Search

Northwest Xizang White Cashmere Goat (NXWCG) is the first new breed of cashmere goat in the Xizang Autonomous Region. It has significant characteristics of extremely high fineness, gloss, and softness. Genome-wide association analysis is an effective biological method used to measure the consistency and correlation of genotype changes between two molecular markers in the genome. In addition, it can screen out the key genes affecting the complex traits of biological individuals. The aim of this study was to analyze the genetic mechanism of cashmere trait variation in NXWCG and to discover SNP locus and key genes closely related to traits such as superfine cashmere. Additionally, the key genes near the obtained significant SNPs were analyzed by gene function annotation and biological function mining. In this study, the phenotype data of the four traits (cashmere length, fiber length, cashmere diameter, and cashmere production) were collected. GGP_Goat_70K SNP chip was used for genotyping the ear tissue DNA of the experimental group. Subsequently, the association of phenotype data and genotype data was performed using Gemma-0.98.1 software. A linear mixed model was used for the association study. The results showed that four fleece traits were associated with 18 significant SNPs at the genome level and 232 SNPs at the chromosome level, through gene annotated from Capra hircus genome using assembly ARS1. A total of 107 candidate genes related to fleece traits were obtained. Combined with Gene Ontology and Kyoto Encyclopedia of Genes and Genomes enrichment analysis, we can find that CLNS1A, CCSER1, RPS6KC1, PRLR, KCNRG, KCNK9, and CLYBL can be used as important candidate genes for fleece traits of NXWCG. We used Sanger sequencing and suitability chi-square test to further verify the significant loci and candidate genes screened by GWAS, and the results show that the base mutations loci on the five candidate genes, CCSER1 (snp12579, 34,449,796, A → G), RPS6KC1 (snp41503, 69,173,527, A → G), KCNRG (snp41082, 67,134,820, G → A), KCNK9 (14:78472665, 78,472,665, G → A), and CLYBL (12: 9705753, 9,705,753, C → T), significantly affect the fleece traits of NXWCG. The results provide a valuable basis for future research and contribute to a better understanding of the genetic structure variation of the goat. [ABSTRACT FROM AUTHOR]

Introduction: Mucopolysaccharidoses are a group of lysosomal storage disorders that include seven types that are classified based on the enzymes that are disrupted. Malfunction of these enzymes leads to the accumulation of glycosaminoglycans (GAGs) in various tissues. Due to genetic and clinical heterogeneity, diagnosing and distinguishing the different types is challenging. Genetic methods such as whole exome sequencing (WES) and Sanger sequencing are accurate methods for detecting pathogenic variants in patients. Methods: Thirty-two cases of mucopolysaccharidosis, predominantly from families with consanguineous marriages, were genetically examined. Out of these, fourteen cases underwent targeted sequencing, while the rest underwent WES. The results of WES were analyzed and the pathogenicity of the variants was examined using bioinformatics tools. In addition, a segregation analysis within families was carried out. Results: In most cases, a pathogenic or likely pathogenic variant was detected. Sixteen previously reported variants and six new variants were detected in the known IDS (c.458G>C, c.701del, c.920T>G), GNS (c.1430A>T), GALNS (c.1218_ 1221dup), and SGSH (c.149T>C) genes. Furthermore, we discovered a c.259G>C substitution in the NAGLU gene for the first time in three homozygous patients. This substitution was previously reported as heterozygous. Except for the variants related to the IDS gene, which were hemizygous, all the other variants were homozygous. Discussion: It appears that the high rate of consanguineous marriages in the families being studied has had a significant impact on the occurrence of this disease. Overall, these findings could expand the spectrum of pathogenic variants in mucopolysaccharidoses. Genetic methods, especially WES, are very accurate and can be used alone or in conjunction with other diagnostic methods for a more precise and rapid diagnosis of mucopolysaccharidoses. Additionally, they could be beneficial for family screening and disease prevention. [ABSTRACT FROM AUTHOR]

Introduction: In preceding work, a deleterious REEP4 variant [GRCh38/hg38, NC_000008.11:g.22140245G>A, NM_025232.4:c.109C>T, p.Arg37Trp] was found to co-segregate with blepharospasm (BSP) in a large African-American pedigree. Other REEP4 variants have been reported in genetic screening studies of dystonia. The REEP4 paralogs, REEP1 and REEP2, are associated with spastic paraplegia. The causal contributions of REEP4 variants to dystonia and other neurological disorders remains indecisive. Methods: Sanger sequencing was used to screen subjects (N = 307) with BSP and BSP-plus dystonia affecting additional anatomical segments (BSP+) phenotypes for variants in REEP4. In silico tools were used to examine the deleteriousness of reported (ClinVar) and previously published REEP4 variants. Results: No highly deleterious variant was identified in coding or contiguous splice site regions of REEP4 in our cohort of 307 subjects. In silico analysis identified numerous deleterious REEP4 variants in published screening studies of dystonia and several highly deleterious single nucleotide REEP4 variants in ClinVar. Conclusion: Highly deleterious REEP4 variants are rare in BSP and BSP+ phenotypes. [ABSTRACT FROM AUTHOR]

Background and aims: Defective enzymes, cofactors, or transporters of metabolic pathways cause inherited metabolic disorders (IMDs), a group of genetic disorders. Several IMDs have serious consequences for the affected neonates. Newborn screening for IMDs is conducted by measuring specific metabolites between 3 and 7 days of life. Herein, we analyzed the incidence, spectrum, and genetic characteristics of IMDs in newborns in the Zhuzhou area. Methods: Tandem mass spectrometry was conducted on 90,829 newborns who were admitted to the Women and Children Healthcare Hospital of Zhuzhou and requested for screening for IMDs. These newborns were subsequently subjected to next-generation sequencing and further validated using Sanger sequencing. Results: 30 IMDs cases were found in 90,829 cases of newborns screened for IMDs, and the overall incidence was 1/3,027. The incidence of amino acid, organic acid, fatty acid oxidation and urea cycle disorders were 1/8,257, 1/18,165, 1/7,569, and 1/45,414, respectively. Additionally, 9 cases of maternal IMDs were found in our study, and unreported gene mutations of 3 cases IMDs were identified. Conclusion: Our data indicated that IMDs are never uncommon in zhuzhou, meanwhile, we also found that primary carnitine deficiency was the only disorder of fatty acid oxidation in Zhuzhou, and the incidence (1/7,569) was higher than the national level, organic acid metabolic diseases are mostly inherited. Therefore, our study has clarified the disease spectrum and genetic backgrounds, contributing to the treatment and prenatal genetic counseling of these disorders in this region. [ABSTRACT FROM AUTHOR]

