Search

The global surge in multi-drug resistant bacteria, including extended-spectrum β-lactamase (ESBL)-producing Escherichia coli has led to a growing need for new antibacterial compounds. Despite being promising, the potential of fish-derived antimicrobial peptides (AMPs) in combating ESBL-producing E. coli is largely unexplored. In this study, native African catfish antimicrobial peptides (NACAPs) were extracted from the skin mucus of farmed African catfish, Clarias gariepinus , using a combination of 10% acetic acid solvent hydrolysis, 5 kDa ultrafiltration, and C 18 hydrophobic interaction chromatography. Peptides were then sequenced using Orbitrap Fusion Lumos Tribrid Mass Spectrometry. The identified peptides were screened for potential antibacterial activity using Random Forest and AdaBoost machine learning algorithms. The most promising peptide was chemically synthesized and evaluated in vitro for safety on rabbit red blood cells and activity against ESBL-producing E. coli (ATCC 35218) utilizing spot-on-lawn and broth dilution methods. Eight peptides ranging from 13 to 22 amino acids with molecular weights between 968.42 and 2434.11 Da were identified. Peptide NACAP-II was non-hemolytic to rabbit erythrocytes ( p > 0.05) with a zone of inhibition (ZOI) of 22.7 ± 0.9 mm and a minimum inhibitory concentration (MIC) of 91.3 ± 1.2 μg/mL. The peptide is thus a candidate antibacterial compound with enormous potential applications in the pharmaceutical industry. However, further studies are still required to establish an upscale production strategy and optimize its activity and safety in vivo.

Domestic horses routinely participate in vigorous and various athletic activities. This enables the horse to serve as a model for studying athletic physiology and immunology in other species, including humans. For instance, as a model of physical efforts, such as endurance rides (long-distance running/aerobic exercise) and races (anaerobic exercise), the horse can be useful in evaluating post-exercise response. Currently, there has been significant interest in finding biomarkers, which characterize the advancement of training and adaptation to physical exercise in the horse. The parallels in cellular responses to physical exercises, such as changes in receptor expression and blood cell activity, improve our understanding of the mechanisms involved in the body's response to intense physical activity. This study focuses on the changes in levels of the pro- and anti-inflammatory cytokines and cellular response in the context of post-exercise immune response. Both the direction of changes in cytokine levels and cellular responses of the body, such as proliferation and expression of surface markers on lymphocytes, monocytes and neutrophils, show cross-functional similarities. This review reveals that horses are robust research models for studying the immune response to physical exercise in human athletes., Competing Interests: The authors declare no conflicts of interest.

Infectious bronchitis virus (IBV) induces severe economic losses in chicken farms due to the emergence of new variants leading to vaccine breaks. The studied IBV strains belong to Massachusetts (Mass), Canadian 4/91, and California (Cal) 1737 genotypes that are prevalent globally. This study was designed to compare the impact of these three IBV genotypes on primary and secondary lymphoid organs. For this purpose, one-week-old specific pathogen-free chickens were inoculated with Mass, Canadian 4/91, or Cal 1737 IBV variants, keeping a mock-infected control. We examined the IBV replication in primary and secondary lymphoid organs. The molecular, histopathological, and immunohistochemical examinations revealed significant differences in lesion scores and viral distribution in these immune organs. In addition, we observed B-cell depletion in the bursa of Fabricius and the spleen with a significant elevation of T cells in these organs. Further studies are required to determine the functional consequences of IBV replication in lymphoid organs.

The objective of this study was to identify alterations in the vaginal discharge (VD) metabolome and potential biomarkers to predict metritis development and a cure in dairy cows. This prospective cohort study was conducted on two dairies located in CA and TX. Vaginal discharge was evaluated and collected using the Metricheck ® device. Cows were examined for metritis at 4, 7, and 9 days in milk (DIM). Cows with a fetid, watery, and reddish-brown uterine discharge were classified as having metritis and randomized to receive ceftiofur ( n = 10) or remain untreated ( n = 7). A cure was defined as the absence of a fetid, watery, reddish-brown uterine discharge at 14 d after enrollment. Vaginal discharge samples were collected from 86 cows within 6 h after parturition, at 4 and 7 DIM, at metritis diagnosis, and at 4 and 7 days after metritis diagnosis. Cows with metritis (MET; n = 17) were paired with counterparts without metritis (HTH) of a similar DIM and parity ( n = 34). The uterine metabolome was evaluated using untargeted gas chromatography time-of-flight mass spectrometry (GC-TOF-MS). Metabolomic data were analyzed using the MetaboAnalyst 5.0. Data were log-transformed and auto-scaled for normalization. Univariate analyses, including the fold-change, were performed to identify the metabolites linked to metritis development and its cure and principal component analysis and partial least squares discriminant analysis were performed to explain metabolite variance between animals developing or not developing metritis and being cured or not being cured of metritis. Comparing HTH with MET cows at calving, 12 metabolites were upregulated, and one was downregulated. At four and seven DIM, 51 and 74 metabolites, respectively, were altered between MET and HTH cows. After metritis development, three and five metabolites were upregulated in cows that were cured and in cows that received treatment and were cured, respectively. In all scenarios, the metabolites lignoceric, malic, and maleic acids, ornithine, and hypotaurine, which are associated with arginine/aminoacyl-tRNA biosynthesis and taurine/purine metabolism, were upregulated in HTH cows. Metritis was associated with changes in the uterine metabolome. Cows not being cured of metritis had changes in the uterus metabolome independent of receiving ceftiofur or remaining untreated. Metabolome analysis may be an important tool to understand the vaginal discharge changes during postpartum and the dynamics of metritis development and cures and help to identify biomarkers to predict metritis being cured.

Bacterial endometritis is among the most common causes of subfertility in mares. It has a major economic impact on the equine breeding industry. The sensitivity of detecting uterine microbes using culture-based methods, irrespective of the sample collection method, double-guarded endometrial swab, endometrial biopsy, or uterine low-volume lavage (LVL), is low. Therefore, equine bacterial endometritis often goes undiagnosed. Sixteen individual mares were enrolled, and an endometrial sample was obtained using each method from all mares. After trimming, quality control and decontamination, 3824 amplicon sequence variants were detected in the dataset. We found using 16S rRNA sequencing that the equine uterus harbors a distinct resident microbiome during estrus. All three sampling methods used yielded similar results in composition as well as relative abundance at phyla (Proteobacteria, Firmicutes, and Bacteroidota) and genus ( Klebsiella , Mycoplasma , and Aeromonas) levels. A significant difference was found in alpha diversity (Chao1) between LVL and endometrial biopsy, suggesting that LVL is superior at detecting the low-abundant (rare) taxa. These new data could pave the way for innovative treatment methods for endometrial disease and subfertility in mares. This, in turn, could lead to more judicious antimicrobial use in the equine breeding industry.

