Search

To examine the genetic controls of endosperm (ES) specificity, several cereal seed storage protein (SSP) promoters were isolated and studied using a transient expression analysis system. An oat globulin promoter (AsGlo1) capable of driving strong ES-specific expression in barley and wheat was identified. Progressive 5' deletions and cis element mutations demonstrated that the mechanism of specificity in the AsGlo1 promoter was distinct from that observed in glutelin and prolamin promoters. A novel interrupted palindromic sequence, ACATGTCATCATGT, was required for ES specificity and substantially contributed to expression strength of the AsGlo1 promoter. This sequence was termed the endosperm specificity palindrome (ESP) element. The GCN4 element, which has previously been shown to be required for ES specificity in cereal SSP promoters, had a quantitative role but was not required for tissue specificity. The 960-bp AsGlo1 promoter and a 251-bp deletion containing the ESP element also drove ES-specific expression in stably transformed barley. Reporter gene protein accumulated at very high levels (10% of total soluble protein) in ES tissues of plants transformed with an AsGlo1:GFP construct. Expression strength and tissue specificity were maintained over five transgenic generations. These attributes make the AsGlo1 promoter an ideal promoter for biotechnology applications. In conjunction with previous findings, our data demonstrate that there is more than one genetically distinct mechanism by which ES specificity can be achieved in cereal SSP promoters, and also suggest that there is redundancy between transcriptional and post-transcriptional tissue specificity mechanisms in cereal globulin genes.

A substantial literature exists characterizing transgene locus structure from plants transformed via Agrobacterium and direct DNA delivery. However, there is little comprehensive sequence analysis of transgene loci available, especially from plants transformed by direct delivery methods. The goal of this study was to completely sequence transgene loci from two oat lines transformed via microprojectile bombardment that were shown to have simple transgene loci by Southern analysis. In line 3830, transformed with a single plasmid, one major and one of two minor loci were completely sequenced. Both loci exhibited rearranged delivered DNA and flanking genomic sequences. The minor locus contained only 296 bp of two non-contiguous fragments of the delivered DNA flanked by genomic (filler) DNA that did not originate from the integration target site. Predicted recognition sites for topoisomerase II and a MAR region were observed in the transgene integration target site for this non-functional minor locus. Line 11929, co-transformed with two different plasmids, had a single relatively simple transgene locus composed of truncated and rearranged sequences from both delivered DNAs. The transgene loci in both lines exhibited multiple transgene and genomic DNA rearrangements and regions of scrambling characteristic of complex transgene loci. The similar characteristics of recombined fragments and junctions in both transgenic oat lines implicate similar mechanisms of transgene integration and rearrangement regardless of the number of co-transformed plasmids and the level of transgene locus complexity.

An analysis of protein synthesis at elevated temperatures in oat (Avena sativa) leaves revealed a heat-induced 44 kDa polypeptide. A cDNA library of heat-treated leaves was constructed and screened with specific antibodies raised against this 44 kDa polypeptide. A clone encoding the 44 kDa protein was identified as a form of the chloroplast-localized fructose-bisphosphate aldolase (EC 4.1.2.13). Northern and western blot analyses indicated heat-induced accumulation of the chloroplast aldolase isoform at both the RNA and protein level. Heat inducibility was restricted to the chloroplastic form of the enzyme, and was not observed for the cytoplasmic aldolase. The heat-induced isoform co-purified with thykaloid fractions, as confirmed by immunoassay and activity analyses. However, when thylakoid membranes were treated with proteinase K, the aldolase isoform completely disappeared, suggesting that this enzyme is not embedded but rather tends to adhere to the chloroplast membranes. Immunoblot analysis of other plant species revealed similar heat induction of thykaloid-associated aldolase homologues, suggesting the possible existence of a universal control mechanism for this enzyme's heat tolerance

We introduced the oat adc cDNA into rice under the control of the constitutive maize ubiquitin 1 promoter. We studied molecularly and biochemically sixteen independent transgenic plant lines. Significant increases in mRNA levels, ADC enzyme activity and polyamines were measured in transgenic callus. These increases were not maintained in vegetative tissue or seeds in regenerated plants, with the exception of one lineage. This particular lineage showed very significant increases in putrescine preferentially in seeds (up to 10 times compared to wild type and controls transformed with the hpt selectable marker alone). We have demonstrated that in cereals such as rice, over-expression of the oat adc cDNA results in increased accumulation of polyamines at different stages of development. We have also demonstrated that strong constitutive promoters, such as the maize ubiquitin 1 promoter, are sufficient to facilitate heritable high-level polyamine accumulation in seed. Our results demonstrate that by screening adequate numbers of independently derived transgenic plants, it is possible to identify those individuals which express a desired phenotype or genotype.

