular respiration, ATP production, and spare respiratory capacity were enhanced. FSH/LH-induced favorable alterations in cellular metabolism, favoring oxidative phosphorylation. In aging mouse oocytes, FSH/LH treatment improved in vitro maturation and mitochondrial health. In conclusion, FSH/LH supplementation ameliorates age-related mitochondrial dysfunction and improves cellular metabolism in aging female reproductive cells. [ABSTRACT FROM AUTHOR]

Simple Summary: Normal folliculogenesis is essential for mammalian fertility. Ovarian granulosa cells (GCs) are necessary in mammalian reproduction as they secrete factors promoting oocyte growth and maturation. Although the role of inhibitin beta A (INHBA) in the proliferation and secretion functions of GCs is well established, the post-transcriptional regulation of INHBA expression during folliculogenesis in sheep remains unclear. This research investigated the role of miRNAs in sheep GCs that target INHBA and assessed the potential functions of miR-134-3p in the activity of GCs in sheep. These results confirmed the functions of miR-134-3p in controlling GC proliferation and apoptosis via influencing the TGF-β/PI3K/AKT pathway. Inhibin β-A (INHBA), a TGF-β superfamily member, is crucial for developing follicles. Although miRNAs are essential for post-transcriptional gene regulation, it is not yet known how they affect the expression of INHBA during follicle development. Using bioinformatics analyses, miR-134-3p was found, in this investigation, to be a crucial microRNA that targets INHBA in sheep GCs. Furthermore, when the follicular diameter expanded, there was a discernible decline in miR-134-3p expression. The miR-134-3p overexpression markedly reduced the proliferation of GCs, whereas its knockdown augmented it. Moreover, cell cycle progression was enhanced by miR-134-3p overexpression. Furthermore, miR-134-3p overexpression heightened GC apoptosis, while its knockdown reduced it. Importantly, miR-134-3p overexpression blocked the PI3K/AKT/mTOR axis, whereas its knockdown stimulated it. Overall, the outcomes of transfections with INHBA and miR-134-3p showed that, in sheep GCs, miR-134-3p targets INHBA to control cell proliferation and apoptosis. In summary, these results add to our understanding of the molecular mechanisms involving important miRNAs in ewe fecundity by indicating that miR-134-3p influences cell proliferation, cell apoptosis, and the TGF-β/PI3K/AKT/mTOR axis, which, in turn, influences the follicular development of sheep GCs. [ABSTRACT FROM AUTHOR]

Inflammation disrupts the normal function of granulosa cells (GCs), which leads to ovarian dysfunction and fertility decline. Inflammatory conditions such as polycystic ovary syndrome (PCOS), primary ovarian insufficiency (POI), endometriosis, and age-related ovarian decline are often associated with chronic low-grade inflammation. Nicotinamide mononucleotide (NMN) is an important precursor of NAD+ and has gained attention for its potential to modulate cellular metabolism, redox homeostasis, and mitigate inflammation. This study investigated the protective roles of NMN against lipopolysaccharide LPS-mediated inflammation in GCs. The results of this experiment demonstrated that LPS had negative effects on GCs in term of reduced viability and proliferation rates and upregulated the production of pro-inflammatory cytokines, including interleukin-1 beta (IL-1β), interleukin-6 (IL-6), cyclooxygenase-2 (Cox-2), and tumor necrosis factor-alpha (TNF-α). Notably, the levels of NAD+ and NAD+/NADH ratio in GCs were reduced in response to inflammation. On the other hand, NMN supplementation restored the NAD+ levels and the NAD+/NADH ratio in GCs and significantly reduced the expression of pro-inflammatory markers at both mRNA and protein levels. It also enhanced cell viability and proliferation rates of GCs. Furthermore, NMN also reduced apoptosis rates in GCs by downregulating pro-apoptotic markers, including Caspase-3, Caspase-9, and Bax while upregulating anti-apoptotic marker Bcl-2. NMN supplementation significantly reduced reactive oxygen species ROS and improved steroidogenesis activity by restoring the estradiol (E2) and progesterone (P4) levels in LPS-treated GCs. Mechanistically, this study found that NMN suppressed the activation of the TLR4/NF-κB/MAPK signaling pathways in GCs, which regulates inflammatory processes. In conclusion, the findings of this study revealed that NMN has the potential to reduce LPS-mediated inflammatory changes in GCs by modulating NAD+ metabolism and inflammatory signaling pathways. NMN supplementation can be used as a potential therapeutic agent for ovarian inflammation and related fertility disorders. [ABSTRACT FROM AUTHOR]

Oxidative stress is a significant factor in the death of granulosa cells (GCs), leading to follicular atresia and consequently limiting the number of dominant follicles that can mature and ovulate within each follicular wave. Follicular fluid contains a diverse array of metabolites that play crucial roles in regulating GCs' proliferation and oocyte maturation, which are essential for follicle development and female fertility. However, the mechanisms behind metabolite heterogeneity and its effects on GCs' function remain poorly understood. Here, we identified elevated nicotinamide levels in the follicular fluid of high-prolificacy sheep, correlated with oxidative stress in GCs, by an integrated analysis. In vitro experiments demonstrated that supplementation with β-nicotinamide mononucleotide (NMN) significantly increased the levels of nicotinamide adenine dinucleotide (NAD+) and adenosine triphosphate (ATP) in GCs. NMN treatment effectively reduced Lipopolysaccharide (LPS)-induced apoptosis and mitigated mitochondrial dysfunction, while also decreasing the production of reactive oxygen species (ROS), thereby enhancing the activity of the antioxidant defense system. Importantly, NMN treatment improved the impairments in steroid hormone levels induced by LPS. Mechanistically, the protective effects of NMN against GCs function were mediated via the AMPK/mTOR pathway. Collectively, our findings elucidate the metabolic characteristics associated with sheep prolificacy and demonstrate that NMN effectively protects GCs from LPS-induced dysfunction and enhances ovarian responsiveness via the AMPK/mTOR pathway. These findings also position NMN as a potential novel metabolic biomarker in enhancing ovarian function. [ABSTRACT FROM AUTHOR]

Copper nanoparticles (CuNPs) are known to affect many ovarian cell functions. CuNPs, prepared using a chemical reduction method, were fully characterized by different means (TEM, DLS, XRD, Z potential, XPS, and AES). The resulting colloidal suspension contained needle-like CuNPs aggregates made of a core of metallic copper and an oxidized surface of Cu2O and CuO. The separate and coupled effects of CuNPs and the growth factor betacellulin (BTC) were analyzed on the control of some basic functions of ovarian cells. With this purpose, porcine ovarian granulosa cells, together with CuNPs, BTC, and both (CuNPs + BTC), were cultured. Viability and BrDU tests, quantitative immunocytochemistry, TUNEL, and ELISA were used to evaluate markers of the S-phase (PCNA) and G-phase (cyclin B1) of the cell cycle, cell proliferation (BrDU incorporation), cytoplasmic/mitochondrial apoptosis (bax) and extrinsic (nuclear DNA fragmentation) markers, and the release of estradiol and progesterone. CuNPs were accumulated within the cells and were found to reduce all the markers of proliferation, but promoted all the markers of apoptosis and the release of steroid hormones. When added alone, BTC raised the expression of all cell viability and proliferation markers, depleted the expression of all apoptosis markers, and stimulated the release of both estradiol and progesterone. Furthermore, BTC prevented and even reversed the effect of CuNPs on all the measured parameters, whereas CuNPs mitigated BTC's effect on all the analyzed cell functions. These results support a direct toxic effect of CuNPs and a stimulatory effect of BTC on ovarian cell functions, as well as the capability of BTC to protect against the adverse effects of CuNPs. [ABSTRACT FROM AUTHOR]

Background: Granulosa cells are somatic cells within the ovarian follicle. As the primary site of estradiol production, they are critical regulators of several aspects of female reproduction. This review aims to provide an overview of the physiology of mammalian granulosa cells and their importance for female fertility. Methods: the literature about the function and regulation of granulosa cells was reviewed. Results: a comprehensive summary and discussion of the role of granulosa cells on ovarian steroidogenesis and folliculogenesis, as well as factors that control granulosa cells function, are presented. Conclusion: The functions of granulosa cells are regulated by a plethora of intra- and extra-ovarian factors via autocrine, paracrine, and endocrine pathways, which creates a complex regulatory network. A comprehensive understanding of granulosa cells' physiology is vital for the development of innovative strategies to enhance reproductive outcomes in several species. [ABSTRACT FROM AUTHOR]

Background and Clinical Significance: Abnormal uterine bleeding during the postmenopausal years is a pathological sign that may be due to simultaneous intrauterine and ovarian pathology. Granulosa cell tumours of the ovary are malignant neoplasms producing oestradiol, which leads to the abnormal proliferation of the endometrium, precancerous lesions, and endometrial carcinoma type I. Case Presentation: The authors present a clinical case of a 67-year-old woman with postmenopausal bleeding who underwent a total abdominal hysterectomy with bilateral adnexectomy, pelvic lymphadenectomy, and partial omentectomy. The histopathological examination showed a granulosa cell adult-type ovarian tumour and a malignant endometrial polyp with atypical hyperplasia of the endometrium. Conclusions: The immunohistochemical analysis of the malignant endometrial polyp confirmed the expression of oestrogen, progesterone receptors, and the biomarker Ki-67. [ABSTRACT FROM AUTHOR]