Milk production continues to be the main source of income for dairy producers, and mastitis continues to be the major health challenge for dairy cows worldwide. The objective of the current study was to describe the different management practices implemented in Egyptian dairies, which may influence mastitis and improve milk quality. An in-person survey was completed with herd managers and owners of 20 Egyptian dairies selected using a stratified random sample from four of Egypt's milk sheds. The questionnaire included 80 questions that inquired about herd demographics, mastitis status and control, milking practices, and management practices of the study dairies. Statistical analyses included descriptive statistics, multiple factor analysis (MFA), and hierarchical clustering to identify the important principal components and different dairy clusters. Of the surveyed herds, 69.50% had less than 500 lactating cows, with Holstein as the main cow breed. The reported average milk production on the study herds was 31.1 (SE ± 1.10) Kg/cow/day. Housing of lactating, dry, and close-up cows was in open lots. The majority of the dairies milked cows were three times per day (90.63%), the remaining milked cows four (5.00%) or a mix of four and three times per day. Furthermore, herringbone parlor design was the most common parlor design (66.79%) in the study dairies. The most common disinfectants used for both pre- and post-milking teat dip were iodine-based, 90.0% and 95.0%, respectively, while 52.16% of the dairies reported that their milkers wore gloves during milking. The reported mean annual percentage of mastitis was 52.3%, as a percent of the milking herd. The study dairies reported the inspection of udder health through either visual inspection (95.00%), udder hygiene score (86.88%), teat end score (71.88%), and/or using CMT (54.91%). Contagious mastitis pathogens were reported in 45.2% of the study herds. More than 50% of the study herds relied on importing pregnant cows or pregnant heifers as replacements. Multiple factor analysis identified 20 questions and represented 5 components of variability related to mastitis on dairies. The current survey of Egyptian dairies described the herd demographics and different management practices related to mastitis control and prevention. All the study dairies relied on the blanket intramammary antimicrobial drugs at dry off when current research elsewhere has identified selective dry cow therapy as an integral component of antimicrobial stewardship on dairies. Further research is required to identify the association between different management factors and the occurrence of mastitis.

Maturation is a critical step in the development of an oocyte, and it is during this time that the oocyte advances to metaphase II (MII) of the meiotic cycle and acquires developmental competence to be fertilized and become an embryo. However, in vitro maturation (IVM) remains one of the limiting steps in the in vitro production of embryos (IVP), with a variable percentage of oocytes reaching the MII stage and unpredictable levels of developmental competence. Understanding the dynamics of oocyte maturation is essential for the optimization of IVM culture conditions and subsequent IVP outcomes. Thus, the aim of this study was to elucidate the transcriptome dynamics of oocyte maturation by comparing transcriptomic changes during in vitro maturation in both oocytes and their surrounding cumulus cells. Cumulus-oocyte complexes were obtained from antral follicles and divided into two groups: immature and in vitro-matured (MII). RNA was extracted separately from oocytes (OC) and cumulus cells (CC), followed by library preparation and RNA sequencing. A total of 13,918 gene transcripts were identified in OC, with 538 differentially expressed genes (DEG) between immature OC and in vitro-matured OC. In CC, 13,104 genes were expressed with 871 DEG. Gene ontology (GO) analysis showed an association between the DEGs and pathways relating to nuclear maturation in OC and GTPase activity, extracellular matrix organization, and collagen trimers in CC. Additionally, the follicle-stimulating hormone receptor gene ( FSHR ) and luteinizing hormone/choriogonadotropin receptor gene ( LHCGR ) showed differential expressions between CC-MII and immature CC samples. Overall, these results serve as a foundation to further investigate the biological pathways relevant to oocyte maturation in horses and pave the road to improve the IVP outcomes and the overall clinical management of equine assisted reproductive technologies (ART).

The placenta is a temporary organ that is essential for the survival of the fetus, with a lifelong effect on the health of both the offspring and the dam. The functions of the placenta are controlled by its dynamic gene expression during gestation. In this study, we aimed to investigate the equine placental DNA methylome as one of the fundamental mechanisms that controls the gene expression dynamic. Chorioallantois samples from four (4M), six (6M), and ten (10M) months of gestation were used to map the methylation pattern of the placenta. Globally, methylation levels increased toward the end of gestation. We identified 921 differentially methylated regions (DMRs) between 4M and 6M, 1225 DMRs between 4M and 10M, and 1026 DMRs between 6M and 10M. A total of 817 genes carried DMRs comparing 4M and 6M, 978 comparing 4M and 10M, and 804 comparing 6M and 10M. We compared the transcriptomes between the samples and found 1381 differentially expressed genes (DEGs) when comparing 4M and 6M, 1428 DEGs between 4M and 10M, and 741 DEGs between 6M and 10M. Finally, we overlapped the DEGs and genes carrying DMRs (DMRs-DEGs). Genes exhibiting (a) higher expression, low methylation and (b) low expression, high methylation at different time points were identified. The majority of these DMRs-DEGs were located in introns (48.4%), promoters (25.8%), and exons (17.7%) and were involved in changes in the extracellular matrix; regulation of epithelial cell migration; vascularization; and regulation of minerals, glucose, and metabolites, among other factors. Overall, this is the first report highlighting the dynamics in the equine placenta methylome during normal pregnancy. The findings presented serve as a foundation for future studies on the impact of abnormal methylation on the outcomes of equine pregnancies.

The rising prevalence of extended-spectrum β-lactamase (ESBL)-producing Enterobacterales is a significant threat to animal and human health. This study aims to describe the clinical features, antimicrobial susceptibility patterns, and genotypic features of infections associated with ESBL-producing Enterobacterales in dogs and cats seen at a tertiary referral veterinary teaching hospital. Enterobacterales isolated from dogs and cats that underwent ESBL testing during the study period were identified using a search of the hospital antimicrobial susceptibility test software database. Medical records of confirmed ESBL isolates were reviewed, and the source of infection, clinical findings, and antimicrobial susceptibility were recorded. Genomic DNA from bacterial isolates was evaluated for antimicrobial resistance genes with whole genome sequencing. Thirty ESBL-producing isolates were identified based on phenotypic testing (twenty-nine from dogs, one from a cat); twenty-six were Escherichia coli and the remainder were Klebsiella spp. Bacterial cystitis was the most commonly identified (8/30, 27%) clinical problem associated with infection. Resistance to three or more antimicrobial classes was identified in 90% (27/30) of isolates, and all isolates were susceptible to imipenem. Over 70% of isolates were susceptible to piperacillin-tazobactam, amikacin, and cefoxitin. Bla was the most common ESBL gene identified, present in 13/22 (59%) isolate genomes. A wide range of clinical infections were identified. Piperacillin-tazobactam and amikacin may be alternatives to carbapenem therapy. Further, larger-scale studies are needed.CTX-M-15 was the most common ESBL gene identified, present in 13/22 (59%) isolate genomes. A wide range of clinical infections were identified. Piperacillin-tazobactam and amikacin may be alternatives to carbapenem therapy. Further, larger-scale studies are needed.