Fusarium solani, as an opportunistic pathogen, can infect individuals with immunosuppression, neutropenia, hematopoietic stem cell transplantation (HSCT), or other high-risk factors, leading to invasive or localized infections. Particularly in patients following allogeneic HSCT, Fusarium solani is more likely to cause invasive or disseminated infections. This study focuses on a pediatric patient who underwent HSCT for severe aplastic anemia. Although initial blood cultures were negative, an abnormality was detected in the 1,3-β-D-glucan test (G test) post-transplantation. To determine the causative agent, blood samples were subjected to metagenomic next-generation sequencing (mNGS) and blood cultures simultaneously. Surprisingly, the results of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and mNGS differed slightly, with mNGS identifying Nectria haematonectria, while MALDI-TOF MS based on culture showed Fusarium solani. To clarify the results, Sanger sequencing was performed for further detection, and the results were consistent with those of MALDI-TOF MS. Since the accuracy of Sanger sequencing is higher than that of mNGS, the diagnosis was revised to invasive Fusarium solani infection. With advancements in technology, various detection methods for invasive fungi have been developed in recent years, such as mNGS, which has high sensitivity. While traditional methods may be time-consuming, they are important due to their high specificity. Therefore, in clinical practice, it is essential to utilize both traditional and novel detection methods in a complementary manner to enhance the diagnosis of invasive fungal infections.

Background: Mutations in the MYO6 gene have been associated with both autosomal dominant non-syndromic hearing loss (ADNSHL) and autosomal recessive non-syndromic hearing loss (ARNSHL), with a cumulative identification of 125 pathogenic variants. To investigate the underlying genetic factor within a Chinese family affected with heriditary hearing loss, prompted the utilization of high-throughput sequencing. Method: A detailed clinical investigation was performed. Genetic testing was performed by using target panel sequencing, and Sanger sequencing. Targeted sequencing identified the variants and Sanger sequencing was employed to validate segregation of the identified variants within family. Additionally, bioinformatics analysis was performed to strengthen our findings. Results: Clinical investigation revealed the family members were affected by progressive and sensorineural hearing loss with an onset around 8-10 years old. Furthermore, genetic testing identified novel MYO6 variants, c.[2377T>G; 2382G>T] p.[Trp793Gly; Lys794Asn], positioned in a cis pattern, as plausible pathogenic contributors to early-onset hearing loss characterized by a severe and progressive course. Moreover, bioinformatics analysis showd disruptin in hydrogen bonding of mutant amino acids with interactive amino acids. Conclusion: Our research uncovered a relationship between mutations in the MYO6 gene and non-syndromic hearing loss. We identified two variants, c.[2377T>G; 2382G>T] p.[Trp793Gly; Lys794Asn] in MYO6 as strong candidates responsible for the observed progressive hereditary hearing loss. This study not only adds to our knowledge about hearing problems related to MYO6 but also reveals the presence of monogenic compound heterozygosity. Our study will provide a new sight for genetic diagnosis in such patients and their management for future use. [ABSTRACT FROM AUTHOR]

Introduction: Mucopolysaccharidoses are a group of lysosomal storage disorders that include seven types that are classified based on the enzymes that are disrupted. Malfunction of these enzymes leads to the accumulation of glycosaminoglycans (GAGs) in various tissues. Due to genetic and clinical heterogeneity, diagnosing and distinguishing the different types is challenging. Genetic methods such as whole exome sequencing (WES) and Sanger sequencing are accurate methods for detecting pathogenic variants in patients. Methods: Thirty-two cases of mucopolysaccharidosis, predominantly from families with consanguineous marriages, were genetically examined. Out of these, fourteen cases underwent targeted sequencing, while the rest underwent WES. The results of WES were analyzed and the pathogenicity of the variants was examined using bioinformatics tools. In addition, a segregation analysis within families was carried out.Results: In most cases, a pathogenic or likely pathogenic variant was detected. Sixteen previously reported variants and six new variants were detected in the known IDS (c.458G>C, c.701del, c.920T>G), GNS (c.1430A>T), GALNS (c.1218_1221dup), and SGSH (c.149T>C) genes. Furthermore, we discovered a c.259G>C substitution in the NAGLU gene for the first time in three homozygous patients. This substitution was previously reported as heterozygous. Except for the variants related to the IDS gene, which were hemizygous, all the other variants were homozygous.Discussion: It appears that the high rate of consanguineous marriages in the families being studied has had a significant impact on the occurrence of this disease. Overall, these findings could expand the spectrum of pathogenic variants in mucopolysaccharidoses. Genetic methods, especially WES, are very accurate and can be used alone or in conjunction with other diagnostic methods for a more precise and rapid diagnosis of mucopolysaccharidoses. Additionally, they could be beneficial for family screening and disease prevention.

Introduction: In preceding work, a deleterious REEP4 variant [GRCh38/hg38, NC_000008.11:g.22140245G>A, NM_025232.4:c.109C>T, p.Arg37Trp] was found to co-segregate with blepharospasm (BSP) in a large African-American pedigree. Other REEP4 variants have been reported in genetic screening studies of dystonia. The REEP4 paralogs, REEP1 and REEP2, are associated with spastic paraplegia. The causal contributions of REEP4 variants to dystonia and other neurological disorders remains indecisive.Methods: Sanger sequencing was used to screen subjects (N = 307) with BSP and BSP-plus dystonia affecting additional anatomical segments (BSP+) phenotypes for variants in REEP4. In silico tools were used to examine the deleteriousness of reported (ClinVar) and previously published REEP4 variants.Results: No highly deleterious variant was identified in coding or contiguous splice site regions of REEP4 in our cohort of 307 subjects. In silico analysis identified numerous deleterious REEP4 variants in published screening studies of dystonia and several highly deleterious single nucleotide REEP4 variants in ClinVar.Conclusion: Highly deleterious REEP4 variants are rare in BSP and BSP+ phenotypes.

