Search

Introduction: Ataxia-Telangiectasia (A-T) is an autosomal recessive multisystem disease affecting the brain, immune system, lungs, liver and also characterised by an enhanced risk of lymphoid and other tumours. At present there is no cure for A-T with management relying on supportive care using symptom-specific medications. Identification of the gene defective in this syndrome, ATM, and further characterization of the disorder together with greater insight into the function of the ATM protein has provided greater opportunity for the development of potential therapies. Areas covered: Here we review conventional as well as more recently developed approaches to manage the symptoms of patients with A-T. In addition we explore ongoing and potential strategies for therapy involving gene correction, stem cells and use of antioxidants and anti-inflammatory agents. Expert opinion: Prevention or arrest of the progressive neurodegeneration, the most debilitating feature of A-T, represents a major goal in the development of a cure for this disorder. However, since lung disease and increased risk of cancer are responsible for the majority of mortality in A-T, a greater understanding of these pathologies together with more effective approaches to treatment is required in the overall management of patients.

Cancer incidence in schizophrenia is not increased commensurate with higher rates of risk exposures. Here we report an investigation of the DNA damage response, an anti-tumorigenic defence, in immortalised lymphoblasts from patients with schizophrenia.Unirradiated and irradiated (5Gy) lymphoblasts from schizophrenia patients (n = 28) and healthy controls (n = 28) were immunostained for the phosphorylated histone variant H2AX (γH2AX), an index of DNA double-strand breaks. Flow cytometry was used to assess cell cycle distribution and γH2AX immunofluorescence. Rate of DNA repair was quantified by determining the temporal change in γH2AX values following irradiation.In unirradiated lymphoblasts, γH2AX levels were significantly increased in the schizophrenia group compared with controls (effect size = 0.86). This increase was most evident in patients with cognitive deficits. In irradiated lymphoblasts, peak radiation-induced γH2AX levels were significantly reduced in patients. No differences between patients and controls were found in the rate of DNA repair or in cell cycle distribution.The significant differences in DNA damage response signalling observed involve modification of histone variant H2AX and thereby implicate regulatory processes determining chromatin structure in dividing lymphoblasts from patients with schizophrenia. The role that aberrant DNA damage response signalling plays in protecting patients from cancer is unclear.

To provide an update on the product of the ATM gene mutated in the human genetic disorder ataxia-telangiectasia (A-T).The product of the ATM gene mutated in the human genetic disorder A-T is a 350 kDa protein that plays a central role in the regulation of a number of cellular processes. It is a member of the phosphatidylinositol 3-kinase superfamily, but is more likely a protein kinase similar to another member of that family, i.e. DNA-dependent protein kinase (DNA-PK). A-T cells and fibroblasts derived from the atm -/- mouse are hypersensitive to ionizing radiation and defective in cell cycle checkpoint control. At present the nature of the lesion in damaged DNA recognized by ATM remains uncertain, but it is evident that a small number of residual strand breaks remain unrepaired in A-T cells, which may well account for the radiosensitivity. On the other hand, considerable progress has been achieved in delineating the role of ATM in cell cycle checkpoint control. Defects are observed at all cell cycle checkpoints in A-T cells post-irradiation. At the G1 /S interface ATM has been shown to play a central role in radiation-induced activation of the tumour suppressor gene product p53. ATM binds to p53 in a complex fashion and activates the molecule in response to breaks in DNA by phosphorylating it at serine 15 close to the N-terminus and by controlling other phosphorylation and dephosphorylation changes on the molecule. This in turn leads to the induction of p21/WAF1 and other p53 effector proteins before inhibition of cyclin-dependent kinase activity and G1 arrest. Emerging evidence supports a direct role for ATM at other cell cycle checkpoints. Other proteins interacting with ATM include c-Abl a protein tyrosine kinase, beta-adaptin an endosomal protein and p21 a downstream effector of p53. The significance of these interactions is currently being investigated. ATM also plays an important role in the regulation and surveillance of meiotic progression. The localization of ATM to both the nucleus and other subcellular organelles implicates this molecule in a myriad of cellular processes.ATM is involved in DNA damage recognition and cell cycle control in response to ionizing radiation damage. There is evidence that ATM may also have a more general signalling role.

We used differential display, a method designed to amplify partial cDNA sequences from subsets of mRNAs, to identify mRNAs induced by ionizing radiation in human Epstein Barr Virus (EBV)-transformed lymphoblastoid cells. Increased expression of a cDNA corresponding to the inositol 1,4,5 trisphosphate receptor (InsP3R) type 1 was observed after exposure of cells to 3Gy gamma-rays. This was confirmed by Northern blot analysis. The increase in mRNA for InsP3R type 1 was accompanied by a corresponding increase in the level of InsP3R type 1 protein as determined by Western blotting. Exposure of cells from patients with the human genetic disorder ataxia-telangiectasia (A-T), characterized by hypersensitivity to ionizing radiation, failed to change the levels of InsP3R type 1 mRNA and, as expected, there was no increase in InsP3R type 1 protein in A-T cells in response to radiation exposure. Protein levels for two other InsP3Rs, types 2 and 3, were observed to increase in control and A-T cells after exposure to ionizing radiation. The induction of the InsP3R type 1, which is primarily located in the endoplasmic reticulum, may play an important role in radiation signal transduction.