It is necessary to study hormonal patterns from mules to recognize alterations and neonatal maladaptation. Our objective was to evaluate concentrations of hormones in mule (n = 6) and equine foals (n = 6). Blood was collected at T0, 1, 6 and 12 h after birth. Hormone concentrations were evaluated using liquid chromatography tandem mass spectrometry. Effects of time, group and interactions and regression analysis were evaluated (p < 0.05). There was a cubic and quadratic decline in mule and equine foals, respectively, for 3β,20α-dihydroxy-DHP. Mule foals were born with lower circulating 3β,20α-dihydroxy-DHP concentrations, which might be related to progestogen concentrations in mares with a hybrid placenta. Corticosterone and cortisol concentrations remained unchanged for the first hour post-foaling then declined in mule and equine foals (p < 0.0001). Dehydroepiandrosterone was the main androgen present. There was a decrease in dihydrotestosterone at 12 h (p = 0.002). Differences in the temporal patterns of secretion within each steroid class, pregnanes, corticoids, and androgens, suggest they were derived from different tissue sources, presumptively the placenta, adrenals and gonads of the fetus/neonate, respectively. Mule and horse foals were born without evidence of testosterone secretion. For the first time, steroid hormone levels were measured in neonatal mules, and this will provide insight into neonatal physiology that differs from equine and allow us to gain an understanding of mules that have rarely been studied. Further studies are needed to elucidate the effects of hybrid pregnancies in the steroid endocrinology of neonates.

We used mitochondrial sequences and nuclear microsatellites to investigate population structure of gray foxes (Urocyon cinereoargenteus) and the evolutionary origins of the endemic island fox (Urocyon littoralis), which first appeared in the northern Channel Islands <13,000 years ago and in the southern Channel Islands <6000 years ago. It is unclear whether island foxes evolved directly from mainland gray foxes transported to the islands one or more times or from a now-extinct mainland population, already diverged from the gray fox. Our 345 mitochondrial sequences, combined with previous data, confirmed island foxes to be monophyletic, tracing to a most recent common ancestor approximately 85,000 years ago. Our rooted nuclear DNA tree additionally indicated genome-wide monophyly of island foxes relative to western gray foxes, although we detected admixture in northern island foxes from adjacent mainland gray foxes, consistent with some historical gene flow. Southern California gray foxes also bore a genetic signature of admixture and connectivity to a desert population, consistent with partial replacement by a late-Holocene range expansion. Using our outgroup analysis to root previous nuclear sequence-based trees indicated reciprocal monophyly of northern versus southern island foxes. Results were most consistent with island fox origins through multiple introductions from a now-extirpated mainland population.

Since domestication, horses have been selectively bred for various coat colors and white spotting patterns. To investigate breed distribution, allele frequencies, and potential lethal variants for recommendations on genetic testing, 29 variants within 14 genes were investigated in 11,281 horses from 28 breeds. The recessive chestnut ea allele in melanocortin 1 receptor (MC1R) (p.D84N) was identified in four breeds: Knabstrupper, Paint Horse, Percheron, and Quarter Horse. After filtering for relatedness, ea allele frequency in Knabstruppers was estimated at 0.035, thus illustrating the importance of testing for mate selection for base coat color. The Rocky Mountain Horse breed had the highest allele frequency for two of the dilution variants under investigation (Za.f. = 0.32 and Cha.f. = 0.026); marker-assisted selection in this breed could aid in the production of horses with desirable dilute coats with less severe ocular anomalies caused by the silver (Z) allele. With regard to white patterning, nine horses homozygous for the paired box 3 (PAX3) splashed white 2 (SW2) allele (p.C70Y) and six horses homozygous for the KIT proto-oncogene, receptor tyrosine kinase (KIT) sabino 1 (SB1) allele (ECA3g.79544206A>T) were identified, thus determining they are rare and confirming that homozygosity for SW2 is not embryonic lethal. The KIT dominant white 20 (W20) allele (p.R682H) was identified in all but three breeds: Arabian (n = 151), Icelandic Horse (n = 66), and Norwegian Fjord Horse (n = 90). The role of W20 in pigmentation across breeds is not well understood; given the different selection regimes of the breeds investigated, these data provide justification for further evaluating the functional role of this allele in pigmentation. Here, we present the largest dataset reported for coat color variants in horses to date, and these data highlight the importance of breed-specific studies to inform on the proper use of marker-assisted selection and to develop hypotheses related to pigmentation for further testing in horses.

Infectious bronchitis virus (IBV) is a highly variable RNA virus that affects chickens worldwide. Due to its inherited tendency to suffer point mutations and recombination events during viral replication, emergent IBV strains have been linked to nephropathogenic and reproductive disease that are more severe than typical respiratory disease, leading, in some cases, to mortality, severe production losses, and/or unsuccessful vaccination. QX and DMV/1639 strains are examples of the above-mentioned IBV evolutionary pathway and clinical outcome. In this study, our purpose was to systematically compare whole genomes of QX and DMV strains looking at each IBV gene individually. Phylogenetic analyses and amino acid site searches were performed in datasets obtained from GenBank accounting for all IBV genes and using our own relevant sequences as a basis. The QX dataset studied is more genetically diverse than the DMV dataset, partially due to the greater epidemiological diversity within the five QX strains used as a basis compared to the four DMV strains from our study. Historically, QX strains have emerged and spread earlier than DMV strains in Europe and Asia. Consequently, there are more QX sequences deposited in GenBank than DMV strains, assisting in the identification of a larger pool of QX strains. It is likely that a similar evolutionary pattern will be observed among DMV strains as they develop and spread in North America.