Introduction: Intramuscular myxomas are benign tumors that are challenging to diagnose, especially on core needle biopsies. Acquired chromosomal aberrations and pathogenic variants in codon 201 or codon 227 in GNAS complex locus gene (GNAS) have been reported in these tumors. Here we present our genetic findings in a series of 22 intramuscular myxomas.Materials and methods: The tumors were investigated for the presence of acquired chromosomal aberrations using G-banding and karyotyping. Pathogenic variants in codon 201 or codon 227 of GNAS were assessed using direct cycle Sanger sequencing and Ion AmpliSeq Cancer Hotspot Panel v2 methodologies.Results: Eleven tumors carried chromosomal abnormalities. Six tumors had numerical, four had structural, and one had both numerical and structural chromosomal aberrations. Gains of chromosomes 7 and 8 were the most common abnormalities being found in five and four tumors respectively. Pathogenic variants in GNAS were detected in 19 myxomas (86%) with both methodologies. The detected pathogenic variants were p.R201H in nine cases (seven with abnormal and two with normal karyotypes), p.R201C in five cases, all with normal karyotypes, p.R201S in three cases (two with abnormal and one with normal karyotype), p.R201G in one case with a normal karyotype, and p.Q227E in one case with a normal karyotype.Conclusion: Firstly, our data indicate a possible association between chromosomal abnormalities and GNAS pathogenic variants in intramuscular myxomas. Secondly, the presence of the rare pathogenic variants R201S, p.R201G and p.Q227E in 26% (5 out of 19) of myxomas with GNAS pathogenic variants shows that methodologies designed to detect only the common “hotspot” of p.R201C and p.R201H will give false negative results. Finally, a comparison between Ion AmpliSeq Cancer Hotspot Panel v2 and direct cycle Sanger sequencing showed that direct cycle Sanger sequencing provides a quick, reliable, and relatively cheap method to detect GNAS pathogenic variants, matching even the most cutting-edge sequencing methods.

Objective: This aim of this study was to investigate the prognostic significance of KIT exon 11 mutation subtypes in patients with GISTs. Methods: A total of 233 consecutive patients diagnosed with GISTs at the First Affiliated Hospital of Zhengzhou University from January 2013 to August 2018 were included in this study. The prevalence and mutation landscape of exon 11 in KIT was presented. The clinicopathological characteristics and prognosis among the different mutation subtypes were analyzed. All the statistical analyses were performed by SPSS22.0. Results: Somatic mutational analysis indicated that point mutations were the most frequently detected mutations followed by deletions & compound mutations and insertion and tandem duplication mutations in the stomach. Point mutations showed a low mitotic count and a high risk of recurrence, and deletions and compound mutations have a high mitotic count while insertions and tandem duplication mutations showed a low mitotic count with an intermediate recurrence risk. Point mutations and deletions frequently occurred in sequence region codons 550-560 of exon 11, while compound mutations, insertion, and tandem duplication were mainly detected in codons 557-559, 572-580, and 577-581, respectively. The multi-variation analysis demonstrated that tumor diameter and high recurrence risk groups had worse prognostic values. However, mutation types were not significant predictors of relapse-free survival (RFS) in GISTs. Survival analysis suggested no significant difference in RFS between the 557/558 deletion and the other deletions. Conclusion: This study suggested that mutations in exon 11 of the KIT gene were common with intermediate/high recurrence risk in GISTs patients. Tumor diameter ≥5 cm, and deletions mutations might predict a worse prognosis. [ABSTRACT FROM AUTHOR]

Background: we evaluated the concordance between immunohistochemical p53 staining and TP53 mutations in a series of HGSOC. Moreover, we searched for prognostic differences between p53 overexpression and null expression groups. Methods: patients affected by HGSOC were included. For each case p53 immunohistochemical staining and molecular assay (Sanger sequencing) were performed. Kaplan-Meier survival analyses were undertaken to determine whether the type of TP53 mutation, or p53 staining pattern influenced overall survival (OS) and progression free survival (PFS). Results: 34 HGSOC were considered. All cases with a null immunohistochemical p53 expression (n=16) showed TP53 mutations (n=9 nonsense, n=4 in-frame deletion, n=2 splice, n=1 in-frame insertion). 16 out of 18 cases with p53 overexpression showed TP53 missense mutation. Follow up data were available for 33 out of 34 cases (median follow up time 15 month). We observed a significant reduction of OS in p53 null group [HR = 3.64, 95% CI 1.01-13.16]. Conclusion: immunohistochemical assay is a reliable surrogate for TP53 mutations in most cases. Despite the small cohort and the limited median follow up, we can infer that HGSOC harboring p53 null mutations are a more aggressive subgroup. [ABSTRACT FROM AUTHOR]

Central nervous system (CNS) tumors in children comprise a highly heterogenous and complex group of diseases. Historically, diagnosis and confirmation of these tumors were routinely based on histological examination. However, recently obtained data demonstrate that such a diagnostic approach is not completely accurate and could lead to misdiagnosis. Also, in recent times, the quantity and quality of molecular diagnostic methods have greatly improved, which influences the current classification methods and treatment approach for pediatric CNS tumors. Nowadays, molecular methods, such as DNA methylation profiling, are an integral part of diagnosing brain and spinal tumors in children. In this paper, we present the case of an infant with a posterior fossa tumor who demonstrated a non-specific morphology and whose diagnosis was verified only after DNA methylation.

Backgroundwe evaluated the concordance between immunohistochemical p53 staining and TP53 mutations in a series of HGSOC. Moreover, we searched for prognostic differences between p53 overexpression and null expression groups.Methodspatients affected by HGSOC were included. For each case p53 immunohistochemical staining and molecular assay (Sanger sequencing) were performed. Kaplan-Meier survival analyses were undertaken to determine whether the type of TP53 mutation, or p53 staining pattern influenced overall survival (OS) and progression free survival (PFS).Results34 HGSOC were considered. All cases with a null immunohistochemical p53 expression (n=16) showed TP53 mutations (n=9 nonsense, n=4 in-frame deletion, n=2 splice, n=1 in-frame insertion). 16 out of 18 cases with p53 overexpression showed TP53 missense mutation. Follow up data were available for 33 out of 34 cases (median follow up time 15 month). We observed a significant reduction of OS in p53 null group [HR = 3.64, 95% CI 1.01-13.16].Conclusionimmunohistochemical assay is a reliable surrogate for TP53 mutations in most cases. Despite the small cohort and the limited median follow up, we can infer that HGSOC harboring p53 null mutations are a more aggressive subgroup.