Simple Summary: Prolactin (PRL) is essential for the growth and ovulation of animal follicles, but its impact on follicular recruitment in ewes remains poorly understood. This study identified key genes and pathways influenced by PRL inhibition using RNA sequencing and bioinformatics approaches. Subcellular localization for the key gene in ovarian tissue was observed using a fluorescence in situ hybridization (FISH) assay and immunohistochemistry. The function of these key genes was validated through gene knockout and overexpression experiments. The results indicate that PRL inhibition mainly regulates follicle recruitment through the target gene PIKfyve. The subcellular localization of PIKfyve in the ovarian tissue of ewes was primarily present in the ovarian granulosa cells (GCs) and cumulus cells (CCs). Overexpression of PIKfyve decreased cell apoptosis and enhanced steroid hormone release, whereas knockout of PIKfyve had the reverse effect. In conclusion, PRL inhibition facilitates follicle recruitment in ewes by upregulating PIKfyve during the estrus phase. These findings offer a fresh perspective on how PRL regulates follicle recruitment during the estrus cycle in ewes. Prolactin (PRL) plays a key role in the growth and ovulation of animal follicles, but its impact on follicular recruitment in ewes remains uncertain. In this study, a total of sixteen healthy ewes (Hu sheep, aged 2–3 years, with continuous reproduction and housed separately), matched for parity and weight (52.98 ± 0.96 kg), were randomly assigned to two groups: a control group (C) and a treatment group (T, PRL inhibition). Ovaries were collected in vivo after anesthesia during the estrus stage, and tissue morphology was observed using hematoxylin–eosin (HE) staining. By using RNA sequencing on the ovaries of C and T groups and conducting bioinformatics analysis, the essential genes and pathways involved in the regulation of PRL inhibition were pinpointed. Subcellular localization of key genes in ovarian tissue was determined using a fluorescence in situ hybridization (FISH) assay and immunohistochemistry. The function of key genes was validated using knockout and overexpression techniques. During the estrus phase, we noted a marked rise in the count of large follicles within ovarian tissue following the inhibition of prolactin. In total, 328 differentially expressed genes (DEGs) were detected, with 162 upregulated and 166 downregulated. The results indicated that inhibiting PRL primarily influences follicle recruitment by acting on the target gene PIKfyve. Following the inhibition of PRL during the estrus phase, there was an increase in the expression of PIKfyve. PIKfyve was primarily localized in the ovarian granulosa cells (GCs) and cumulus cells (CCs) in the ovarian tissue of ewes. The overexpression of PIKfyve decreased cell apoptosis and enhanced steroid hormone release, whereas knockout of PIKfyve had the reverse effect. In conclusion, PRL inhibition promoted follicle recruitment in ewes by upregulating PIKfyve during the estrus stage. [ABSTRACT FROM AUTHOR]

Simple Summary: Granulosa cells play an essential role in oocyte meiotic competence acquisition by supplying nutrients and metabolites to oocytes and secreting paracrine signals that regulate oocyte maturation. Identifying biomarkers in granulosa cells to measure an oocyte's ability to mature in vitro noninvasively predicts success or failure prior to maturation. This technique also offers the opportunity to develop treatment strategies to overcome potential maturation failures. This study aimed to evaluate potential biomarkers associated with follicle development, meiotic competence, cell death and atresia, and embryonic genome activation in granulosa cells from oocytes that did or did not mature after in vitro fertilization in the southern white rhinoceros. This study determined eight potential biomarkers associated with the success or failure of an oocyte to mature. Two genes were correlated with follicle development, three genes with meiotic competence, and three genes with cell death and atresia. This is the first study in which in vivo granulosa cells were used as a diagnostic predictor of oocyte maturation competence in the southern white rhinoceros. It represents a critical evaluation needed to improve assisted reproductive technologies in this species. In recent years, biomarkers in granulosa cells (GC) have been determined and associated in several species with oocyte maturation, in vitro fertilization success, and embryo development outcomes. The identification of biomarkers of oocyte competence can aid in improving assisted reproductive technologies (ARTs) in the southern white rhino (SWR). This study aimed to identify biomarkers present in SWR GC associated with oocytes that either did or did not mature in vitro. We evaluated follicle development (FD), meiotic competence (MC), cell death and atresia (CDA), and embryonic genome activation (EGA). Our objective was to design biomarkers to predict oocyte in vitro maturation results in the SWR. RNA was isolated from GC obtained during ovum pick up (OPU) for qPCR analysis. Overall, 22 genes were assessed, and nine were differentially expressed between GC from oocytes that did or did not mature in vitro (FD-GDF9 and mTOR; MC-GGPS1, JMY, and NPR2; CDA-COL4A1, MACIR, and TMPO; EGA-NFYA). From these data, we determined that GC can be used as a predictor for oocyte in vitro maturation outcome in the SWR. Our results provide crucial information needed to improve in vitro maturation and ARTs in this species. [ABSTRACT FROM AUTHOR]

Simple Summary: Follicular development is closely related to fertility. In this study, we aimed to explore the specific mechanism of FoxO1 in regulating follicular development. Our findings revealed that the H3K27me3-FoxO1-CYP1A1 pathway might be a potential target for improving follicular development in sows. It is well known that the function of granulosa cells (GCs) is closely related to follicular development, and FoxO1 and histone methylation have been implicated in follicular development. However, the specific mechanisms by which FoxO1 and histone methylation regulate follicular development are still largely unknown. To explore the specific mechanism of FoxO1 in regulating follicular development, in this study, we showed that the expression of FoxO1 in immature ovaries and small follicles was significantly higher than in mature ovaries and large follicles of sows, respectively. FoxO1 was found to inhibit the secretion of testosterone and proliferation of porcine GCs and promote the secretion of progesterone and apoptosis of porcine GCs. Furthermore, H3K27me3, as a transcriptional inhibitor, can inhibit the transcription of FoxO1. FoxO1 could promote the transcription of CYP1A1, and CYP1A1 was found to inhibit the proliferation and facilitate the ferroptosis of porcine GCs. Collectively, our results revealed that the H3K27me3-FoxO1-CYP1A1 pathway might participate in follicular development, and these findings could provide potential targets for improving follicular development in sows. [ABSTRACT FROM AUTHOR]

Simple Summary: Atractylodes macrocephala Koidz (AMK) as an oriental medicine has been used in the treatment of threatened abortion. Atractylenolide I (AT-I) is one of the major bioactive components of AMK. This study aimed to investigate the effect of AT-I on the secretion of estradiol and progesterone in feline ovarian granulosa cells (FOGCs), which is necessary for pregnancy. It was found that AT-I could promote proliferation and the secretion of estradiol (E2) and progesterone (P4) in FOGCs; after AT-I treatment, 137 significant DEGs were observed, out of which 49 were up-regulated and 88 down-regulated. A relatively high number of genes were enriched for the cholesterol metabolism, ovarian steroidogenesis, and biosynthesis of unsaturated fatty acids. Furthermore, the contents of the total cholesterol and low-density lipoprotein cholesterol were decreased by AT-I treatment in the cell culture supernatant. The results indicated that AT-I could increase the ability of FOGCs to secrete E2 and P4, which might be achieved by activation of cholesterol metabolism. Atractylodes macrocephala Koidz (AMK) as an oriental medicine has been used in the treatment of threatened abortion. Atractylenolide I (AT-I) is one of the major bioactive components of AMK. This study aimed to investigate the effect of AT-I on the secretion of estradiol (E2) and progesterone (P4) in feline ovarian granulosa cells (FOGCs), which is necessary for pregnancy. At first, the proliferation of FOGCs after AT-I treatment was measured by CCK-8. Then, the synthesis of E2 and P4 were measured by ELISA. Lastly, transcriptome sequencing was used to detect the DEGs in the FOGCs, and RNA-seq results were verified by RT-qPCR and biochemical verification. It was found that AT-I could promote proliferation and the secretion of E2 and P4 in FOGCs; after AT-I treatment, 137 significant DEGs were observed, out of which 49 were up-regulated and 88 down-regulated. The DEGs revealed significant enrichment of 52 GO terms throughout the differentiation process (p < 0.05), as deciphered by Gene Ontology enrichment analysis. Kyoto Encyclopedia of Genes and Genomes analysis manifested that the DEGs were successfully annotated as members of 155 pathways, with 23 significantly enriched (p < 0.05). A relatively high number of genes were enriched for the cholesterol metabolism, ovarian steroidogenesis, and biosynthesis of unsaturated fatty acids. Furthermore, the contents of the total cholesterol and low-density lipoprotein cholesterol were decreased by AT-I treatment in the cell culture supernatant. The results indicated that AT-I could increase the ability of FOGCs to secrete E2 and P4, which might be achieved by activation of cholesterol metabolism. [ABSTRACT FROM AUTHOR]