The novel severe acute respiratory syndrome (SARS) coronavirus, SARS-CoV-2, is responsible for the global COVID-19 pandemic. Effective interventions are urgently needed to mitigate the effects of COVID-19 and likely require multiple strategies. Egg-extracted antibody therapies are a low-cost and scalable strategy to protect at-risk individuals from SARS-CoV-2 infection. Commercial laying hens were hyperimmunized against the SARS-CoV-2 S1 protein using three different S1 recombinant proteins and three different doses. Sera and egg yolk were collected at three and six weeks after the second immunization for enzyme-linked immunosorbent assay and plaque-reduction neutralization assay to determine antigen-specific antibody titers and neutralizing antibody titers, respectively. In this study we demonstrate that hens hyperimmunized against the SARS-CoV-2 recombinant S1 and receptor binding domain (RBD) proteins produced neutralizing antibodies against SARS-CoV-2. We further demonstrate that antibody production was dependent on the dose and type of antigen administered. Our data suggests that antibodies purified from the egg yolk of hyperimmunized hens can be used as immunoprophylaxis in humans at risk of exposure to SARS-CoV-2.

In May 2018, an outbreak of virulent Newcastle disease (vND) affected backyard and commercial premises in Southern California. The re-occurrence of these outbreaks since the 1970s suggests that some poultry communities may not have reliable and stable resources available regarding biosecurity and disease prevention. Therefore, staff at the University of California, Davis (UCD) School of Veterinary Medicine (SVM), and the California Department of Food and Agriculture (CDFA) began organizing educational events and learning more about the gamefowl breeder community through a needs assessment exercise, during which local feedstores and neighborhoods were also visited. Focus groups were organized with breeders in various cities within the regional quarantine area, established by the CDFA during the vND outbreak. The focus groups were aimed at creating open communication networks with gamefowl breeders in the affected area, as well as to learn about their current sources of information, learning preferences, and current management practices. With the input from gamefowl breeders, as well as funding and input from the CDFA and the United States Department of Agriculture (USDA), a quality assurance program called the "Gamefowl Wellness Program" was established. Educational content was created and published through the UCD Gamefowl Wellness Program poultry health website. Additionally, with the help of the CDFA, the USDA, and pharmaceutical companies, Newcastle disease vaccines and training for their application were provided to feedstores with gamefowl breeder clientele. Nurturing trust with these poultry communities allowed us to receive the information needed to develop effective outreach strategies that could better serve them. Responding to community concerns might be a way to garner the trust necessary to prevent or at least promptly detect foreign animal disease outbreaks.

We investigated two litters of distantly related Nova Scotia Duck Tolling Retrievers (NSDTR), of which four puppies were affected by cerebellar signs with or without neuromuscular weakness. The phenotype was termed cerebellar degeneration—myositis complex (CDMC). We suspected a heritable condition and initiated a genetic analysis. The genome of one affected dog was sequenced and compared to 565 control genomes. This search yielded a private protein-changing SLC25A12 variant in the affected dog, XM&#95;038584842.1:c.1337C>T, predicted to result in the amino acid change XP&#95;038440770.1:(p.Pro446Leu). The genotypes at the variant co-segregated with the phenotype as expected for a monogenic autosomal recessive mode of inheritance in both litters. Genotyping of 533 additional NSDTR revealed variant allele frequencies of 3.6% and 1.3% in a European and a North American cohort, respectively. The available clinical and biochemical data, together with current knowledge about SLC25A12 variants and their functional impact in humans, mice, and dogs, suggest the p.Pro446Leu variant is a candidate causative defect for the observed phenotype in the affected dogs.

Two FGF4 retrogenes ( FGF4L1 on chromosome 18 and FGF4L2 on chromosome 12) have been identified to cause dwarfism across many dog breeds. Some breeds are nearly homozygous for both retrogenes (e.g., Dachshunds) and others are homozygous for just one (e.g., Beagles and Scottish Terriers). Since most breeds do not segregate both of these retrogenes, it is challenging to evaluate their individual effects on long bone length and body size. We identified two dog breeds selected for hunting ability, the Alpine Dachsbracke and the Schweizer Niederlaufhund, that segregate both of these retrogenes. Using individual measurements of height at the shoulder, back length, head width, thorax depth and width, and thoracic limb measurements, we evaluated the combined effects of FGF4 retrogenes within these breeds. We applied multivariable linear regression analysis to determine the effects of retrogene copy numbers on the measurements. Copy numbers of both retrogenes had significant effects reducing height at the shoulders and antebrachial length, with FGF4L1 having a much greater effect than FGF4L2 . FGF4L1 alone influenced the degree of carpal valgus and FGF4L2 alone increased head width. Neither retrogene had an effect on thorax width or depth. Selectively breeding dogs with FGF4L1 and without FGF4L2 would likely lead to a reduction in the FGF4L2 -related risk of intervertebral disc herniation while maintaining the reduction in leg length resulting from FGF4L1.

Coat color is a trait of economic significance in horses. Variants in seven genes have been documented to cause white patterning in horses. Of the 34 variants that have been identified in KIT proto-oncogene, receptor tyrosine kinase ( KIT ), 27 have only been reported in a single individual or family and thus not all are routinely offered for genetic testing. Therefore, to enable proper use of marker-assisted selection, determining breed specificity for these alleles is warranted. Screening 19 unregistered all-white Shetland ponies for 16 white patterning markers identified 14 individuals whose phenotype could not be explained by testing results. In evaluating other known dominant white variants, 14 horses were heterozygous for W13. W13 was previously only reported in two quarter horses and a family of Australian miniature horses. Genotyping known white spotting variants in 30 owner-reported white animals (25 Miniature Horses and five Shetland ponies) identified two additional W13/N American Miniature Horses. The estimated allele frequency of W13 in the American Miniature Horse was 0.0063 (79 N/N , 1 W13/N ) and the allele was not detected in a random sample ( n = 59) of Shetland ponies. No homozygous W13 individuals were identified and W13/N ponies had a similar all-white coat with pink skin phenotype, regardless of the other white spotting variants present, demonstrating that W13 results in a Mendelian inherited dominant white phenotype and homozygosity is likely lethal. These findings document the presence of W13 in the American Miniature Horse and Shetland pony populations at a low frequency and illustrate the importance of testing for this variant in additional breeds.

Myosinopathies are defined as a group of muscle disorders characterized by mutations in genes encoding myosin heavy chains. Their exact molecular and cellular mechanisms remain unclear. In the present study, we have focused our attention on a MYH1 -related E321G amino acid substitution within the head region of the type IIx skeletal myosin heavy chain, associated with clinical signs of atrophy, inflammation and/or profound rhabdomyolysis, known as equine myosin heavy chain myopathy. We performed Mant-ATP chase experiments together with force measurements on isolated IIx myofibres from control horses ( MYH1 E321G-/- ) and Quarter Horses homozygous ( MYH1 E321G+/+ ) or heterozygous ( MYH1 E321G+/- ) for the E321G mutation. The single residue replacement did not affect the relaxed conformations of myosin molecules. Nevertheless, it significantly increased its active behaviour as proven by the higher maximal force production and Ca 2+ sensitivity for MYH1 E321G+/+ in comparison with MYH1 E321G+/- and MYH1 E321G-/- horses. Altogether, these findings indicate that, in the presence of the E321G mutation, a molecular and cellular hyper-contractile phenotype occurs which could contribute to the development of the myosin heavy chain myopathy.