Background: In doping control, the presence of the exon5 c.577del variant in the human erythropoietin gene may be a confounding factor in the interpretation of the results from the analytical method currently in force for the detection of human recombinant erythropoietin, based on immunoelectrophoresis on SDSPAGE and/or SAR-PAGE. This variant, determining the transcription of a higher molecular weight protein, can erroneously suggest the presence of recombinant erythropoietin in a biological sample, causing the possibility of a false positive result. Although the variant was now identified only in East Asian populations and with a very low frequency, it can threaten the reliability of current anti-doping tests. Methods: We have implemented a genetic test to identify the presence of this variant in the biological samples that are presently collected for anti-doping analysis (whole blood, urine, and dried blood spots). The test is based on the Sanger sequencing of the human erythropoietin gene exon 5, where the c.577del variant falls. Results and Discussion: The method has a specificity of 100% and allows identification of the possible presence of the variant starting from 100 pg of genomic DNA extracted from each biological sample. The efficacy of the test has been confirmed by the analysis of real samples from subjects showing and not showing the exon c.577del variant. [ABSTRACT FROM AUTHOR]

BackgroundMucolipidosis type II (MLII), or I-cell disease, is a rare lysosomal storage disease (LSD) caused by variants in the GNPTAB gene. MLII patients exhibit clinical phenotypes in the prenatal or neonatal stage, such as marked dysmorphic features, cardiac involvement, respiratory symptoms, dysostosis multiplex, severe growth abnormalities, and mental and motor developmental abnormalities. The median age at diagnosis for MLII is 0.7 years, the median survival is 5.0 years, and the median age at death is 1.8 years. No cure for MLII exists.MethodsSanger sequencing of the GNPTAB gene identified the compound heterozygous mutations c.673C > T in exon 7 and c.1090C > T in exon 9, which were novel double heterozygous mutations first reported in China. For the first time, we describe our experience in the use of HSCT for MLII. Our patient underwent HSCT with cells from a 9/10 human leukocyte antigen (HLA)-matched unrelated donor at 12 months of age. Myeloid neutrophil and platelet engraftment occurred on Days 10 and 11, respectively.ResultsThe patient's limb muscle tension was significantly reduced, and his gross and fine motor skills were improved four months after transplantation. DST(Developmental Screen Test) results showed that the patient's fine motor skills and mental development were improved compared with before HSCT.ConclusionMLII is a very severe lysosomal storage disease, to date, only 3 cases have been reported on the use of HSCT to treat MLII. Our data show that HSCT is a potential way to prolong the life of patients and improve their quality of life. Due to the lack of comparable data and time, the exact benefit remains unclear in MLII patients. Longer-term follow-up and in-depth prospective studies are indispensable.

Hepatitis B virus (HBV) infection remains a serious public health concern worldwide despite the availability of an efficient vaccine and the major improvements in antiviral treatments. The aim of the present study is to analyze the mutational profile of the HBV whole genome in ETV non-responder chronic HBV patients, in order to investigate antiviral drug resistance, immune escape, and liver disease progression to Liver Cirrhosis (LC) or Hepatocellular Carcinoma (HCC). Blood samples were collected from five chronic hepatitis B patients. For each patient, two plasma samples were collected, before and during the treatment. Whole genome sequencing was performed using Sanger technology. Phylogenetic analysis comparing the studied sequences with reference ones was used for genotyping. The mutational profile was analyzed by comparison with the reference sequence M32138. Genotyping showed that the studied strains belong to subgenotypes D1, D7, and D8. The mutational analysis showed high genetic variability. In the RT region of the polymerase gene, 28 amino acid (aa) mutations were detected. The most significant mutations were the pattern rtL180M + rtS202G + rtM204V, which confer treatment resistance. In the S gene, 35 mutations were detected namely sP120T, sT126S, sG130R, sY134F, sS193L, sI195M, and sL216stop were previously described to lead to vaccine, immunotherapy, and/or diagnosis escape. In the C gene, 34 mutations were found. In particular, cG1764A, cC1766G/T, cT1768A, and cC1773T in the BCP; cG1896A and cG1899A in the precore region and cT12S, cE64D, cA80T, and cP130Q in the core region were associated with disease progression to LC and/or HCC. Other mutations were associated with viral replication increase including cT1753V, cG1764A/T, cC1766G/T, cT1768A, and cC1788G in the BCP as well as cG1896A and cG1899A in the precore region. In the X gene, 30 aa substitutions were detected, of which substitutions xT36D, xP46S, xA47T, xI88F, xA102V, xI127T, xK130M, xV131I, and xF132Y were previously described to lead to LC and/or HCC disease progression. In conclusion, our results show high genetic variability in the long-term treatment of chronic HBV patients causing several effects. This could contribute to guiding national efforts to optimize relevant HBV treatment management in order to achieve the global hepatitis elimination goal by 2030. [ABSTRACT FROM AUTHOR]

Hepatitis B virus (HBV) infection remains a serious public health concern worldwide despite the availability of an efficient vaccine and the major improvements in antiviral treatments. The aim of the present study is to analyze the mutational profile of the HBV whole genome in ETV non-responder chronic HBV patients, in order to investigate antiviral drug resistance, immune escape, and liver disease progression to Liver Cirrhosis (LC) or Hepatocellular Carcinoma (HCC). Blood samples were collected from five chronic hepatitis B patients. For each patient, two plasma samples were collected, before and during the treatment. Whole genome sequencing was performed using Sanger technology. Phylogenetic analysis comparing the studied sequences with reference ones was used for genotyping. The mutational profile was analyzed by comparison with the reference sequence M32138. Genotyping showed that the studied strains belong to subgenotypes D1, D7, and D8. The mutational analysis showed high genetic variability. In the RT region of the polymerase gene, 28 amino acid (aa) mutations were detected. The most significant mutations were the pattern rtL180M + rtS202G + rtM204V, which confer treatment resistance. In the S gene, 35 mutations were detected namely sP120T, sT126S, sG130R, sY134F, sS193L, sI195M, and sL216stop were previously described to lead to vaccine, immunotherapy, and/or diagnosis escape. In the C gene, 34 mutations were found. In particular, cG1764A, cC1766G/T, cT1768A, and cC1773T in the BCP; cG1896A and cG1899A in the precore region and cT12S, cE64D, cA80T, and cP130Q in the core region were associated with disease progression to LC and/or HCC. Other mutations were associated with viral replication increase including cT1753V, cG1764A/T, cC1766G/T, cT1768A, and cC1788G in the BCP as well as cG1896A and cG1899A in the precore region. In the X gene, 30 aa substitutions were detected, of which substitutions xT36D, xP46S, xA47T, xI88F, xA102V, xI127T, xK130M, xV131I, and xF132Y were previously described to lead to LC and/or HCC disease progression. In conclusion, our results show high genetic variability in the long-term treatment of chronic HBV patients causing several effects. This could contribute to guiding national efforts to optimize relevant HBV treatment management in order to achieve the global hepatitis elimination goal by 2030.

Danon disease is a rare disease caused by glycogen storage lysosomal disorder. It is related to the pathogenic mutation of the LAMP2 gene. In this case report, we present a patient with a novel pathogenic mutation (c.764_765insGA) with cardiac-only symptoms. Her family members do not carry the same mutation she does, suggesting this is a de novo mutation. Further tests revealed vacuoles and glycogen disposition in the patient's heart tissue and a significant decrease in LAMP2 protein expression. Protein structure remodeling of LAMP2 predicted that the mutant protein has conformational change lacking an important transmembrane domain, subsequently causing protein destabilization.