The genes AV1, AV10, and Z1 encode proteins that accumulate during oat seed development. In developing endosperm of Avena sativa (cultivated oat), AV1, AV10 and Z1 mRNAs reach maximal levels midway through seed development but fall to very low levels in mature seeds. Similarly, mRNAs for these proteins peak during endosperm development of Avena fatua (wild oat) and are later degraded. However, during late maturation of A. fatua seeds, populations of mRNA fragments shorter than the intact transcripts accumulate as the full-length transcripts decline in abundance. The smaller RNA molecules, which are apparently long-lived decay intermediates, are derived randomly from the entire transcripts and are most likely not generated by cleavage at precisely defined sites. Other A. fatua endosperm mRNAs that are degraded during late seed development, such as those for ADP glucose pyrophosphorylase and starch synthase, do not produce detectable decay intermediates. Decay intermediates of AV1 and Z1 mRNAs persist at high levels during late seed development of two other undomesticated oat species, Avena strigosa and Avena barbata. The persistence of decay intermediates for these endosperm mRNAs in wild grass species may represent a model system for studying RNA decay process in plant tissues.

To elucidate the mechanisms by which alpha-amylase genes are expressed in wild oat aleurone, two genes, alpha-Amy2/A and alpha-Amy2/D, were isolated. Both were shown to be positively regulated by gibberellin (GA) during germination and both contain the conserved cis-acting elements Box 2, GA-response element (TAACAGA) and TATCSATSS (where S is C or G). In addition, they possess a conserved initiator element (CATCA) that is present in both alpha-Amy2 and alpha-Amy1 genes, and also in a number of other plant TATA-containing and TATA-less promoters. DNase 1 footprint analysis showed the alpha-Amy2/A promoter to be a complex array of binding sites for a number of different classes of DNA-binding proteins. Our data suggest that the area around the initiator element (Inr) is bound by a large complex of general transcription factors, that the TATA box is bound by the TFIID complex, that Box 2 is bound by one or more WRKY proteins and that the GA-response element is bound by one or more MYBs. Two other elements containing the core sequence CCATGG/C are bound by nuclear protein and this sequence is the core of the Sph element. The regulation of alpha-Amy2 genes by GA therefore involves an interplay of at least three different types of transcription factor.

An irregular pattern of transgene silencing was revealed in expression and inheritance studies conducted over multiple generations following transgene introduction by microprojectile bombardment of allohexaploid cultivated oat (Avena sativa L.). Expression of two transgenes, bar and uidA, delivered on the same plasmid was investigated in 23 transgenic oat lines. Twenty-one transgenic lines, each derived from an independently selected transformed tissue culture, showed expression of both bar and uidA while two lines expressed only bar. The relationship of the transgenic phenotypes to the presence of the transgenes in the study was determined using (1) phenotypic scoring combined with Southern blot analyses of progeny, (2) coexpression of the two transgenic phenotypes since the two transgenes always cosegregated, and (3) reactivation of a transgenic phenotype in self-pollinated progenies of transgenic plants that did not exhibit a transgenic phenotype. Transgene silencing was observed in 19 of the 23 transgenic lines and resulted in distorted segregation of transgenic phenotypes in 10 lines. Silencing and inheritance distortions were irregular and unpredictable. They were often reversible in a subsequent generation of self-pollinated progeny and abnormally segregating progenies were as likely to trace back to parents that exhibited normal segregation in a previous generation as to parents showing segregation distortions. Possible causes of the irregular patterns of transgene silencing are discussed.

Regions of the sugarcane bacilliform badnavirus genome were tested for promoter activity. The genomic region spanning nucleotides 5999-7420 was shown to possess promoter activity as exemplified by its ability to drive the expression of the coding region of the uidA gene of Escherichia coli, in both Avena sativa and Arabidopsis thaliana. In A. sativa, the promoter was active in all organs examined and, with the exception of the anthers where the expression was localized, this activity was constitutive. In A. thaliana, the promoter activity was constitutive in the rosette leaf, stem, stamen, and root and limited primarily to vascular tissue in the sepal and the silique. The transgene was inherited and active in progeny plants of both A. sativa and A. thaliana.

Steryl glucosides are characteristic lipids of plant membranes. The biosynthesis of these lipids is catalyzed by the membrane-bound UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). The purified enzyme (Warnecke and Heinz, Plant Physiol 105 (1994): 1067-1073) has been used for the cloning of a corresponding cDNA from oat (Avena sativa L.). Amino acid sequences derived from the amino terminus of the purified protein and from peptides of a trypsin digestion were used to construct oligonucleotide primers for polymerase chain reaction experiments. Screening of oat and Arabidopsis cDNA libraries with amplified labeled DNA fragments resulted in the isolation of sterol glucosyltransferase-specific cDNAs with insert lengths of ca. 2.3 kb for both plants. These cDNAs encode polypeptides of 608 (oat) and 637 (Arabidopsis) amino acid residues with molecular masses of 66 kDa and 69 kDa, respectively. The first amino acid of the purified oat protein corresponds to the amino acid 133 of the deduced polypeptide. The absence of these N-terminal amino acids reduces the molecular mass to 52 kDa, which is similar to the apparent molecular mass of 56 kDa determined for the purified protein. Different fragments of these cDNAs were expressed in Escherichia coli. Enzyme assays with homogenates of the transformed cells exhibited sterol glucosyltransferase activity.