A sufficient vascular network within the feto-maternal interface is necessary for placental function. Several pregnancy abnormalities have been associated with abnormal vascular formations in the placenta. We hypothesized that growth and expansion of the placental vascular network in the equine ( Equus caballus ) placenta is regulated by estrogens (estrogen family hormones), a hormone with a high circulating concentration during equine gestation. Administration of letrozole, a potent and specific inhibitor of aromatase, during the first trimester (D30 to D118), decreased circulatory estrone sulfate concentrations, increased circulatory testosterone and androstenedione concentrations, and tended to reduce the weight of the fetus ( p < 0.1). Moreover, the gene expression of CYP17A1 was increased, and the expression of androgen receptor was decreased in the D120 chorioallantois (CA) of letrozole-treated mares in comparison to that of the control mares. We also found that at D120, the number of vessels tended to decrease in the CAs with letrozole treatment ( p = 0.07). In addition, expression of a subset of angiogenic genes, such as ANGPT1 , VEGF , and NOS2 , were altered in the CAs of letrozole-treated mares. We further demonstrated that 17β-estradiol increases the expression of ANGPT1 and VEGF and increases the angiogenic activity of equine endothelial cells in vitro. Our results from the estrogen-suppressed group demonstrated an impaired placental vascular network, suggesting an estrogen-dependent vasculogenesis in the equine CA during the first trimester.

The horse reference genome assemblies, EquCab2.0 and EquCab3.0, have enabled great advancements in the equine genomics field, from tools to novel discoveries. However, significant gaps of knowledge regarding genome function remain, hindering the study of complex traits in horses. In an effort to address these gaps and with inspiration from the Encyclopedia of DNA Elements (ENCODE) project, the equine Functional Annotation of Animal Genome (FAANG) initiative was proposed to bridge the gap between genome and gene expression, providing further insights into functional regulation within the horse genome. Three years after launching the initiative, the equine FAANG group has generated data from more than 400 experiments using over 50 tissues, targeting a variety of regulatory features of the equine genome. In this review, we examine how valuable lessons learned from the ENCODE project informed our decisions in the equine FAANG project. We report the current state of the equine FAANG project and discuss how FAANG can serve as a template for future expansion of functional annotation in the equine genome and be used as a reference for studies of complex traits in horse. A well-annotated reference functional atlas will also help advance equine genetics in the pan-genome and precision medicine era.

Infectious bronchitis virus (IBV) induces respiratory and urogenital disease in chickens. Although IBV replicates in the gastrointestinal tract, enteric lesions are uncommon. We have reported a case of runting-stunting syndrome in commercial broilers from which an IBV variant was isolated from the intestines. The isolate, CalEnt, demonstrated an enteric tissue tropism in chicken embryos and SPF chickens experimentally. Here, we determined the full genome of CalEnt and compared it to other IBV strains, in addition to comparing the pathobiology of CalEnt and M41 in commercial broilers. Despite the high whole-genome identity to other IBV strains, CalEnt is rather unique in its nucleotide composition. The S gene phylogenetic analyses showed great similarity between CalEnt and Cal 99. Clinically, vent staining was slightly more frequent in CalEnt-infected birds than those challenged with M41. Furthermore, IBV IHC detection was more evident and the viral shedding in feces was overall higher with the CalEnt challenge compared with M41. Despite underlying intestinal lesions caused by coccidiosis and salmonellosis vaccination, microscopic lesions in CalEnt-infected chickens were more severe than in M41-infected chickens or controls, supporting the enteric tropism of CalEnt. Further studies in SPF chickens are needed to determine the pathogenesis of the virus, its molecular mechanisms for the enteric tropism, and its influence in intestinal health.

The red fox ( Vulpes vulpes ) has a wide global distribution with many ecotypes and has been bred in captivity for various traits, making it a useful evolutionary model system. The Y chromosome represents one of the most informative markers of phylogeography, yet it has not been well-studied in the red fox due to a lack of the necessary genomic resources. We used a target capture approach to sequence a portion of the red fox Y chromosome in a geographically diverse red fox sample, along with other canid species, to develop single nucleotide polymorphism (SNP) markers, 13 of which we validated for use in subsequent studies. Phylogenetic analyses of the Y chromosome sequences, including calibration to outgroups, confirmed previous estimates of the timing of two intercontinental exchanges of red foxes, the initial colonization of North America from Eurasia approximately half a million years ago and a subsequent continental exchange before the last Pleistocene glaciation (~100,000 years ago). However, in contrast to mtDNA, which showed unidirectional transfer from Eurasia to North America prior to the last glaciation, the Y chromosome appears to have been transferred from North America to Eurasia during this period. Additional sampling is needed to confirm this pattern and to further clarify red fox Y chromosome phylogeography.

Squamous cell carcinoma (SCC) is the most common cancer affecting the equine eye. A missense variant within the gene damage-specific DNA binding protein 2 (DDB2 c.1013 C>T , p.Thr338Met) was previously identified as a causal recessive genetic risk factor for the development of ocular SCC within Haflingers, Belgian Draft horses, and Rocky Mountain Horses, but not in the Appaloosa or Arabian breeds. This study aimed to evaluate three cases of ocular SCC in additional breeds and determine if DNA testing for the DDB2 variant in warmblood horses and Connemara ponies is warranted. Histopathology confirmed ocular SCC in all three cases and DNA testing confirmed each horse was homozygous for the DDB2 risk factor. The DDB2 risk allele frequency was estimated to be 0.0043 for Holsteiners ( N = 115), 0.014 for Belgian Warmbloods ( N = 71), and 0.22 for Connemara Ponies ( N = 86). Taken together these data support using DNA testing for DDB2 in Connemara Ponies to assist in mate selection and clinical management. Given the low observed allele frequencies in both the Holsteiner and Belgian Warmblood breeds and that the case under investigation was a warmblood cross-bred, evaluating additional SCC affected warmbloods is warranted to fully determine the importance of DDB2 genotyping as a risk factor in warmblood breeds.