Next Generation Sequencing (NGS) is the gold standard for the detection of new variants of SARS-CoV-2 including those which have immune escape properties, high infectivity, and variable severity. This test is helpful in genomic surveillance, for planning appropriate and timely public health interventions. But labs with NGS facilities are not available in small or medium research settings due to the high cost of setting up such a facility. Transportation of samples from many places to few centers for NGS testing also produces delays due to transportation and sample overload leading in turn to delays in patient management and community interventions. This becomes more important for patients traveling from hotspot regions or those suspected of harboring a new variant. Another major issue is the high cost of NGS-based tests. Thus, it may not be a good option for an economically viable surveillance program requiring immediate result generation and patient follow-up. The current study used a cost-effective facility which can be set up in a common research lab and which is replicable in similar centers with expertise in Sanger nucleotide sequencing. More samples can be processed at a time and can generate the results in a maximum of 2 days (1 day for a 24 h working lab). We analyzed the nucleotide sequence of the Receptor Binding Domain (RBD) region of SARS-CoV-2 by the Sanger sequencing using in-house developed methods. The SARS-CoV-2 variant surveillance was done during the period of March 2021 to May 2022 in the Northern region of Kerala, a state in India with a population of 36.4 million, for implementing appropriate timely interventions. Our findings broadly agree with those from elsewhere in India and other countries during the period.

Equine histoplasmosis commonly known as epizootic lymphangitis (EL) is a neglected granulomatous disease of equine that is endemic to Ethiopia. It is caused by Histoplasma capsulatum variety farciminosum, a dimorphic fungus that is closely related to H. capsulatum variety capsulatum. The objective of this study was to undertake a phylogenetic analysis of H. capsulatum isolated from EL cases of horses in central Ethiopia and evaluate their relationship with H. capsulatum isolates in other countries and/or clades using the internal transcribed spacer (ITS) region of rRNA genes. Clinical and mycological examinations, DNA extraction, polymerase chain reaction (PCR), Sanger sequencing, and phylogenetic analysis were used for undertaking this study. Additionally, sequence data of Histoplasma isolates were retrieved from GenBank and included for a comprehensive phylogenetic analysis. A total of 390 horses were screened for EL and 97 were positive clinically while H. capsulatum was isolated from 60 horses and further confirmed with PCR, of which 54 were sequenced. BLAST analysis of these 54 isolates identified 29 H. capsulatum isolates and 14 isolates from other fungal genera while the remaining 11 samples were deemed insufficient for further downstream analysis. The phylogenetic analysis identified five clades, namely, African, Eurasian, North American 1 and 2, and Latin American A and B. The Ethiopian isolates were closely aggregated with isolates of the Latin American A and Eurasian clades, whereas being distantly related to isolates from North American 1 and 2 clades as well as Latin American B clade. This study highlights the possible origins and transmission routes of Histoplasmosis in Ethiopia. [ABSTRACT FROM AUTHOR]

To address inborn errors of immunity (IEI) which were underdiagnosed in resource-limited regions, our centre developed and offered free genetic testing for the most common IEI by Sanger sequencing (SS) since 2001. With the establishment of The Asian Primary Immunodeficiency (APID) Network in 2009, the awareness and definitive diagnosis of IEI were further improved with collaboration among centres caring for IEI patients from East and Southeast Asia. We also started to use whole exome sequencing (WES) for undiagnosed cases and further extended our collaboration with centres from South Asia and Africa. With the increased use of Next Generation Sequencing (NGS), we have shifted our diagnostic practice from SS to WES. However, SS was still one of the key diagnostic tools for IEI for the past two decades. Our centre has performed 2,024 IEI SS genetic tests, with in-house protocol designed specifically for 84 genes, in 1,376 patients with 744 identified to have disease-causing mutations (54.1%). The high diagnostic rate after just one round of targeted gene SS for each of the 5 common IEI (X-linked agammaglobulinemia (XLA) 77.4%, Wiskott–Aldrich syndrome (WAS) 69.2%, X-linked chronic granulomatous disease (XCGD) 59.5%, X-linked severe combined immunodeficiency (XSCID) 51.1%, and X-linked hyper-IgM syndrome (HIGM1) 58.1%) demonstrated targeted gene SS should remain the first-tier genetic test for the 5 common X-linked IEI. [ABSTRACT FROM AUTHOR]

Purpose: Describing the clinical and genetic features of an ethnically heterogeneous group of (inherited retinal diseases) IRD patients from different underrepresented countries, referring to specialized Italian Hospitals, and expanding the epidemiological spectrum of the IRD in understudied populations. Methods: The patients' phenotypes underwent were characterized by exhaustive ophthalmological examinations, including morpho-functional testing. Genetic testing was performed using next-generation sequencing (NGS) and gene sequencing panels targeting a specific set of genes, Sanger sequencing and—when necessary—multiplex ligation-dependent probe amplification (MLPA) to better identify the genotype. When possible, segregation analysis was performed in order to confirm unsolved cases. Results: The article reports the results of the phenotypes and genotypes of 123 IRD probands, 69 males and 54 females, mean age 41 (IQR, 54–30) years, disease onset at 13 (IQR, 27.25–5) years. Thirty-three patients out of 123 (26.8%) were Africans (North/Northwest Africa), 21 (17.1%) Asians, 19 (15.4%) Americans (South/Central America) and 50 (40.7%) Europeans (Eastern Europe). Retinitis pigmentosa was the most represented phenotype (56%), followed by cone dystrophy (11%) and Leber congenital amaurosis (7%), while ABCA4 was the most frequently mutated gene (18%), followed by USH2A (9%) and RPGR (5%). About ABCA4 variants found in Stargardt disease, macular and cone dystrophies were predominant in Asian (42%) and European (21%) patients. The most represented inheritance pattern was autosomal recessive, while a higher frequency of homozygous patients versus compound heterozygotes as compared to previous studies on Italian IRD patients was evidenced, reflecting a possible higher frequency of inbreeding marriages. Conclusion: Though limited by the relatively low number of patients, the present paper paints a picture of the clinical and genetic features of IRD patients from understudied ethnic groups referred to Italian specialized hospitals and extended the epidemiological studies on underrepresented world regional areas. [ABSTRACT FROM AUTHOR]

Equine histoplasmosis commonly known as epizootic lymphangitis (EL) is a neglected granulomatous disease of equine that is endemic to Ethiopia. It is caused by Histoplasma capsulatum variety farciminosum, a dimorphic fungus that is closely related to H. capsulatum variety capsulatum. The objective of this study was to undertake a phylogenetic analysis of H. capsulatum isolated from EL cases of horses in central Ethiopia and evaluate their relationship with H. capsulatum isolates in other countries and/or clades using the internal transcribed spacer (ITS) region of rRNA genes. Clinical and mycological examinations, DNA extraction, polymerase chain reaction (PCR), Sanger sequencing, and phylogenetic analysis were used for undertaking this study. Additionally, sequence data of Histoplasma isolates were retrieved from GenBank and included for a comprehensive phylogenetic analysis. A total of 390 horses were screened for EL and 97 were positive clinically while H. capsulatum was isolated from 60 horses and further confirmed with PCR, of which 54 were sequenced. BLAST analysis of these 54 isolates identified 29 H. capsulatum isolates and 14 isolates from other fungal genera while the remaining 11 samples were deemed insufficient for further downstream analysis. The phylogenetic analysis identified five clades, namely, African, Eurasian, North American 1 and 2, and Latin American A and B. The Ethiopian isolates were closely aggregated with isolates of the Latin American A and Eurasian clades, whereas being distantly related to isolates from North American 1 and 2 clades as well as Latin American B clade. This study highlights the possible origins and transmission routes of Histoplasmosis in Ethiopia.