Simple Summary: Yak is a unique species of highland cattle that inhabits cold regions year-round. Poor soil conditions lead to low nutrient content in forage, making yaks susceptible to trace element deficiencies. This deficiency results in reduced reproductive rates and overall productivity in yaks. Hormones synthesized by the granulosa cells of yak follicles play a crucial role in yak reproduction. In this study, the changes in cell viability, hormone secretion, and hormone synthesis-related genes were observed by adding metal trace elements and vitamins to the culture medium of cultured granulosa cells of yak follicles in vitro. The results showed that the addition of certain trace elements and vitamins had a positive effect on the activity and hormone secretion of granulosa cells in yak follicles. These findings offer a potential solution for enhancing the reproductive performance of female yaks affected by trace element deficiencies. Yak (Bos grunniens), a special breed of cattle on the Qinghai–Tibet Plateau, has low fertility due to nutritional deficiency, especially the trace elements. The steroid hormones estradiol (E2) and progesterone (P4) synthesized by yak follicular granulosa cells (BGCs) are involved in the entire reproductive process. In the present study, we investigated the effects of trace elements and vitamins on yak follicular GCs, including the cellular activity, the synthesis of E2 and P4, and the expression of genes related to steroid hormone synthesis. The results showed that moderate supplementation of vitamin D3 (VD3), strontium (Sr), manganese (Mn), and selenium (Se) enhanced granulosa cell activity. Within the safe dose range, the addition of vitamin A (VA), VD3, cobalt (Co), Sr, copper (Cu), Mn, Se, and chromium (Cr) significantly increased the synthesis of E2 by GCs, while the addition of VA, vitamin C (VC), VE, zinc (Zn), Sr, Cu, and Cr enhanced the production of P4 in GCs. The changes in steroid synthesizing genes were consistent with the changes in hormone synthesis. This study provides an experimental basis for the addition of trace elements to improve the production performance of yaks. [ABSTRACT FROM AUTHOR]

Simple Summary: The common carp (Cyprinus carpio) shows pronounced sexual dimorphism in growth, and females grow faster than males. Studying the molecular mechanisms of ovarian development and oogenesis is vital for improving productivity and breeding all-female populations. Although many transcriptome analyses of bulk ovaries have been conducted, they have not been able to uncover cell type-specific differences in gene expression. In this study, we presented the transcriptional profile of common carp ovaries at the single-cell level using single-nucleus RNA sequencing. Our analysis revealed valuable information about regulating oogenesis and the development of granulosa cells. Our research provides a helpful resource that complements previously published bulk ovary transcriptomic analyses in the common carp for further investigating the molecular and cellular mechanisms underlying ovarian development. The common carp (Cyprinus carpio) is a crucial freshwater species cultivated worldwide for food consumption. Female carp have better growth performance than males, which fascinates scholars to uncover the mechanism of gonadal differentiation and produce mono-sex populations. However, the mechanism of ovarian development at single-cell resolution is limited. Here, we conducted single-nucleus RNA sequencing in adolescent common carp ovaries. Our study obtained transcriptional profiles of 13,155 nuclei and revealed 13 distinct cell clusters in the ovaries, including three subtypes of germ cells and four subtypes of granulosa cells. We subsequently performed pseudotime trajectory analysis to delineate potential mechanisms underlying the development of germ cells and granulosa cells. We identified 1250 dynamic expression genes in germ cells and 1815 in granulosa cells (q-value < 0.01), including zp3, eif4a2 and aspm in germ cells and fshr and esr1 in granulosa cells. The functional annotation showed that dynamic expression genes in germ cells were involved in sperm–egg recognition and some terms related to meiosis, such as sister chromatid segregation and homologous recombination. Genes expressed dynamically in granulosa cells were related to the TGF-β signaling pathway, response to gonadotropin, and development of primary female sexual characteristics. In addition, the dynamic genes expressed in granulosa cells might relate to the complex communication between different cell types. In summary, our study provided a transcriptome profile of common carp ovaries at single-nucleus resolution, and we further revealed the potential cell type-specific mechanisms underlying oogenesis and the differentiation of granulosa cells, which will facilitate breeding all-female common carp populations. [ABSTRACT FROM AUTHOR]

The timing of puberty significantly influences subsequent reproductive performance in cattle. N6-methyladenosine (m6A) is a key epigenetic modification involved in the regulation of pubertal onset. However, limited research has investigated alterations in m6A methylation within the hypothalamic–pituitary–ovarian (HPO) axis during the onset of puberty. In this study, combined analysis of methylated RNA immunoprecipitation sequencing (MeRIP-Seq) and RNA sequencing (RNA-seq) is used to describe the overall modification pattern of m6A in the HPO axis, while GSEA, KEGG, and GO analyses are used to describe the enrichment pathways of differentially expressed genes and differentially methylated genes. The m6A modifications of the differential genes KL, IGSF10, PAPPA2, and BMP15 and the pathways of cell adhesion molecules (CAMs), TGF-β, cell cycle, and steroid hormone synthesis may play roles in regulating the function of the HPO axis tissue during pubertal transition. Notably, BMP15′s m6A modification depends on the action of the demethylase ALKBH5, which is recognized by the reader protein YTHDF2, promoting bovine granulosa cell proliferation, steroid production, and estrogen secretion. This study reveals for the first time the modification mechanism of BMP15 m6A during the initiation of bovine puberty, which will provide useful information for improving the reproductive efficiency of Chinese beef cattle. [ABSTRACT FROM AUTHOR]

The zinc oxide nanoparticles (ZnO NPs) is one of the most extensively utilized metal oxide nanoparticles in biomedicine, human food, cosmetics and livestock farming. However, growing evidence suggests that there is a potential risk for humans and animals because of the accumulation of ZnO NPs in cells, which leads to cell death through several different pathways. Nevertheless, the effects of ZnO NPs on porcine granulosa cells (PGCs) and how ZnO NPs regulate the follicular cells are unknown. In this study, we aimed to elucidate the role of ZnO NPs in the porcine ovary by using PGCs. Firstly, we identified the characterization of ZnO NPs used in this study and the results showed that the size of ZnO NPs was 29.0 nm. The results also demonstrated that ZnO NPs impaired cell viability and decreased steroid hormone secretion in PGCs. In addition, ZnO NPs induced reactive oxygen species (ROS) production, leading to oxidative stress of PGCs. Meanwhile, ZnO NPs also triggered autophagy in PGCs by increasing the ratio of LC3-II/LC3-I, along with the expression of SQSTM1 and ATG7. Finally, the results from N-acetylcysteine (NAC) addition suggested that ZnO NPs promoted autophagy through the enhancement of ROS production. In summary, this study demonstrates that ZnO NPs impair the viability and function of PGCs through autophagy, which is regulated by ROS production. [ABSTRACT FROM AUTHOR]

Transfer RNA-derived small RNAs (tsRNAs) are novel regulatory small non-coding RNAs that have been found to modulate many life activities in recent years. However, the exact functions of tsRNAs in follicle development remain unclear. Follicle development is a remarkably complex process that follows a strict hierarchy and is strongly associated with reproductive performance in ducks. The process of converting small yellow follicles into hierarchal follicles is known as follicle selection, which directly determines the number of mature follicles. We performed small RNA sequencing during follicle selection in ducks and identified tsRNA-00764 as the target of interest based on tsRNA expression profiles in this study. Bioinformatics analyses and luciferase reporter assays further revealed that peroxisome proliferator-activated receptor-γ (PPAR-γ) was the target gene of tsRNA-00764. Moreover, tsRNA-00764 knockdown promoted estrogen and progesterone synthesis and lipid deposition in duck granulosa cells, while a PPAR-γ inhibitor reversed the above phenomenon. Taken together, these results demonstrate that tsRNA-00764, differentially expressed in pre-hierarchal and hierarchy follicles, modulates estrogen and progesterone synthesis and lipid deposition by targeting PPAR-γ in duck granulosa cells, serving as a potential novel mechanism of follicle selection. Overall, our findings provide a theoretical foundation for further exploration of the molecular mechanisms underlying follicle development and production performance in ducks. [ABSTRACT FROM AUTHOR]