Comparative genetic studies have demonstrated that gene content and orders are highly conserved, both at the map and megabase level, between different species within the grass family. Integration of the genetic maps of rice, foxtail millet, sugar cane, sorghum, maize, the Triticeae cereals and oats into a single synthesis reveals that some chromosome arrangements characterise taxonomic groups, while others have arisen during or after speciation. A detailed analysis of the comparative maps of seven species, belonging to three subfamilies, and their applications are described below.

To analyze the patterns of gene expression associated with seed dormancy in wild oat (Avena fatua), we have isolated cDNA clones corresponding to genes that are differentially expressed in dormant and afterripened line M73 embryos. Gene transcripts of these clones were maintained in embryos of imbibed dormant caryopses, but declined rapidly in afterripened embryos after imbibition. GA3 treatment of dormant caryopses, which breaks dormancy, could lower the transcript levels in dormant embryos. When the germination of afterripened caryopses was inhibited by high temperature (35 degrees C), the decline in abundance of the transcripts in afterripened embryos was arrested. These genes were expressed to various degrees in water-stressed, but not in unstressed, 7-day-old seedlings. The expression of the genes was also ABA-inducible in afterripened embryos. The expression patterns in non-dormant line SH430 wild oat were similar to those of afterripened M73. DNA sequence analyses indicated that some of the cDNA clones encode LEA (late embryogenesis-abundant) proteins and aldose reductase. The significance of the expression of these genes in maintaining seed dormancy or longevity is discussed.

The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Gene-preferential oligonucleotide probes were used to determined the relative abundance and half-lives of distinct oat phytochrome A (PHYA) mRNAs. Oat PHYA mRNAs are highly conserved in the 5'-untranslated region and the coding region, but the 3'-untranslated region has an overall lower sequence conservation and was the source of gene-preferential probes. PHYA3 mRNA was estimated to be ca. 61% of the oat PHYA mRNA pool present in poly(A)+ RNA from dark-grown seedlings. The half-lives for PHYA3 and PHYA4 mRNAs were both estimated to be ca. 30 min, and a similar short half-life was estimated for the average PHYA mRNA. Sequence comparisons of PHYA mRNAs from four grass species identified conserved sequences within the 5'- and 3'-untranslated regions that might be important for PHYA mRNA degradation.

cDNA fragments from ten different protein kinases expressed in Avena sativa aleurone cells were amplified from mRNA by RT-PCR with degenerate primers. These could be classified into five groups: Aspk1-3 showed homology to the Snf1-related protein kinases, Aspk4-5 to a wheat ABA up-regulated protein kinase, Aspk6-8 to the Ca-dependent, calmodulin-independent protein kinase family, Aspk9 encoded a MAP kinase and Aspk10 was closely related to a novel Arabidopsis ribosomal protein kinase. GA caused a rapid increase in transcripts hybridising to Aspk10, while inhibiting the dramatic accumulation of transcripts hybridising to Aspk9 that occurred in the absence of GA.

A protein consisting of 60 kDa subunits (As-P60) was isolated from etiolated oat seedlings (Avena sativa L.) and characterized as avenacosidase, a beta-glucosidase that belongs to a preformed defence system of oat against fungal infection. The enzyme is highly aggregated; it consists of 300-350 kDa aggregates and multimers thereof. Dissociation by freezing/thawing leads to complete loss of enzyme activity. The specificity of the enzyme was investigated with para-nitrophenyl derivatives which serve as substrates, in decreasing order beta-fucoside, beta-glucoside, beta-galactoside, beta-xyloside. The corresponding orthonitrophenyl glycosides are less well accepted. No hydrolysis was found with alpha-glycosides and beta-thioglucoside. An anti-As-P60 antiserum was prepared and used for isolation of a cDNA clone coding for As-P60. A presequence of 55 amino acid residues was deduced from comparison of the cDNA sequence with the N-terminal sequence determined by Edman degradation of the mature protein. The presequence has the characteristics of a stroma-directing signal peptide; localization of As-P60 in plastids of oat seedlings was confirmed by western blotting. The amino acid sequence revealed significant homology (> 39% sequence identity) to beta-glucosidases that are constituents of a defence mechanism in dicotyledonous plants. 34% sequence identity was even found with mammalian and bacterial beta-glucosidases of the BGA family. Avenacosidase extends the occurrence of this family of beta-glucosidases to monocotyledonous plants.

We studied the expression of the oat globulin gene asglo5 in developing transgenic tobacco seeds. The asglo5 gene promoter directed transcription in the endosperm as well as in the provascular tissue, the presumptive root tip and the shoot apical meristem of the embryo as revealed by GUS reporter gene constructs and in situ hybridization. However, immunological tissue printing detected the oat protein exclusively in the tobacco endosperm, suggesting that extensive post-transcriptional regulatory processes influence the expression of the monocot transgene in the dicot host.