Purpose: Describing the clinical and genetic features of an ethnically heterogeneous group of (inherited retinal diseases) IRD patients from different underrepresented countries, referring to specialized Italian Hospitals, and expanding the epidemiological spectrum of the IRD in understudied populations.Methods: The patients’ phenotypes underwent were characterized by exhaustive ophthalmological examinations, including morpho-functional testing. Genetic testing was performed using next-generation sequencing (NGS) and gene sequencing panels targeting a specific set of genes, Sanger sequencing and—when necessary—multiplex ligation-dependent probe amplification (MLPA) to better identify the genotype. When possible, segregation analysis was performed in order to confirm unsolved cases.Results: The article reports the results of the phenotypes and genotypes of 123 IRD probands, 69 males and 54 females, mean age 41 (IQR, 54–30) years, disease onset at 13 (IQR, 27.25–5) years. Thirty-three patients out of 123 (26.8%) were Africans (North/Northwest Africa), 21 (17.1%) Asians, 19 (15.4%) Americans (South/Central America) and 50 (40.7%) Europeans (Eastern Europe). Retinitis pigmentosa was the most represented phenotype (56%), followed by cone dystrophy (11%) and Leber congenital amaurosis (7%), while ABCA4 was the most frequently mutated gene (18%), followed by USH2A (9%) and RPGR (5%). About ABCA4 variants found in Stargardt disease, macular and cone dystrophies were predominant in Asian (42%) and European (21%) patients. The most represented inheritance pattern was autosomal recessive, while a higher frequency of homozygous patients versus compound heterozygotes as compared to previous studies on Italian IRD patients was evidenced, reflecting a possible higher frequency of inbreeding marriages.Conclusion: Though limited by the relatively low number of patients, the present paper paints a picture of the clinical and genetic features of IRD patients from understudied ethnic groups referred to Italian specialized hospitals and extended the epidemiological studies on underrepresented world regional areas.

ObjectiveThe clinical manifestations of ataxia–telangiectasia (AT) are very complex and are easily misdiagnosed and missed. The purpose of this study was to explore the clinical characteristics and genetic features of five pediatric patients with AT from three pedigrees in china.MethodsRetrospectively collected and analyzed the clinical data and genetic testing results of five AT patients diagnosed by the Whole-exome sequencing followed by Sanger sequencing. The five patients with AT were from three pedigrees, including two female patients (case 1 and case 2) in pedigree I, one male patient (case 3) in pedigree II, and two male patients (case 4 and case 5) in pedigree III. According to the United Kingdom Association for Clinical Genomic Science Best Practice Guidelines for Variants Classification in Rare Disease 2020 to grade the genetic variants.ResultsFive patients had mainly clinical presentations including unsteady gait, dysarthria, bulbar conjunctive telangiectasia, cerebellar atrophy, intellectual disability, stunted growth, increase of alpha-fetoprotein in serum, lymphopenia. Notably, one patient with classical AT presented dystonia as the first symptom. One patient had recurrent infections, five patients had serum Immunoglobulin (Ig) A deficiency, and two patients had IgG deficiency. In three pedigrees, we observed five pathogenic variants of the ATM gene, which were c.1339C>T (p.Arg447Ter), c.7141_7151delAATGGAAAAAT (p.Asn2381GlufsTer18), c.437_440delTCAA (p.Leu146GlnfsTer6), c.2482A>T (p.Lys828Ter), and c.5495_5496+2delAAGT (p.Glu1832GlyfsTer4). Moreover, the c.437_440delTCAA, c.2482A>T, and c.5495_5496+2delAAGT were previously unreported variants.ConclusionsPediatric patients with classical AT may present dystonia as the main manifestation, or even a first symptom, besides typical cerebellar ataxia, bulbar conjunctive telangiectasia, etc. Crucially, we also found three novel pathogenic ATM gene variants (c.437_440delTCAA, c.2482A>T, and c.5495_5496+2delAAGT), expanding the ATM pathogenic gene mutation spectrum.

The fast pace of gene discovery has resulted in groundbreaking advances in the field of epilepsy genetics. Clinical testing using comprehensive gene panels, exomes, or genomes is now increasingly available and has significantly increased the diagnostic yield for early-onset epilepsies and enabled precision medicine approaches. In this paper, we report a case of epilepsy in a pedigree. The proband had heterozygous mutations in KCNC1 (NM_001112741.1:c.959G>A, p. Arg320His), CAPN3 (NM_000070.2:c.526G>A, p. Val176Met), and NEFH (NM_021076.3:c. 2595 delC, p. Lys866Argfs*51). Sanger sequencing verification was consistent with the results of whole-exome sequencing. The KCNC1 mutation was a de novo mutation, and the CAPN3 and NEFH mutations were inherited from their father and mother, respectively. Based on the American College of Medical Genetics and Genomics (ACMG) guidelines, a heterozygous mutation was found for APOB (NM_000384.2: c.10579C > T, p. Arg3527Trp). The heterozygous mutation at this site was inherent in the pedigree. Coexpression analysis indicated that heterozygous mutations of KCNC1, CAPN3, NEFH, and APOB were closely related to the clinical phenotypes of the patient, and the clinical phenotypic heterogeneity of the disease may be the result of the interaction of multiple genes.