Dysfunctional mitochondria producing excessive ROS are the main factors that cause ovarian aging. Immp2l deficiency causes mitochondrial dysfunction and excessive ROS production, leading to ovarian aging, which is attributed to granulosa cell senescence. The pathway controlling mitochondrial proteostasis and mitochondrial homeostasis of the UPRmt and mitophagy are closely related with the ROS and cell senescence. Our results suggest that Immp2l knockout led to granulosa cell senescence, and enocyanin treatment alleviated Immp2l deficiency-induced granulosa cell senescence, which was accompanied by improvements in mitochondrial function and reduced ROS levels. Interestingly, redox-related protein modifications, including S-glutathionylation and S-nitrosylation, were markedly increased in Immp2l-knockout granulosa cells, and were markedly reduced by enocyanin treatment. Furthermore, STAT1 was significantly increased in Immp2l-knockout granulosa cells and reduced by enocyanin treatment. The co-IP results suggest that the expression of STAT1 was controlled by S-glutathionylation and S-nitrosylation, but not phosphorylation. The UPRmt was impaired in Immp2l-deficient granulosa cells, and unfolded and misfolded proteins aggregated in mitochondria. Then, the HIF1α/BNIP3-mediated mitophagy pathway was activated, but mitophagy was impaired due to the reduced fusion of mitophagosomes and lysosomes. The excessive aggregation of mitochondria increased ROS production, leading to senescence. Hence, Enocyanin treatment alleviated granulosa cell senescence through STAT1/ATF4-mediated UPRmt and STAT1/(ATF4)/HIF1α/BNIP3-mediated mitophagy. [ABSTRACT FROM AUTHOR]

Considering the properties of myo-inositol (MI) and D-chiro-inositol (DCI), which are well known in polycystic ovary syndrome therapy, and the limitations of adult granulosa cell tumor (AGCT) treatment, especially for androgen-secreting tumors, we studied the role of MI and DCI in the androgen-rich environment of AGCTs. For this purpose, we analyzed the mRNA expression of steroidogenic genes and the secretion of progesterone (P4) and 17β-estradiol (E2) in an unstimulated and/or dihydrotestosterone (DHT)-stimulated environment under MI and DCI influence. Thus, we used the HGrC1 and KGN cell lines as in vitro models of healthy and cancerous granulosa cells. We found that DHT, the most potent androgen, increased E2 secretion and steroidogenic acute regulatory protein (StAR) and cytochrome P450 side-chain cleavage gene (CYP11A1) mRNA expression without affecting 450 aromatase (CYP19A1) in AGCTs. However, after the MI and DCI treatment of KGN cells, both compounds strongly reduced StAR and CYP11A1 expression. Interestingly, in DHT-stimulated KGN cells, only DCI alone and its cotreatment with MI reduced both CYP11A1 mRNA and E2 secretion. These findings suggest that CYP11A1 is responsible for the antiestrogenic effect of DCI in the androgen-rich environment of AGCTs. Therefore, MI and DCI could be used as effective agents in the adjuvant treatment of AGCT, but further detailed studies are needed. [ABSTRACT FROM AUTHOR]

Simple Summary: Taurine (Tau) is a well-known antioxidant. However, the protective effects of Tau against silica nanoparticle (SNP)-induced reproductive toxicity still remain unexplored. So this study reveals the effect of Tau on SNP-induced porcine ovarian granulosa cell toxicity. SNPs trigger oxidative stress through excessive ROS production, leading to inflammation and cell apoptosis in porcine ovarian granulosa cells. Tau mitigates SNP-induced cytotoxicity by reducing oxidative stress, inflammatory response, and mitochondria-mediated cell apoptosis in porcine ovarian granulosa cells. Therefore, Tau could be an effective strategy to alleviate SNP-induced toxicity and holds promising application prospects in the animal husbandry and veterinary industry. Silica nanoparticles (SNPs) induce reproductive toxicity through ROS production, which significantly limits their application. The protective effects of taurine (Tau) against SNP-induced reproductive toxicity remain unexplored. So this study aims to investigate the impact of Tau on SNP-induced porcine ovarian granulosa cell toxicity. In vitro, granulosa cells were exposed to SNPs combined with Tau. The localization of SNPs was determined by TEM. Cell viability was examined by CCK-8 assay. ROS levels were measured by CLSM and FCM. SOD and CAT levels were evaluated using ELISA and qPCR. Cell apoptosis was detected by FCM, and pro-inflammatory cytokine transcription levels were measured by qPCR. The results showed that SNPs significantly decreased cell viability, while increased cell apoptosis and ROS levels. Moreover, SOD and CAT were decreased, while IFN-α, IFN-β, IL-1β, and IL-6 were increased after SNP exposures. Tau significantly decreased intracellular ROS, while it increased SOD and CAT compared to SNPs alone. Additionally, Tau exhibited anti-inflammatory effects and inhibited cell apoptosis. On the whole, these findings suggest that Tau mitigates SNP-induced cytotoxicity by reducing oxidative stress, inflammatory response, and cell apoptosis. Tau may be an effective strategy to alleviate SNP-induced toxicity and holds promising application prospects in the animal husbandry and veterinary industry. [ABSTRACT FROM AUTHOR]

Fragile X mental retardation protein (FMRP) is a translational repressor encoded by FMR1. It targets bone morphogenetic protein receptor type II (BMPR2), which regulates granulosa cell (GC) function and follicle development. However, whether this interaction affects folliculogenesis remains unclear. Therefore, this study investigated the potential effect of FMRP-BMPR2 dysregulation in ovarian reserves and infertility. COV434 cells and patient-derived GCs were used to evaluate FMRP and BMPR2 expression. Similarly, FMR1, BMPR2, LIMK1, and SMAD expression were evaluated in GCs with normal (NOR) and poor (POR) ovarian responses. FMRP and BMPR2 were expressed in both cell types. They were co-localized to the nuclear membrane of COV434 cells and cytoplasm of primary GCs. FMR1 silencing increased the mRNA and protein levels of BMPR2. However, the mRNA levels of FMR1 and BMPR2 were significantly lower in the POR group. FMR1 and BMPR2 levels were strongly positively correlated in the NOR group but weakly correlated in the POR group. Additionally, SMAD9 expression was significantly reduced in the POR group. This study highlights the crucial role of FMR1/FMRP in the regulation of BMPR2 expression and its impact on ovarian function. These findings indicate that the disruption of FMRP-BMPR2 interactions may cause poor ovarian responses and infertility. [ABSTRACT FROM AUTHOR]

Simple Summary: Bilateral ovariectomy in mares with behavioral problems is a common long-term solution with high owner satisfaction. However, a pathohistological explanation for behavioral improvement after surgery is lacking. Therefore, bilaterally removed, clinically unremarkable ovaries from mares with behavioral problems were immunohistologically evaluated and compared with pathohistologically confirmed granulosa cell tumors. A complete data set including clinical history, clinical examination, serum anti-Müllerian hormone (AMH), and testosterone concentrations was analyzed as the basis for the pathohistological study. Immunohistochemical evaluation of Ki-67, AMH, aromatase, epidermal growth factor receptor, calretinin, and epithelial cadherin revealed no clear differentiation between large follicular structures of clinically unremarkable ovaries and cyst-like structures of neoplastic ovaries. Clinical data and success rate after bilateral ovariectomy of 85% were comparable with previous studies. Preoperatively measured serum AMH and testosterone concentrations were indicative of advanced granulosa cell tumors but were variable in mares with clinically unremarkable ovaries. Ultrasonographically nondetectable early neoplastic changes could be determined in 15% of mares and anovulatory-like follicles in 30% of mares with bilaterally removed ovaries. These changes might be a pathohistological explanation for behavioral problems of ovarian origin and a reason for the high success rate of bilateral ovariectomy. Behavioral problems in reproductively healthy mares are a challenging issue that is successfully treated with bilateral ovariectomy (BO). This laparoscopic procedure represents an alternative to conservative treatment for mares not intended for breeding and results in high owner satisfaction regarding behavioral improvement. However, a pathohistological explanation to justify surgical ovarian removal regarding animal welfare is lacking. Therefore, the objective of this study was to pathohistologically evaluate bilaterally removed, clinically unremarkable ovaries of mares with behavioral problems (bOE, n = 20) and to compare them with pathohistologically confirmed granulosa cell tumors of mares with neoplastic ovaries (GCT-uOE, n = 10). A complete data set including preliminary presentation, clinical examination, and serum anti-Müllerian hormone (AMH) and testosterone was further analyzed in both groups. Both hormones were significantly higher in GCT-uOE compared with bOE. Immunohistochemical expression of Ki-67, AMH, aromatase, epidermal growth factor receptor, calretinin, and epithelial cadherin in granulosa cells of large follicular structures in bOE did not differ from neoplastic granulosa cells in GCT-uOE. Ultrasonographically nondetectable early neoplastic changes were pathohistologically evaluated in 15% of mares and anovulatory-like follicles in 30% of mares in bOE and might be one explanation for the high success rate of BO in 85% of bOE in this study. [ABSTRACT FROM AUTHOR]