Ca 2+ regulation in equine muscle is important for horse performance, yet little is known about this species-specific regulation. We reported recently that horse encode unique gene and protein sequences for the sarcoplasmic reticulum (SR) Ca 2+ -transporting ATPase (SERCA) and the regulatory subunit sarcolipin (SLN). Here we quantified gene transcription and protein expression of SERCA and its inhibitory peptides in horse gluteus, as compared to commonly-studied rabbit skeletal muscle. RNA sequencing and protein immunoblotting determined that horse gluteus expresses the ATP2A1 gene (SERCA1) as the predominant SR Ca 2+ -ATPase isoform and the SLN gene as the most-abundant SERCA inhibitory peptide, as also found in rabbit skeletal muscle. Equine muscle expresses an insignificant level of phospholamban (PLN), another key SERCA inhibitory peptide expressed commonly in a variety of mammalian striated muscles. Surprisingly in horse, the RNA transcript ratio of SLN -to- ATP2A1 is an order of magnitude higher than in rabbit, while the corresponding protein expression ratio is an order of magnitude lower than in rabbit. Thus, SLN is not efficiently translated or maintained as a stable protein in horse muscle, suggesting a non-coding role for supra-abundant SLN mRNA. We propose that the lack of SLN and PLN inhibition of SERCA activity in equine muscle is an evolutionary adaptation that potentiates Ca 2+ cycling and muscle contractility in a prey species domestically selected for speed.

In spring 2020, six Hereford calves presented with congenital facial deformities attributed to a condition we termed mandibulofacial dysostosis (MD). Affected calves shared hallmark features of a variably shortened and/or asymmetric lower mandible and bilateral skin tags present 2-10 cm caudal to the commissure of the lips. Pedigree analysis revealed a single common ancestor shared by the sire and dam of each affected calf. Whole-genome sequencing (WGS) of 20 animals led to the discovery of a variant (Chr26 g. 14404993T>C) in Exon 3 of CYP26C1 associated with MD. This missense mutation (p.L188P), is located in an α helix of the protein, which the identified amino acid substitution is predicted to break. The implication of this mutation was further validated through genotyping 2 additional affected calves, 760 other Herefords, and by evaluation of available WGS data from over 2500 other individuals. Only the affected individuals were homozygous for the variant and all heterozygotes had at least one pedigree tie to the suspect founder. CYP26C1 plays a vital role in tissue-specific regulation of retinoic acid (RA) during embryonic development. Dysregulation of RA can result in teratogenesis by altering the endothelin-1 signaling pathway affecting the expression of Dlx genes, critical to mandibulofacial development. We postulate that this recessive missense mutation in CYP26C1 impacts the catalytic activity of the encoded enzyme, leading to excess RA resulting in the observed MD phenotype.

Heat stress results in reduced productivity, anorexia, and mortality in chickens. The objective of the study was to identify genes and signal pathways associated with heat stress and Newcastle disease virus (NDV) infection in the liver of chickens through RNA-seq analysis, using two highly inbred chicken lines (Leghorn and Fayoumi). All birds were held in the same environment until 14 days of age. On day 14, half the birds were exposed to 38 °C with 50% relative humidity for 4 h, then 35 °C until the end of the experiment. The remaining birds were kept at 25 °C throughout the experiment. The heat-treated birds were inoculated at 21 days of age with 10 7 EID 50 (One EID 50 unit is the amount of virus that will infect 50 percent of inoculated embryos) NDV La Sota strain to investigate the effects of both heat stress and NDV infection. Physiological parameters were recorded as blood phenotypes at three stages: acute heat (AH), chronic heat (CH1), and chronic heat combined with NDV infection (CH&NDV), at 4 h, 7 days, and 10 days post-initiation of heat treatment, respectively. Our previous work revealed that the heat-resilient Fayoumi line maintained a more stable acid-base balance in their blood compared to the Leghorn line. Liver samples were harvested on both AH and CH&NDV to characterize the transcriptome profiles of these two inbred lines. Both genetic lines and treatments had large impact on the liver transcriptome. Fayoumi birds had more differentially expressed genes (DEGs) than Leghorn birds for both treatments. Metabolic and immune-related genes were on the DEG list, with Fayoumi having more immune-related DEGs than Leghorns, which was confirmed by gene functional enrichment analysis. Weighted correlation network analysis (WGCNA) indicated that the driver genes such as Solute Carrier Family genes could be very important for stabilizing the acid-base balance in Fayoumi birds during heat stress. Therefore, candidate genes such solute carrier family genes could be potential genetic targets that are regulated by Fayoumis to maintain physical hemostasis under heat stress. Differential gene expression showed that Leghorns mainly performed metabolic regulation in response to heat stress and NDV infection, while Fayoumis regulated both immune and metabolic functions. This study provides novel insights and enhances our understandings of liver response to heat stress of heat resilient and susceptible inbred chicken lines.

Dogs provide highly valuable models of human disease due to the similarity in phenotype presentation and the ease of genetic analysis. Seven Saluki puppies were investigated for neurological abnormalities including seizures and altered behavior. Magnetic resonance imaging showed a diffuse, marked reduction in cerebral cortical thickness, and symmetrical T2 hyperintensity in specific brain regions. Cerebral cortical atrophy with vacuolation (status spongiosus) was noted on necropsy. Genome-wide association study of 7 affected and 28 normal Salukis revealed a genome-wide significantly associated region on CFA 35. Whole-genome sequencing of three confirmed cases from three different litters revealed a homozygous missense variant within the aldehyde dehydrogenase 5 family member A1 ( ALDH5A1 ) gene (XM&#95;014110599.2: c.866G>A; XP&#95;013966074.2: p.(Gly288Asp). ALDH5A1 encodes a succinic semialdehyde dehydrogenase (SSADH) enzyme critical in the gamma-aminobutyric acid neurotransmitter (GABA) metabolic pathway. Metabolic screening of affected dogs showed markedly elevated gamma-hydroxybutyric acid in serum, cerebrospinal fluid (CSF) and brain, and elevated succinate semialdehyde in urine, CSF and brain. SSADH activity in the brain of affected dogs was low. Affected Saluki dogs had striking similarities to SSADH deficiency in humans although hydroxybutyric aciduria was absent in affected dogs. ALDH5A1 -related SSADH deficiency in Salukis provides a unique translational large animal model for the development of novel therapeutic strategies.

Newcastle disease (ND) is one of the most challenging infectious diseases affecting poultry production in Africa, causing major economic losses. To date, Newcastle disease virus isolates from several African countries have been grouped into class II NDV genotypes I, IV, V, VI, VII, XI, XIII, XIV, XVII, XVIII and XXI. Although ND is endemic in many African countries, information on circulating genotypes is still scarce. In Tanzania, outbreaks with genotypes V and XIII have been reported. In West and Central Africa, genotypes XIV, XVII, and XVIII are the most predominant. To investigate other genotypes circulating in Tanzania and Ghana, we performed molecular genotyping on isolates from Tanzania and Ghana using the MinION, a third-generation portable sequencing device from Oxford Nanopore Technologies. Using the MinION, we successfully sequenced the NDV F gene hypervariable region of 24 isolates from Tanzania and four samples from Ghana. In Tanzania, genotypes V, VII and XIII were detected. All isolates from Ghana belonged to genotype XVIII. The data obtained in this study reflect the genetic diversity of NDV in Africa and highlight the importance of surveillance for monitoring the distribution of NDV genotypes and viral evolution.