Purpose: To investigate the role of the mouse double minute 2 (MDM2) gene single-nucleotide polymorphism (SNP) T309G in the development of epimacular membranes (EMMs) by analyzing the genotype distribution and consistency of the polymorphism in paired membrane-blood samples.Methods: This was a cross–sectional genetic association study of patients with proliferative vitreoretinopathy (PVR) or EMMs. PVR membranes (PVRMs), internal limiting membranes (ILMs) (PVR-ILMs) and blood samples (PVR-blood) from patients with PVR, and EMMs, EMM-ILMs and EMM-blood from patients with EMMs were collected. The genotype of all samples was determined by Sanger sequencing. Sex composition, mean age, the genotype distribution of MDM2 T309G, the allelic frequency of the MDM2 SNP309 G allele (% G) and the somatic mutation rate at the MDM2 T309G locus (% M) were analyzed and compared. The PVR and healthy Chinese donor groups were used as controls for different comparisons.Results: The EMM group of 62 patients was older than the PVR group of 61 patients by an average of 8.87 years (p < 0.0001), but the two groups were statistically similar in the sex composition (p = 0.1754). Importantly, G allele carriers were at a higher risk of developing EMMs than non-G allele carriers (p = 0.0479; OR = 2.047). Moreover, EMM-blood exhibited a significantly higher % G than blood samples from healthy Chinese donors (EMM-blood: 56.78%, donors: 45.61%; p = 0.0256; OR = 1.567). Regarding membrane-blood consistency, % M was significantly different between PVRMs and EMMs (PVRMs: 2.63%, EMMs: 21.57%; p = 0.0097; OR = 10.18) but not between different types of ILMs (PVR-ILMs: 18.18%, EMM-ILMs: 29.17%; p = 0.6855). Furthermore, EMMs (p = 0.0053; OR = 8.250) and EMM-ILMs (p = 0.0233; OR = 14.40) from patients with preoperative macular holes were more predisposed toward somatic mutations at the MDM2 T309G locus than those from patients without preoperative macular holes.Conclusions:MDM2 T309G is associated with the development of EMMs. Herein, the MDM2 SNP309 G allele is first reported as an associated factor of EMMs in a Chinese population. In addition, EMMs and ILMs are genetically unstable at the MDM2 T309G locus, especially when complicated with preoperative macular holes.

Non-tuberculous mycobacteria (NTM) are difficult to identify by biochemical and genetic methods due to their microbiological properties and complex taxonomy. The development of more efficient and rapid methods for species identification in the veterinary microbiological laboratory is, therefore, of great importance. Although MALDI-TOF Mass Spectrometry (MS) has become a promising tool for the identification of NTM species in human clinical practise, information regarding its performance on veterinary isolates is scarce. This study assesses the capacity of MALDI-TOF MS to identify NTM isolates (n = 75) obtained from different animal species. MALDI-TOF MS identified 76.0% (n = 57) and 4% (n = 3) of the isolates with high and low confidence, respectively, in agreement with the identification achieved by Sanger sequencing of housekeeping genes (16S rRNA, hsp65, and rpoB). Thirteen isolates (17.3%) were identified by Sanger sequencing to the complex level, indicating that these may belong to uncharacterised species. MALDI-TOF MS approximated low confidence identifications toward closely related mycobacterial groups, such as the M. avium or M. terrae complexes. Two isolates were misidentified due to a high similarity between species or due to the lack of spectra in the database. Our results suggest that MALDI-TOF MS can be used as an effective alternative for rapid screening of mycobacterial isolates in the veterinary laboratory and potentially for the detection of new NTM species. In turn, Sanger sequencing could be implemented as an additional method to improve identifications in species for which MALDI-TOF MS identification is limited or for further characterisation of NTM species.

Parkinson's disease (PD) is the fastest-growing neurodegenerative disorder. Aging, environmental factors, and genetics are considered as risk factors. The alpha-synuclein gene (SNCA), the first pathogenic gene identified in a familial form of PD, was indisputably involved as a heritable component for familial and sporadic PD. In this study, whole-exome sequencing and Sanger sequencing were performed to evaluate the association between the SNCA gene variants and PD. The genetic data of 438 clinically diagnosed patients with PD and 543 matched control populations of the Han Chinese were analyzed. The literature review of SNCA variants for 231 cases reported in 89 articles was extracted from the PubMed and the Movement Disorder Society Genetic mutation database. No potentially causative variant(s) in the SNCA gene, excepting two single-nucleotide nonsynonymous variants c.158C>T (p.A53V, rs542171324) and c.349C>T (p.P117S, rs145138372), were detected. There was no statistically significant difference in the genotypic or allelic frequencies for either variant between the PD group and the control group (all P > 0.05). No copy number variants of the SNCA gene were detected. The results of this study suggest that the variants in the exons of the SNCA gene may have less or no role in the development of PD in the Han Chinese populations. The literature review suggests that psychiatric signs and cognitive decline/dementia were more common among patients with SNCA duplication or triplication (psychiatric signs: χ2 = 7.892, P = 0.005; cognitive decline/dementia: χ2 = 8.991, P = 0.003). [ABSTRACT FROM AUTHOR]

Nonimmune hydrops fetalis (NIHF) is a serious and complex fetal condition. Prenatal diagnosis of hydrops fetalis is not difficult by ultrasound. However, determining the underlying etiology of NIHF remains a challenge which is essential to address for prenatal counseling. We extracted DNA from a proband prenatally diagnosed unexplained NIHF. Trio-whole exome sequencing (WES) was performed to filter candidate causative variants. Two gene mutations were identified as a compound heterozygous state in the proband. Both variants located on the PIEZO1 gene: c.3895C > T, a missense mutation in exon 27 paternally inherited; c.4030_4032del, a maternally inherited in-frame deletion in exon 28. Both variants were first reported to be related to NIHF. PIEZO1 gene mutations, leading to an autosomal recessive congenital lymphatic dysplasia, which can present as NIHF and partial or complete resolution postnatally. In conclusion, WES can aid in the elucidation of the genetic cause of NIHF and has a positive effect on the assessment of prognosis. [ABSTRACT FROM AUTHOR]

Nonimmune hydrops fetalis (NIHF) is a serious and complex fetal condition. Prenatal diagnosis of hydrops fetalis is not difficult by ultrasound. However, determining the underlying etiology of NIHF remains a challenge which is essential to address for prenatal counseling. We extracted DNA from a proband prenatally diagnosed unexplained NIHF. Trio-whole exome sequencing (WES) was performed to filter candidate causative variants. Two gene mutations were identified as a compound heterozygous state in the proband. Both variants located on the PIEZO1 gene: c.3895C > T, a missense mutation in exon 27 paternally inherited; c.4030_4032del, a maternally inherited in-frame deletion in exon 28. Both variants were first reported to be related to NIHF. PIEZO1 gene mutations, leading to an autosomal recessive congenital lymphatic dysplasia, which can present as NIHF and partial or complete resolution postnatally. In conclusion, WES can aid in the elucidation of the genetic cause of NIHF and has a positive effect on the assessment of prognosis.