Gossypol (GP), a polyphenolic compound in cottonseed, has notable effects on female reproduction and the respiratory system in pigs. This study aimed to discern the alterations in gene expression within swine granulosa cells (GCs) when treated with two concentrations of GP (6.25 and 12.5 µM) for 72 h, in vitro. The analysis revealed significant changes in the expression of numerous genes in the GP-treated groups. A Gene Ontology analysis highlighted that the differentially expressed genes (DEGs) primarily pertained to processes such as the mitotic cell cycle, chromosome organization, centromeric region, and protein binding. Pathway analysis using the Kyoto Encyclopedia of Genes and Genomes (KEGG) indicated distinct impacts on various pathways in response to different GP concentrations. Specifically, in the GP6.25 group, pathways related to the cycle oocyte meiosis, progesterone-mediated oocyte maturation, and p53 signaling were prominently affected. Meanwhile, in the GP12.5 group, pathways associated with PI3K-Akt signaling, focal adhesion, HIF-1 signaling, cell cycle, and ECM–receptor interaction showed significant alterations. Notably, genes linked to female reproductive function (CDK1, CCNB1, CPEB1, MMP3), cellular component organization (BIRC5, CYP1A1, TGFB3, COL1A2), and oxidation–reduction processes (PRDX6, MGST1, SOD3) exhibited differential expression in GP-treated groups. These findings offer valuable insights into the changes in GC gene expression in pigs exposed to GP. [ABSTRACT FROM AUTHOR]

Simple Summary: Heat stress exerts extensive and intricate effects on germ cells, attracting significant attention from researchers. This article provides a comprehensive review and summary of the impacts and mechanisms of heat stress on ovarian granulosa cells. The systematic evaluation of heat stress effects on ovarian granulosa cells encompasses alterations in steroid hormone levels, oxidative stress, apoptosis, and mitochondrial function, with detailed discussions on several key mechanisms. Furthermore, this study analyzes the mechanism and potential relevance of ferroptosis in ovarian granulosa cells under heat stress conditions. Looking ahead to the future, gaining a deeper understanding of this complex mechanism will serve as a theoretical foundation for exploring possible interactions between heat stress and ferroptosis. Heat stress has been one of the key research areas for researchers due to the wide-ranging effects and complex mechanisms of action of its stress product reactive oxygen species (ROS). The aim of this paper is to comprehensively review and summarize the effects of heat stress on ovarian granulosa cells and their mechanism of action. We systematically reviewed the effects of heat stress on ovarian granulosa cells, including intracellular steroid hormone changes, oxidative stress, apoptosis, and mitochondrial function. Meanwhile, this paper discusses in detail several major mechanisms by which heat stress induces apoptosis in ovarian granulosa cells, such as through the activation of apoptosis-related genes, induction of endoplasmic reticulum stress, and the mitochondrial pathway. In addition, we analyzed the mechanism of ferroptosis in ovarian granulosa cells under heat stress conditions, summarized the potential association between heat stress and ferroptosis in light of the existing literature, and explored the key factors in the mechanism of action of heat stress, such as the signaling pathways of Nrf2/Keap1, HSPs, and JNK, and analyzed their possible roles in the process of ferroptosis. Finally, this paper provides an outlook on the future research direction, describing the possible interaction between heat stress and ferroptosis, with a view to providing a theoretical basis for further understanding and revealing the complex mechanism of ferroptosis occurrence in ovarian granulosa cells under heat stress. [ABSTRACT FROM AUTHOR]

The physiological state of Granulosa cells (GCs) is intricately linked to the growth and development of oocytes. Oxidative stress has been found to cause damage to GCs in vitro. Astaxanthin (AST), a well-known natural ketone-type carotenoid, has demonstrated strong antioxidant properties. This study investigates the impact of astaxanthin supplementation on the physiological state of porcine ovarian granulosa cells cultured in vitro. Variations in morphology, apoptosis, reactive oxygen species (ROS) levels, and the expression of apoptosis and anti-oxidation-related genes in porcine GCs from different passages were observed. Significant morphological changes, increases in apoptosis, and decreases in antioxidant capacity resulting from passage were observed. Subsequently, treatment with 5 μmol/L astaxanthin significantly enhanced cell viability, proliferation, antioxidant capacity and mitochondrial function while also regulating the estradiol (E2) and progesterone (P4) levels. Additionally, the gene expression of antioxidation, E2, and P4 synthesis markers was assessed, revealing reduced apoptosis and ROS levels in porcine GCs. In conclusion, supplementation with 5 μmol/L astaxanthin in vitro effectively enhances the physiological condition of porcine GCs and optimizes the culture system for these cells in vitro. Optimizing the culture system of porcine GCs in vitro can simulate the function of granulosa cells in vivo and provide a theoretical reference for further promoting follicular development, which is beneficial to improving sow fertility in actual production. [ABSTRACT FROM AUTHOR]

Ovarian cysts are linked to hormone imbalances and altered gene expressions, but the connection between cysts and ion channel expression is understudied. This study explored the role of TWIK-related acid-sensitive K+ (TASK) channels in bovine ovarian cyst formation. The ovarian follicles were split into small (5 to 10 mm in diameter) and large (>25 mm in diameter) groups. Among the measured K+, Na+, and Cl− concentrations in follicular fluid (FF) obtained from small-sized follicles (SFs) and large-sized follicles (LFs), the K+ concentration was significantly lower in LFFF. Quantitative PCR, Western blot, and immunocytochemistry data revealed that TASK-3 expression levels significantly decreased by approximately 50% in LFs and granulosa cells obtained from LFs (LFGCs) compared to the corresponding controls. The TASK-3 protein was localized to the plasma membranes of GCs. The diameters of LFGCs were larger than those of SFGCs. The cell swelling response to exposure to a hypotonic solution (200 mOsm/L) was highly reduced in TASK-3-overexpressing cells compared to vector-transfected cells. TASK-3-knockdown cells showed arrested growth. Senescence markers were detected in LFGCs and TASK-3-knockdown cells. These findings suggest that reduced TASK-3 expression in LFs is associated with the inhibition of GC growth, leading to senescence and cyst formation. [ABSTRACT FROM AUTHOR]

Circular RNAs (circRNAs) are a class of circular non-coding RNAs that play essential roles in the intricate and dynamic networks governing cell growth, development, and apoptosis. Resveratrol (RSV), a non-flavonoid polyphenol, is known to participate in follicular development and ovulation. In our previous research, we established a model using porcine ovarian granulosa cells (POGCs) treated with resveratrol, which confirmed its regulatory effects on long non-coding RNAs (lncRNAs) and microRNAs (miRNAs) within these cells. However, the influence of resveratrol on circRNA expression has not been thoroughly investigated. To explore how resveratrol affects circRNA levels in POGCs, we designed an experiment with three groups: a control group (CON, n = 3, 0 μM RSV), a low-dose RSV group (LOW, n = 3, 50 μM RSV), and a high-dose RSV group (HIGH, n = 3, 100 μM RSV) for circRNA sequencing. We identified a total of 10,045 candidate circRNAs from POGCs treated with different concentrations of resveratrol (0, 50, and 100 μM). Differential expression analysis indicated that 96 circRNAs were significantly altered in the LOW vs. CON group, while 109 circRNAs showed significant changes in the HIGH vs. CON group. These circRNAs were notably enriched in biological processes associated with cell metabolism, apoptosis, and oxidative stress. Functional enrichment analysis of the host genes revealed their involvement in critical signaling pathways, including mTOR, AMPK, and apoptosis pathways. Additionally, we identified potential miRNA sponge candidates among the differentially expressed circRNAs, particularly novel_circ_0012954 and novel_circ_0004762, which exhibited strong connectivity within miRNA-target networks. Our findings provide valuable insights into the regulatory mechanisms of circRNAs in the context of resveratrol-induced apoptosis in POGCs, highlighting their potential as innovative therapeutic targets in reproductive biology. [ABSTRACT FROM AUTHOR]

Melatonin, as an endocrine neurotransmitter, can promote the development of the ovary. Meanwhile, it also has protective effect on the ovary as an antioxidant. Thyroid hormone (TH) is essential for normal human reproductive function. Many studies have shown that 3,5,3′-triiodothyronine (T3) regulates the development of ovarian granulosa cells. However, little is known about the specific mechanisms by which melatonin combines with T3 to regulate granulosa cell development. The aim of present study was to investigate the effects and the possible mechanisms of melatonin and T3 on ovarian granulosa cell development. In the present study, cell development and apoptosis were detected by CCK8, EdU and TUNEL, respectively. The levels of related proteins were analyzed by Western blotting. The results showed that oxidative stress (OS) and reactive oxygen species (ROS) were induced by H2O2 in granulosa cells, and cell apoptosis was also increased accompanied with the decreased cellular proliferation and viability. Melatonin protects granulosa cells from H2O2-induced apoptosis and OS by downregulating ROS levels, especially in the presence of T3. Co-treatment of cell with melatonin and T3 also promotes the expression of GRP78 and AMH, while inhibiting CHOP, Caspase-3, and P16. It was demonstrated that melatonin alone or in combination with T3 had positive effect on the development of granulosa cells. In addition, the AMPK/SIRT1 signaling pathway is involved in the process of melatonin/T3 promoting granulosa cell development. [ABSTRACT FROM AUTHOR]