The molecular basis of radiosensitivity was studied using a cDNA complementation approach to correct radiosensitivity in cells. Four cDNAs of sizes 1.6, 2.0, 2.2 and 2.5 kb were isolated that corrected several aspects of the phenotype of cells from patients with the human genetic disorder ataxia-telangiectasia, characterized by hypersensitivity to ionizing radiation. The criteria used to assess correction included cell viability, induced chromosome aberrations, G2 phase delay and induction of p53 after exposure to radiation. One cDNA (2.5 kb) was identified as the complete sequence of the RNA helicase p68, which was capable of correcting radiosensitivity based on two of the above four criteria, with p53 induction post irradiation being partially corrected. The 2.2 kb cDNA was shown to correspond to the complete sequence of arginyl tRNA synthetase and the other two cDNAs were identical to the 3' untranslated regions (UTR) of the transcription factor TFIIS (1.6 kb) and phospholipase A2 (2.0 kb) respectively. Additional transfections with the 3'UTR (198 nucleotides) of p68 RNA helicase and its inverse sequence revealed that the 3'UTR had the same complementation capacity as the full-length cDNA, whereas the inverse construct failed to complement radiosensitivity. These data provide additional support for a novel role for 3'UTRs in the regulation of gene expression.

A number of anomalies have been described in the progression of ataxia-telangiectasia (AT) cells through the cell cycle post-irradiation. Some uncertainty still exists as to whether AT cells show increased or reduced division delay after exposure to ionizing radiation. We have attempted to resolve the apparent inconsistencies that exist by investigating the effects of radiation on AT cells at various stages of the cell cycle. Specific labelling of S phase cells with 5-bromodeoxyuridine (BrdU) followed by irradiation caused a prolonged accumulation of these cells in G2/M phase with only 2-7% of AT cells progressing through to G1 24h post-irradiation. In contrast, 23-28% of control cells irradiated in S phase reached G1 by 24 h after irradiation. As observed previously with AT fibroblasts, AT lymphoblastoid cells irradiated in G1 phase did not experience a delay in entering S phase. After progressing through S phase these cells also were delayed in G2/M, but not to the same extent as irradiated S phase cells. On the other hand, when AT cells were irradiated in G2 phase they showed less delay initially in entry to mitosis and the subsequent G1 phase than did irradiated control cells. The overall results demonstrate that AT cells fail to show an initial delay in transitions between the G1/S and G2/M phases of the cell cycle and in progression through these phases post-irradiation, but in the long-term, after passage through S phase, they experience a prolonged delay in G2/M. Since several AT complementation groups are represented in this study, the cell cycle anomalies appear to be universal in AT. These results implicate deficiencies in control of cell cycle progression in the increased radiosensitivity and cancer predisposition in AT.

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

1. The effects of N-hydroxyphenacetin on DNA function and structure were investigated to elucidate the involvement of phenacetin in analgesic nephropathy and transitional cell carcinoma. 2. N-Hydroxyphenacetin or a metabolite inhibited synthesis of DNA, RNA and protein; DNA inhibition was greater at higher pH. 3. No single-strand breaks were detectable in DNA after N-hydroxyphenacetin treatment and no appreciable effect on cell viability was observed at concentrations up to 5mM. 4. N-Hydroxyphenacetin-induced alteration to chromatin structure was detected using nucleoid sedimentation analysis. Direct binding to plasmid DNA was not observed. 5. These observations are consistent with a role for phenacetin metabolites in renal disease.

Exposure of normal control and ataxia-telangiectasia (A-T) lymphoblastoid cell lines to ionizing radiation gives rise to an increase in the proportion of G2 phase cells. The size and extent of the G2 phase block is greater in A-T cells than in normal cells. Caffeine has a similar overall effect in control and A-T cell lines in reducing the G2 arrest observed after ionizing radiation. While the proportion of cells accumulated in G2 in A-T cells is considerably greater than in controls, addition of caffeine at the time of maximal G2 block brings about a return of G2 phase cell numbers to unirradiated values in 3 hours in both cell types. In normal control cells the caffeine-mediated decrease in G2 cells is reflected by an increase in mitotic cells. These mitotic cells have a higher frequency of chromosome aberrations compared to cells harvested in the absence of caffeine. Similarly in A-T cells addition of caffeine to irradiated cultures, delayed in G2 phase, increased the number of mitotic cells and the frequency of chromosome aberrations.