Two transcribed retrocopies of the fibroblast growth factor 4 ( FGF4 ) gene have previously been described in the domestic dog. An FGF4 retrocopy on chr18 is associated with disproportionate dwarfism, while an FGF4 retrocopy on chr12 is associated with both disproportionate dwarfism and intervertebral disc disease (IVDD). In this study, whole-genome sequencing data were queried to identify other FGF4 retrocopies that could be contributing to phenotypic diversity in canids. Additionally, dogs with surgically confirmed IVDD were assayed for novel FGF4 retrocopies. Five additional and distinct FGF4 retrocopies were identified in canids including a copy unique to red wolves ( Canis rufus ). The FGF4 retrocopies identified in domestic dogs were identical to domestic dog FGF4 haplotypes, which are distinct from modern wolf FGF4 haplotypes, indicating that these retrotransposition events likely occurred after domestication. The identification of multiple, full length FGF4 retrocopies with open reading frames in canids indicates that gene retrotransposition events occur much more frequently than previously thought and provide a mechanism for continued genetic and phenotypic diversity in canids.

Brown or chocolate coat color in many mammalian species is frequently due to variants at the B locus or TYRP1 gene. In dogs, five different TYRP1 loss-of-function alleles have been described, which explain the vast majority of dogs with brown coat color. Recently, breeders and genetic testing laboratories identified brown French Bulldogs that did not carry any of the known mutant TYRP1 alleles. We sequenced the genome of a TYRP1 +/+ brown French Bulldog and compared the data to 655 other canine genomes. A search for private variants revealed a nonsense variant in HPS3 , c.2420G>A or p.(Trp807*). The brown dog was homozygous for the mutant allele at this variant. The HPS3 gene encodes a protein required for the correct biogenesis of lysosome-related organelles, including melanosomes. Variants in the human HPS3 gene cause Hermansky-Pudlak syndrome 3, which involves a mild form of oculocutaneous albinism and prolonged bleeding time. A variant in the murine Hps3 gene causes brown coat color in the cocoa mouse mutant. We genotyped a cohort of 373 French Bulldogs and found a strong association of the homozygous mutant HPS3 genotype with the brown coat color. The genotype-phenotype association and the comprehensive knowledge on HPS3 function from other species strongly suggests that HPS3 :c.2420G>A is the causative variant for the observed brown coat color in French Bulldogs. In order to clearly distinguish HPS3 -related from the TYRP1 -related brown coat color, and in line with the murine nomenclature, we propose to designate this dog phenotype as "cocoa", and the mutant allele as HPS3 co .

A 4-month-old female Irish Terrier presented with a well demarcated ulcerative and crusting lesion in the right ear canal. Histological analysis revealed epidermal hyperplasia with severe acantholysis affecting all suprabasal layers of the epidermis, which prompted a presumptive diagnosis of canine Darier disease. The lesion was successfully treated by repeated laser ablation of the affected epidermis. Over the course of three years, the dog additionally developed three dermal nodules of up to 4 cm in diameter that were excised and healed without complications. Histology of the excised tissue revealed multiple infundibular cysts extending from the upper dermis to the subcutis. The cysts were lined by squamous epithelium, which presented with abundant acantholysis of suprabasal keratinocytes. Infundibular cysts represent a novel finding not previously reported in Darier patients. Whole genome sequencing of the affected dog was performed, and the functional candidate genes for Darier disease ( ATP2A2 ) and Hailey-Hailey disease ( ATP2C1 ) were investigated. The analysis revealed a heterozygous SINE insertion into the ATP2A2 gene, at the end of intron 14, close to the boundary of exon 15. Analysis of the ATP2A2 mRNA from skin of the affected dog demonstrated a splicing defect and marked allelic imbalance, suggesting nonsense-mediated decay of the resulting aberrant transcripts. As Darier disease in humans is caused by haploinsufficiency of ATP2A2 , our genetic findings are in agreement with the clinical and histopathological data and support the diagnosis of canine Darier disease.

Cutaneous lupus erythematosus (CLE) in humans encompasses multiple subtypes that exhibit a wide array of skin lesions and, in some cases, are associated with the development of systemic lupus erythematosus (SLE). We investigated dogs with exfoliative cutaneous lupus erythematosus (ECLE), a dog-specific form of chronic CLE that is inherited as a monogenic autosomal recessive trait. A genome-wide association study (GWAS) with 14 cases and 29 controls confirmed a previously published result that the causative variant maps to chromosome 18. Autozygosity mapping refined the ECLE locus to a 493 kb critical interval. Filtering of whole genome sequence data from two cases against 654 controls revealed a single private protein-changing variant in this critical interval, UNC93B1 :c.1438C>A or p.Pro480Thr. The homozygous mutant genotype was exclusively observed in 23 ECLE affected German Shorthaired Pointers and an ECLE affected Vizsla, but absent from 845 controls. UNC93B1 is a transmembrane protein located in the endoplasmic reticulum and endolysosomes, which is required for correct trafficking of several Toll-like receptors (TLRs). The p.Pro480Thr variant is predicted to affect the C-terminal tail of the UNC93B1 that has recently been shown to restrict TLR7 mediated autoimmunity via an interaction with syndecan binding protein (SDCBP). The functional knowledge on UNC93B1 strongly suggests that p.Pro480Thr is causing ECLE in dogs. These dogs therefore represent an interesting spontaneous model for human lupus erythematosus. Our results warrant further investigations of whether genetic variants affecting the C-terminus of UNC93B1 might be involved in specific subsets of CLE or SLE cases in humans and other species., Competing Interests: The authors declare no conflict of interest.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype ( p = 2.05 × 10 -7 and 4.72 × 10 -6 ). Within this region, caytaxin ( ATCAY ) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY ® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcay ji mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of -hes mice. Additionally, supplementation of homozygous Atcay ji mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. -hes mice. Additionally, supplementation of homozygous Atcay ji -hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM.