5-Hydroxytryptamine (5-HT) is an inhibitory neurotransmitter widely distributed in mammalian tissues, exerting its effects through binding to various receptors. It plays a crucial role in the proliferation of granulosa cells (GCs) and the development of follicles in female animals, however, its effect on porcine follicle development is not clear. The aim of this study is to investigate the expression of 5-HT and its receptors in various parts of the pig ovary, as well as the effect of 5-HT on porcine follicular development by using ELISA, quantitative real-time PCR (qPCR) and EdU assays. Firstly, we examined the levels of 5-HT and its receptors in porcine ovaries, follicles, and GCs. The findings revealed that the expression of different 5-HT receptors varied among follicles of different sizes. To investigate the relationship between 5-HT and its receptors, we exposed the GCs to 5-HT and found a decrease in 5-HT receptor expression compared to the control group. Subsequently, the treatment of GCs with 0.5 μM, 5 μM, and 50 μM 5-HT showed an increase in the expression of cell cycle-related genes, and EdU results indicated cell proliferation after the 0.5 μM 5-HT treatment. Additionally, the expression of genes involved in E2 synthesis was examined after the treatment of granulosa cells with 0.5 μM 5-HT. The results showed that CYP19A1 and HSP17β1 expression was decreased. These results suggest that 5-HT might affect the development of porcine follicle by promoting the proliferation of GCs and inhibiting the synthesis of estrogen. This provides a new finding for exploring the effect of 5-HT on follicular development, and lays a foundation for further research on the mechanism of 5-HT in follicles. [ABSTRACT FROM AUTHOR]

In vitro embryonic technology is crucial for improving farm animal reproduction but is hampered by the poor quality of oocytes and insufficient development potential. This study investigated the relationships among changes in the gut microbiota and metabolism, serum features, and the follicular fluid metabolome atlas. Correlation network maps were constructed to reveal how the metabolites affect follicular development by regulating gene expression in granulosa cells. The superovulation synchronization results showed that the number of follicle diameters from 4 to 8 mm, qualified oocyte number, cleavage, and blastocyst rates were improved in the dairy heifers (DH) compared with the non-lactating multiparous dairy cows (NDC) groups. The gut microbiota was decreased in Rikenellaceae_RC9_gut_group, Alistipes, and Bifidobacterium, but increased in Firmicutes, Cyanobacteria, Fibrobacterota, Desulfobacterota, and Verrucomicrobiota in the NDC group, which was highly associated with phospholipid-related metabolites of gut microbiota and serum. Metabolomic profiling of the gut microbiota, serum, and follicular fluid further demonstrated that the co-metabolites were phosphocholine and linoleic acid. Moreover, the expression of genes related to arachidonic acid metabolism in granulosa cells was significantly correlated with phosphocholine and linoleic acid. The results in granulosa cells showed that the levels of PLCB1 and COX2, participating in arachidonic acid metabolism, were increased in the DH group, which improved the concentrations of PGD2 and PGF2α in the follicular fluid. Finally, the expression levels of apoptosis-related proteins, cytokines, and steroidogenesis-related genes in granulosa cells and the concentrations of steroid hormones in follicular fluid were determinants of follicular development. According to our results, gut microbiota-related phosphocholine and linoleic acid participate in arachidonic acid metabolism in granulosa cells through the gut–follicle axis, which regulates follicular development. These findings hold promise for enhancing follicular development and optimizing oocyte quality in subfertile dairy cows. [ABSTRACT FROM AUTHOR]

Ovarian aging results in reproductive disorders and infertility in mammals. Previous studies have reported that the ferroptosis and autophagy caused by oxidative stress may lead to ovarian aging, but the mechanisms remain unclear. In this study, we compared the morphological characteristics between the aged and young ovaries of pigs and found that the aged ovaries were larger in size and showed more corpora lutea. TUNEL assay further showed that the apoptosis level of granulosa cells (GCs) was relatively higher in the aged ovaries than those in young ovaries, as well as the expressions of autophagy-associated genes, e.g., p62, ATG7, ATG5, and BECN1, but that the expressions of oxidative stress and aging-associated genes, e.g., SOD1, SIRT1, and SIRT6, were significantly lower. Furthermore, the RNA-seq, Western blotting, and immunofluorescence suggested that phospholipid phosphatase 3 (PLPP3) protein was significantly upregulated in the aged ovaries. PLPP3 was likely to decrease the expressions of SIRT1 and SIRT6 to accelerate cellular senescence of porcine GCs, inhibit the expressions of SOD1, CAT, FSP1, FTH1, and SLC7A11 to exacerbate oxidative stress and ferroptosis, and arouse autophagy to retard the follicular development. In addition, two SNPs of PLPP3 promoter were significantly associated with the age at puberty. g.155798586 (T/T) and g.155798718 (C/C) notably facilitated the mRNA and protein level of PLPP3. In conclusion, PLPP3 might aggravate the oxidative stress of GCs to accelerate ovarian aging, and two molecular markers of PLPP3 were identified for ovarian aging in pigs. This work not only contributes to investigations on mechanisms for ovarian aging but also provides valuable molecular markers to postpone ovarian aging in populations. [ABSTRACT FROM AUTHOR]

This study examines the impact of Bisphenol A (BPA), a prevalent environmental estrogenic toxicant, on the ovarian development of mice. Mice were exposed to varying BPA doses from in utero to postnatal stages, up to weaning (day 21, PND 21) and puberty (day 45, PND 45). The BPA content in the serum of the offspring mice on PND 45 was higher than that of the mice sacrificed at PND 21. However, the ovary organ index of the mice of PND 21 was significantly increased, and the ovarian structure was damaged when exposed to BPA. In contrast, the mice with PND 45 did not show apparent ovarian lesions. On the other hand, granulosa cell apoptosis was detected in both PND 21 and PND 45 mice ovaries, and ERβ was increased under the influence of BPA. Transcriptomic analysis revealed BPA's significant impact on ribosomal gene expression, marked downregulation of Rpl21 and Rpsa, and upregulation of Rps2 in both age groups. These transcriptomic alterations were further corroborated by real-time PCR, highlighting a dose-dependent effect of BPA on Rps2. Our findings confirm BPA's detrimental effects on ovarian health, with more pronounced damage in younger mice, suggesting heightened vulnerability in this group. The study underscores ribosomes as critical targets in BPA-induced ovarian developmental disruptions. [ABSTRACT FROM AUTHOR]

Follicle development refers to the process in which the follicles in the ovary gradually develop from the primary stage to a mature state, and most primary follicles fail to develop normally, without forming a dense granular cell layer and cell wall, which is identified as atretic follicles. Granulosa cells assist follicle development by producing hormones and providing support, and interference in the interaction between granulosa cells and oocytes may lead to the formation of atretic follicles. Ferroptosis, as a non-apoptotic form of death, is caused by cells accumulating lethal levels of iron-dependent phospholipid peroxides. Healthy follicles ranging from 4 to 5 mm were randomly divided into two groups: a control group (DMSO) and treatment group (10 uM of ferroptosis inducer erastin). Each group was sequenced after three repeated cultures for 24 h. We found that ferroptosis was associated with atretic follicles and that the in vitro treatment of healthy follicles with the ferroptosis inducer erastin produced a phenotype similar to that of atretic follicles. Overall, our study elucidates that tRF-1:30-Gly-GCC-2 is involved in the apoptosis and ferroptosis of GCs. Mechanistically, tRF-1:30-Gly-GCC-2 inhibits granulosa cell proliferation and promotes ferroptosis by inhibiting Mitogen-activated protein kinase 1 (MAPK1). tRF-1:30-Gly-GCC-2 may be a novel molecular target for improving the development of atretic follicles in ovarian dysfunction. In conclusion, our study provides a new perspective on the pathogenesis of granulosa cell dysfunction and follicular atresia. [ABSTRACT FROM AUTHOR]

Simple Summary: In dairy cows, a hormone called insulin-like growth factor 1 (IGF-1) helps to control growth and reproduction. It affects how oocytes develop in the ovaries. IGF-1 is usually attached to binding proteins (IGFBPs), which can limit its effects. This study looked at how IGF-1 transfers between blood and the fluid around the oocyte. We checked IGF-1 and protein levels in both places and also measured energy levels using ketones. We examined gene activity in ovary cells too to look for local regulation. We found that IGF-1 levels in blood and ovarian fluid are related. High ketone levels, which indicate low energy, were linked to lower IGF-1 and some of the IGFBP. Some gene activity is also related to IGF-1 levels. In summary, while additional research is necessary to fully understand the local regulatory mechanisms, our findings suggest that the transfer of IGF-1 between systems may link metabolic issues to fertility challenges in dairy cows. Insulin-like growth factor 1 (IGF-1) regulates dairy cow reproduction, while the paracrine IGF system locally influences fertility. In both systems, IGF-1 bioactivity is regulated through binding proteins (IGFBPs) inhibiting IGF-1 binding to its receptor (IGF1R). This study aimed to investigate a possible transfer between this endocrine and paracrine system. Therefore, blood and follicular fluid (FF) from postpartum dairy cows were analysed for ß-hydroxybutyrate (BHB), IGF-1, IGFBP-2, -3, -4, -5, and an IGFBP fragment in two study parts. The mRNA expression of IGFBP-2, IGFBP-4, IGF1R, and the pregnancy-associated plasma protein A (PAPP-A) in granulosa cells was measured. The results showed correlations between plasma and FF for IGF-1 (r = 0.57, p < 0.001) and IGFBP-2 (r = −0.57, p < 0.05). Blood BHB negatively correlated with IGF-1 in blood and FF and IGFBP-3, -5 and total IGFBP in blood (IGF-1 plasma: r = −0.26, p < 0.05; FF: r = −0.35, p < 0.05; IGFBP-3: r = −0.64, p = 0.006; IGFBP-5: r = −0.49, p < 0.05; total IGFBP: r = −0.52, p < 0.05). A negative correlation was found between IGFBP-2 expression and IGF-1 concentration in FF (r = −0.97, p = 0.001), while an IGFBP fragment positively correlated with IGF1R-mRNA in FF (r = 0.82, p = 0.042). These findings suggest a transfer and local regulation between the somatotropic axis and the follicular IGF system, linking the metabolic status with local effects on dairy cow fertility. [ABSTRACT FROM AUTHOR]