Dogs exhibit a wide variety of coat color types, and many genes have been identified that control pigment production, appearance, and distribution. Some breeds, such as the Nova Scotia Duck Tolling Retriever (NSDTR), exhibit variation in pheomelanin pigment intensity that is not explained by known genetic variants. A genome-wide association study comparing light red to dark red in the NSDTR identified a significantly associated region on canine chromosome 15 (CFA 15:23 Mb-38 Mb). Coverage analysis of whole genome sequence data from eight dogs identified a 6 kb copy number variant (CNV) 152 kb upstream of KITLG . Genotyping with digital droplet PCR (ddPCR) confirmed a significant association between an increased copy number with the dark-red coat color in NSDTR ( p = 6.1 × 10 -7 ). The copy number of the CNV was also significantly associated with coat color variation in both eumelanin and pheomelanin-based Poodles ( p = 1.5 × 10 -8 , 4.0 × 10 -9 ) and across other breeds. Moreover, the copy number correlated with pigment intensity along the hair shaft in both pheomelanin and eumelanin coats. KITLG plays an important role in melanogenesis, and variants upstream of KITLG have been associated with coat color variation in mice as well as hair color in humans consistent with its role in the domestic dog., Competing Interests: The authors declare no conflict of interest.

One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein-protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse., Competing Interests: C.C. is affiliated with Diagenode which is a leading provider of complete solutions for epigenetics research, including end-to-end services.

This study quantified the association of rodent fruit damage and the microbiological quality of irrigation water on the risk of microbiological contamination of strawberries collected from 18 U-pick farms across five different districts in the Guangzhou metropolitan region of southern China. Fifty-four composite strawberries samples, with or without evidence of rodent or avian foraging damage (i.e., bitten), along with 16 irrigation water samples, were collected during the spring of 2014 and winter of 2015 from our cohort of 18 farms. Composite strawberry samples and irrigation water were analyzed for total coliforms, E. coli , Salmonella , E. coli O157, Giardia , and Cryptosporidium . Total coliforms and E. coli were detected in 100% and ~90% of irrigation water samples, respectively. In contrast, Cryptosporidium was detected in only two water samples, while Salmonella , E. coli O157, and Giardia were not detected in any water samples. Strawberries with signs of being bitten by wildlife had significantly higher concentrations of total coliforms and E. coli, compared to strawberries with no physical evidence of rodent damage ( p < 0.001). Similarly, Cryptosporidium was detected in 7/18 (39%) of bitten, 4/18 (22%) of edge, and 5/18 (28%) of central strawberry samples, respectively. Concentration of E. coli on strawberries ( p < 0.001), air temperature ( p = 0.025), and presence of Cryptosporidium in irrigation water ( p < 0.001) were all associated with the risk of Cryptosporidium contamination on strawberries. Salmonella and Giardia were detected in <4% strawberry samples and E. coli O157 was not detected in any samples. These results indicate the potential food safety and public health risks of consuming unwashed strawberries from U-pick farms, and the need for improved rodent biosecurity of U-pick strawberry fields and enhanced microbiological quality of irrigation water used at these facilities.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit ( TRIM39-RPP21 ) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic ( P = 1.00) or allelic ( P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 ( ADGRL3 ) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs ( P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses.

Two FGF4 retrogenes on chromosomes 12 (12- FGF4 RG) and 18 (18- FGF4 RG) contribute to short-limbed phenotypes in dogs. 12- FGF4 RG has also been associated with intervertebral disc disease (IVDD). Both of these retrogenes were found to be widespread among dog breeds with allele frequencies ranging from 0.02 to 1; however, their additive contribution to disease is unknown. Surgical cases of IVDD ( n = 569) were evaluated for age of onset, disc calcification, and genotypes for the FGF4 retrogenes. Multivariable linear regression analysis identified the presence of one or two copies of 12- FGF4 RG associated with significantly younger age at first surgery in a dominant manner. 18- FGF4 RG had only a minor effect in dogs with one copy. Multivariable logistic regression showed that 12- FGF4 RG had an additive effect on radiographic disc calcification, while 18- FGF4 RG had no effect. Multivariable logistic regression using mixed breed cases and controls identified only 12- FGF4 RG as highly associated with disc herniation in a dominant manner (Odds Ratio, OR, 18.42, 95% Confidence Interval (CI) 7.44 to 50.26; P < 0.001). The relative risk for disc surgery associated with 12- FGF4 RG varied from 5.5 to 15.1 within segregating breeds and mixed breeds. The FGF4 retrogene on CFA12 acts in a dominant manner to decrease the age of onset and increase the overall risk of disc disease in dogs. Other modifiers of risk may be present within certain breeds, including the FGF4 retrogene on CFA18., Competing Interests: The University of California at Davis has a patent pending for genetic testing for the chromosome 12 FGF4 retrogene.

Shiga toxin-producing Escherichia coli , like E. coli O157:H7, are important human and animal pathogens. Naturally-acquired E. coli O157:H7 infections occur in numerous species but, particularly, cattle have been identified as a significant reservoir for human cases. E. coli O157:H7 are isolated from a number of domestic and wild animals, including rodents that share a living space with cattle. These Shiga toxin-producing E. coli O157:H7 strains can be highly virulent in humans, but little is known about the sequelae of interspecies transfer. In a group of neonatal calves, we determined the differences in colonization patterns and lesions associated with infection using either a wildlife or bovine E. coli O157:H7 strain. In calves challenged with the wildlife E. coli O157:H7 strain, the large (descending) colon was solely colonized, which differed substantially from the calves inoculated with the bovine E. coli O157:H7 strain, where the spiral colon was the principal target of infection. This study also demonstrated that while both interspecies- and intraspecies-derived E. coli O157:H7 can infect young calves, the distribution and severity differs.

This study assessed microbiological safety of water from public swimming pools in Guangzhou, China. Water samples from 39 outdoor municipal swimming pools were collected from late June to early September, 2013 and subjected to detection of protozoa ( Giardia and Cryptosporidium ) and bacteria ( Pseudomonas aeruginos , total coliforms, E. coli , E. coli O157, Shigella , and Salmonella ). Cryptosporidium and Giardia were both detected in 5 (12.8%) swimming pools. Total coliforms were detected in 4 (10.3%) samples with concentrations ranging from 1.3 to 154.0 MPN/100 mL while E. coli was detected in 4 (10.3%) samples with concentrations ranging from 0.5 to 5.3 MPN/100 mL. P. aeruginosa was detected in 27 (69.2%) samples but E. coli O157, Shigella and Salmonella were not detected. Among these swimming pools, 9 (23%) met the Chinese National Standard of residual chlorine levels and 24 (62%) were tested free of residual chlorine at least once. The multi-locus sequence typing (MLST) analysis showed that all P. aeruginosa isolates belonged to new sequence types (STs) with dominant ST-1764 and ST-D distributed in different locations within the area. Some P. aeruginosa strains were resistant to medically important antibiotics. Results indicate potential public health risks due to the presence of microbiological pathogens in public swimming pools in this area.