Simple Summary: It has been observed that red light enhances egg production in pigeons. However, the underlying histological characteristics and molecular mechanisms remain unclear. In this study, fifty-four White King pigeons were selected to confirm the effect of red light on egg production in pigeons and to assess the histological characteristics of follicles, reproductive hormone levels and ovarian transcriptomics on the third day of the laying interval under both red light and white light. This study revealed a molecular basis associated with red light promoting hierarchical follicle selection, enabling a better understanding of the underlying mechanisms of red light improving egg production in pigeons. Red light (RL) has been observed to enhance egg production in pigeons, yet the underlying histological characteristics and molecular mechanisms remain less understood. This study included fifty-four pigeons to assess follicular histology, reproductive hormones, and ovarian transcriptomics on the third day of the laying interval under RL and white light (WL). The results showed that the granulosa cell layer was significantly thicker under RL (p < 0.05), whereas the theca cell and connective tissue layers showed no significant differences (p > 0.05). Higher plasma estradiol (E2) levels were recorded in the RL group (p < 0.05), as well as follicle stimulating hormone (FSH), although progesterone (P4) levels were higher under WL (p < 0.05). Moreover, P4 concentrations in follicle yolk significantly decreased under RL (p < 0.01), with higher FSH and E2 levels in F1 yolk and similar increases in SF1 yolk (p < 0.01). Transcriptomic analysis revealed 4991 differentially expressed genes in the pigeon ovary. The protein–protein interaction network highlighted genes like HSD11B1, VEGFD, WNT6, SMAD6, and LGR5 as potential contributors to hierarchical follicle selection under RL. This research provides new insights into the molecular basis by which RL may promote hierarchical follicle selection and improve egg production in pigeons. [ABSTRACT FROM AUTHOR]

Simple Summary: Chronic stress significantly impacts physical and mental health and has also been shown to affect female reproduction, but the underlying mechanisms are not well understood. Our research focused on the P2X7 receptor, a protein involved in the pathological response under long-term stress. Using mouse models subjected to chronic restraint and cold stress, we observed reduced ovulation rates, a key indicator of reproductive health. We discovered that stress increases the expression of the P2X7 receptor in the ovaries. Treatment with P2X7R inhibitor partially rescued the ovulation rate of the two chronic stress models. This study reveals that managing stress and potentially targeting the P2X7 receptor could help improve reproductive health in women experiencing chronic stress, offering a new approach to treating stress-related reproductive issues. Chronic stress has become a major problem that endangers people's physical and mental health. Studies have shown that chronic stress impairs female reproduction. However, the related mechanism is not fully understood. P2X7 receptor (P2X7R) is involved in a variety of pathological changes induced by chronic stress. Whether P2X7R is involved in the effect of chronic stress on female reproduction has not been studied. In this study, we established a chronic restraint stress mouse model and chronic cold stress mouse model. We found that the number of corpora lutea was significantly reduced in the two chronic stress models. The number of corpora lutea indirectly reflects the ovulation, suggesting that chronic stress influences ovulation. P2X7R expression was significantly increased in ovaries of the two chronic stress models. A superovulation experiment showed that P2X7R inhibitor A-438079 HCL partially rescued the ovulation rate of the two chronic stress models. Further studies showed that activation of P2X7R signaling inhibited the cumulus expansion and promoted the expression of NPPC in granulosa cells, one key negative factor of cumulus expansion. Moreover, sirius red staining showed that the ovarian fibrosis was increased in the two chronic stress models. For the fibrosis-related factors, TGF-β1 was increased and MMP2 was decreased. In vitro studies also showed that activation of P2X7R signaling upregulated the expression of TGF-β1 and downregulated the expression of MMP2 in granulosa cells. In conclusion, P2X7R expression was increased in the ovaries of the chronic restraint-stress and chronic cold-stress mouse models. Activation of P2X7R signaling promoted NPPC expression and cumulus expansion disorder, which contributed to the abnormal ovulation of the chronic stress model. Activation of P2X7R signaling is also associated with the ovarian fibrosis changes in the chronic stress model. [ABSTRACT FROM AUTHOR]

Gonadotoxicity resulting from systemic and locoregional cancer treatments significantly threatens women's reproductive health, often culminating in premature ovarian insufficiency. These therapies, particularly alkylating agents and ionizing radiation, induce DNA damage and apoptosis in ovarian follicles, leading to infertility, amenorrhea, and estrogen deficiency, which exacerbate risks of osteoporosis and cardiovascular diseases. Existing fertility preservation methods do not prevent immediate ovarian damage, underscoring the need for innovative protective strategies. Menstrual blood-derived stem cells (MenSC) and their extracellular vesicles (EV) present promising regenerative potential due to their therapeutic cargo delivery and pathway modulation capabilities. Preclinical studies demonstrate that MenSC-derived EV ameliorate premature ovarian insufficiency by inhibiting granulosa cell apoptosis, promoting angiogenesis, and activating pivotal pathways such as SMAD3/AKT/MDM2/P53. However, comprehensive research is imperative to ensure the safety, efficacy, and long-term effects of MenSC-derived EV in clinical practice. In this review, we update the current knowledge and research regarding the use of MenSC-derived EV as a novel therapeutic weapon for ovarian regeneration in the context of gonadotoxicity induced by systemic anticancer treatment. [ABSTRACT FROM AUTHOR]

During the development of animal organs, various adverse stimuli or toxic environments can induce oxidative stress and delay ovarian development. Paeoniflorin (PF), the main active ingredient of the traditional Chinese herb Paeonia lactiflora Pall., has protective effects on various diseases by preventing oxidative stress. However, the mechanism by which PF attenuates oxidative damage in mouse ovaries remains unclear. We evaluated the protective effects of PF on ovaries in an H2O2-induced mouse oxidative stress model. The H2O2-induced mouse ovarian oxidative stress model was used to explore the protective effect of PF on ovarian development. Histology and follicular development were observed. We then detected related indicators of cell apoptosis, oxidative stress, and autophagy in mouse ovaries. We found that PF inhibited H2O2-induced ovarian cell apoptosis and ferroptosis and promoted granulosa cell proliferation. PF prevented oxidative stress by increasing nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase-1 (HO-1) expression levels. In addition, the autophagic flux of ovarian cells was activated and was accompanied by increased lysosomal biogenesis. Moreover, PF-mediated autophagy was involved in clearing mitochondria damaged by H2O2. Importantly, PF administration significantly increased the number of primordial follicles, primary follicles, secondary follicles, and antral follicles. PF administration improved ovarian sizes compared with the H2O2 group. The present study suggested that PF administration reversed H2O2-induced ovarian developmental delay and promoted follicle development. PF-activated mitophagy is crucial for preventing oxidative stress and improving mitochondrial quality. [ABSTRACT FROM AUTHOR]

Simple Summary: In the present study, we aimed to explore the potential local regulatory role of the cocaine- and amphetamine-regulated transcript (CART) signaling pathway in granulosa cell (GC) apoptosis, which is a key mechanism promoting follicular atresia in several animal species, including buffalo. Our results showed how CART activity adversely influences buffalo GC viability by affecting estradiol production and enhancing apoptosis. The regulatory mechanism by which CART can affect GC apoptosis entails the modulation of the AKT/GSK3β/β-catenin pathway, a key intracellular signaling pathway essential for cell viability. In conclusion, this study provides valuable insights into the intricate mechanisms governing ovarian follicle development and granulosa cell function. These findings have implications for reproductive biology not only for buffalo but also for different species. Atresia is a process in ovarian follicles that is regulated by hormone-induced apoptosis. During atresia, granulosa cell (GC) apoptosis is a key mechanism orchestrated through diverse signaling pathways. Cocaine- and amphetamine-regulated transcript (CART) signaling within ovarian GCs has been demonstrated to play a key role in the regulation of follicular atresia in cattle, pigs, and sheep. The present work aimed to investigate the potential local regulatory role of CART in GC apoptosis-induced follicular atresia in buffalo, focusing on the modulation of the AKT/GSK3β/β-catenin signaling pathways, which are the intracellular signaling pathways involved in cell viability. Our findings revealed increased expression of CARTPT and BAX and decreased levels of AKT, β-catenin, and CYP19A1 genes in atretic follicles compared to healthy follicles. Subsequently, CART treatment in the presence of FSH inhibited the FSH-induced increase in GC viability by reducing estradiol production and increasing apoptosis. This change was accompanied by an increase in the gene expression levels of both CARTPT and BAX. At the protein level, treatment with CART in the presence of FSH negatively affected the activity of AKT, β-catenin, and LEF1, while the activity of GSK3β was enhanced. In conclusion, our study shows how CART negatively influences buffalo GC viability, underlying the modulation of the AKT/GSK3β/β-catenin pathway and promoting apoptosis—a key factor in follicular atresia. [ABSTRACT FROM AUTHOR]

Premature ovarian insufficiency (POI) is defined as the depletion of ovarian function before the age of 40 years. The global prevalence of POI is 3.5%. To date, genetic factors account for 23.5% of the etiology of POI. Herein, a previously uncharacterized pathogenic homozygous variant of the chromosome segregation–1–like gene (CSE1L) was identified in POI patients via targeted panel sequencing. It is reported that dysregulated iron metabolism is involved in many reproductive endocrine disorders; however, its precise role in POI remains obscure. In this study, we identified CSE1L as a potential candidate gene that plays an important role in maintaining iron homeostasis. Deficiency of CSE1L led to ferroptosis in human granulosa cells, which was confirmed by transmission electron microscopy. Mechanistically, coimmunoprecipitation identified the direct interaction between CSE1L and FoxO1. Inhibition of CSE1L led to the excessive accumulation of FoxO1 in the nucleus via nucleocytoplasmic transport. Then, FoxO1 bound to the promoter region of NCOA4 and promoted its transcription, which was verified by a chromatin immunoprecipitation assay. Moreover, inhibition of CSE1L in cumulus cell monolayer could impede oocyte maturation, which might be associated with oxidative stress. Consequently, our study first revealed that CSE1L participated in ferroptosis in human ovarian granulosa cells via nucleocytoplasmic transportation, which might be helpful in revealing the molecular mechanism of CSE1L in the development of POI. Importantly, these findings might provide new insights into the application of ferroptosis inhibitors in the treatment of POI. [ABSTRACT FROM AUTHOR]

Androgen excess is a key feature of several clinical phenotypes of polycystic ovary syndrome (PCOS). However, the presence of FSH receptor (FSHR) and aromatase (CYP19A1) activity responses to physiological endocrine stimuli play a critical role in the pathogenesis of PCOS. Preliminary data suggest that myo-Inositol (myo-Ins) and D-Chiro-Inositol (D-Chiro-Ins) may reactivate CYP19A1 activity. We investigated the steroidogenic pathway of Theca (TCs) and Granulosa cells (GCs) in an experimental model of murine PCOS induced in CD1 mice exposed for 10 weeks to a continuous light regimen. The effect of treatment with different combinations of myo-Ins and D-Chiro-Ins on the expression of Fshr, androgenic, and estrogenic enzymes was analyzed by real-time PCR in isolated TCs and GCs and in ovaries isolated from healthy and PCOS mice. Myo-Ins and D-Chiro-Ins, at a ratio of 40:1 at pharmacological and physiological concentrations, positively modulate the steroidogenic activity of TCs and the expression of Cyp19a1 and Fshr in GCs. Moreover, in vivo, inositols (40:1 ratio) significantly increase Cyp19a1 and Fshr. These changes in gene expression are mirrored by modifications in hormone levels in the serum of treated animals. Myo-Ins and D-Chiro-Ins in the 40:1 formula efficiently rescued PCOS features by up-regulating aromatase and FSHR levels while down-regulating androgen excesses produced by TCs. [ABSTRACT FROM AUTHOR]

The only fertility preservation and subsequent restoration option for many patients facing gonadotoxic treatments is ovarian tissue cryopreservation and transplantation. While this process is successful for some, there is significant room for improvement to extend the life of the transplant and to make it safe for patients that may have metastatic disease within their ovarian tissue. We need a deeper understanding of how the physical properties of the ovarian microenvironment may affect folliculogenesis to engineer an environment that supports isolated follicles and maintains primordial follicle quiescence. Bovine ovaries were used here as a monovulatory model of folliculogenesis to examine the effects of primordial follicle activation and growth under different physical conditions. We found that there were no differences in activation, growth or survival when primordial follicles were cultured in isolation or in situ (remaining in the tissue) under two significantly differently rigid alginate gels. To determine if the extra rigid environment did not affect activation in isolated follicles due to an immediate activation event, we used 5-ethynyl-2′-deoxyuridine (EdU) to track follicle activation during the isolation process. We identified EdU incorporation in granulosa cells after primordial follicles were isolated from the surrounding extracellular matrix (ECM). These findings support that isolation of primordial follicles from the ECM is an activating event and that the differentially rigid environments assessed here had no effect on follicle growth. Further work is needed to suppress activation in primordial follicles to maintain the ovarian reserve and extend the life of an ovarian tissue transplant. [ABSTRACT FROM AUTHOR]

Lipopolysaccharide (LPS) is one of the important pathogenic substances of E. coli and Salmonella, which causes injury to the reproductive system. Ovarian dysfunction due to Gram-negative bacterial infections is a major cause of reduced reproductive performance in geese. However, the specific molecular mechanisms of LPS-induced impairment of sex steroid hormone synthesis have not been determined. The regulatory mechanism of miRNA has been proposed in many physiological and pathogenic mechanisms. Therefore, the role of miRNA in breeding geese exposed to LPS during the peak laying period was investigated. In this study, twenty Yangzhou geese at peak laying period were injected with LPS for 0 h, 24 h, and 36 h. The follicular granulosa layer was taken for RNA-seq and analyzed for differentially expressed miRNAs. It was observed that LPS changed the appearance of hierarchical follicles. miRNA sequencing analysis was applied, and miR-21 and SMAD2 (SMAD family member 2) were selected from 51 differentially expressed miRNAs through bioinformatics prediction. The results showed that miR-21 down-regulated SMAD2 expression and progesterone (P4) production in LPS-treated goose granulosa cells (GCs). It also determined that overexpression of miR-21 or silence of SMAD2 suppressed the sex steroid biosynthesis pathway by decreasing STAR and CYP11A1 expression. Down-regulation of miR-21 exacerbates the LPS-induced decline in P4 synthesis and vice versa. The findings indicated that miR-21 was involved in LPS regulation of P4 synthesis in goose granulosa cells by down-regulating SMAD2. This study provides theoretical support for the prevention of LPS-induced ovarian dysfunction in geese. [ABSTRACT FROM AUTHOR]

Global methylation levels differ in in vitro- and in vivo-developed embryos. Follicular fluid (FF) contains extracellular vesicles (EVs) containing miRNAs that affect embryonic development. Here, we examined our hypothesis that components in FF affect global DNA methylation and embryonic development. Oocytes and FF were collected from bovine ovaries. Treatment of zygotes with a low concentration of FF induced global DNA demethylation, improved embryonic development, and reduced DNMT1/3A levels. We show that embryos take up EVs containing labeled miRNA secreted from granulosa cells and the treatment of zygotes with EVs derived from FF reduces global DNA methylation in embryos. Furthermore, the methylation levels of in vitro-developed blastocysts were higher than those of in their vivo counterparts. Based on small RNA-sequencing and in silico analysis, we predicted miR-29b, -199a-3p, and -148a to target DNMTs and to induce DNA demethylation, thereby improving embryonic development. Moreover, among FF from 30 cows, FF with a high content of these miRNAs demethylated more DNA in the embryos than FF with a lower miRNA content. Thus, miRNAs in FF play a role in early embryonic development. [ABSTRACT FROM AUTHOR]

Cellular metabolism, apoptosis, fertilization, and proliferation of granulosa cells belong to a battery of processes where microRNAs can be detected and associated with infertility. The aim of the present review is to focus on mammalian oocyte maturation events and the association between oocyte growth and miRNA expression. PubMed/Medline, Google Scholar and Scopus databases were searched, and 33 studies were included. Regarding the correlation among miRNA expression and the regulation of granulosa cells and cumulus cells, the most important miRNAs were let-7b, let-7c and miR-21. Additionally, the loss of Dicer, an enzyme involved in miRNA biogenesis, is probably a crucial factor in oogenesis, oocyte maturation and embryogenesis. Furthermore, miRNAs interfere with different cellular mechanisms like apoptosis, steroidogenesis, genome integrity, angiogenesis, antioxidative response and, consequently, oocyte maturation. Hence, it is of major importance to clarify the role and mechanism of each miRNA as understanding its action may develop new tools and establish new diagnostic and treatment approaches for infertility and ovarian disorders. [ABSTRACT FROM AUTHOR]