Parkinson's disease (PD) is the fastest-growing neurodegenerative disorder. Aging, environmental factors, and genetics are considered as risk factors. The alpha-synuclein gene (SNCA), the first pathogenic gene identified in a familial form of PD, was indisputably involved as a heritable component for familial and sporadic PD. In this study, whole-exome sequencing and Sanger sequencing were performed to evaluate the association between the SNCA gene variants and PD. The genetic data of 438 clinically diagnosed patients with PD and 543 matched control populations of the Han Chinese were analyzed. The literature review of SNCA variants for 231 cases reported in 89 articles was extracted from the PubMed and the Movement Disorder Society Genetic mutation database. No potentially causative variant(s) in the SNCA gene, excepting two single-nucleotide nonsynonymous variants c.158C>T (p.A53V, rs542171324) and c.349C>T (p.P117S, rs145138372), were detected. There was no statistically significant difference in the genotypic or allelic frequencies for either variant between the PD group and the control group (all P > 0.05). No copy number variants of the SNCA gene were detected. The results of this study suggest that the variants in the exons of the SNCA gene may have less or no role in the development of PD in the Han Chinese populations. The literature review suggests that psychiatric signs and cognitive decline/dementia were more common among patients with SNCA duplication or triplication (psychiatric signs: χ2 = 7.892, P = 0.005; cognitive decline/dementia: χ2 = 8.991, P = 0.003).

Introduction/AimsMaturity-Onset Diabetes of the Young (MODY) is a monogenic non-autoimmune diabetes with 14 different genetic forms. MODY-related mutations are rarely found in the Tunisian population. Here, we explored MODY related genes sequences among seventeen unrelated Tunisian probands qualifying the MODY clinical criteria.Materials and MethodsThe GCK and HNF1A genes were systematically analyzed by direct sequencing in all probands. Then, clinical exome sequencing of 4,813 genes was performed on three unrelated patients. Among them, 130 genes have been reported to be involved in the regulation of glucose metabolism, β-cell development, differentiation and function. All identified variants were analyzed according to their frequencies in the GnomAD database and validated by direct sequencing.ResultsWe identified the previously reported GCK mutation (rs1085307455) in one patient. The clinical features of the MODY2 proband were similar to previous reports. In this study, we revealed rare and novel alterations in GCK (rs780806456) and ABCC8 (rs201499958) genes with uncertain significance. We also found two likely benign alterations in HNF1A (rs1800574) and KLF11 (rs35927125) genes with minor allele frequencies similar to those depicted in public databases. No pathogenic variants have been identified through clinical exome analysis.ConclusionsThe most appropriate patients were selected, following a strict clinical screening approach, for genetic testing. However, the known MODY1-13 genes could not explain most of the Tunisian MODY cases, suggesting the involvement of unidentified genes in the majority of Tunisian affected families.

Introduction/Aims: Maturity-Onset Diabetes of the Young (MODY) is a monogenic non-autoimmune diabetes with 14 different genetic forms. MODY-related mutations are rarely found in the Tunisian population. Here, we explored MODY related genes sequences among seventeen unrelated Tunisian probands qualifying the MODY clinical criteria. Materials and Methods: The GCK and HNF1A genes were systematically analyzed by direct sequencing in all probands. Then, clinical exome sequencing of 4,813 genes was performed on three unrelated patients. Among them, 130 genes have been reported to be involved in the regulation of glucose metabolism, β-cell development, differentiation and function. All identified variants were analyzed according to their frequencies in the GnomAD database and validated by direct sequencing. Results: We identified the previously reported GCK mutation (rs1085307455) in one patient. The clinical features of the MODY2 proband were similar to previous reports. In this study, we revealed rare and novel alterations in GCK (rs780806456) and ABCC8 (rs201499958) genes with uncertain significance. We also found two likely benign alterations in HNF1A (rs1800574) and KLF11 (rs35927125) genes with minor allele frequencies similar to those depicted in public databases. No pathogenic variants have been identified through clinical exome analysis. Conclusions: The most appropriate patients were selected, following a strict clinical screening approach, for genetic testing. However, the known MODY1-13 genes could not explain most of the Tunisian MODY cases, suggesting the involvement of unidentified genes in the majority of Tunisian affected families. [ABSTRACT FROM AUTHOR]

The whole-genome sequencing (WGS) of human adenoviruses (HAdVs) plays an important role in identifying, typing, and mutation analysis of HAdVs. Nowadays, three generations of sequencing have been developed. The accuracy of first-generation sequencing is up to 99.99%, whereas this technology relies on PCR and is time consuming; the next-generation sequencing (NGS) is expensive and not cost effective for determining a few special samples; and the third-generation sequencing technology has a higher error rate. In this study, first, we developed an efficient HAdV genomic DNA extraction method. Using the complete genomic DNA instead of the PCR amplicons as the direct sequencing template and a set of walking primers, we developed the HAdV WGS method based on first-generation sequencing. The HAdV whole genomes were effectively sequenced by a set of one-way sequencing primers designed, which reduced the sequencing time and cost. More importantly, high sequence accuracy is guaranteed. Four HAdV strains (GZ01, GZ02, HK35, and HK91) were isolated from children with acute respiratory diseases (ARDs), and the complete genomes were sequenced using this method. The accurate sequences of the whole inverted terminal repeats (ITRs) at both ends of the HAdV genomes were also acquired. The genome sequence of human adenovirus type 14 (HAdV-B14) strain GZ01 acquired by this method is identical to the sequence released in GenBank, which indicates that this novel sequencing method has high accuracy. The comparative genomic analysis identified that strain GZ02 isolated in September 2010 had the identical genomic sequence with the HAdV-B14 strain GZ01 (October 2010). Therefore, strain GZ02 is the first HAdV-B14 isolate emergent in China (September 2010; GenBank acc no. MW692349). The WGS of HAdV-C2 strain HK91 and HAdV-E4 strain HK35 isolated from children with acute respiratory disease in Hong Kong were also determined by this sequencing method. In conclusion, this WGS method is fast, accurate, and universal for common human adenovirus species B, C, and E. The sequencing strategy may also be applied to the WGS of the other DNA viruses. [ABSTRACT FROM AUTHOR]

Primary cardiomyopathies (CMPs) are monogenic but multi-allelic disorders with dozens of genes involved in pathogenesis. The implementation of next-generation sequencing (NGS) approaches has resulted in more time- and cost-efficient DNA diagnostics of cardiomyopathies. However, the diagnostic yield of genetic testing for each subtype of CMP fails to exceed 60%. The aim of this study was to demonstrate that allelic dropout (ADO) is a common phenomenon that reduces the diagnostic yield in primary cardiomyopathy genetic testing based on targeted gene panels assayed on the Ion Torrent platform. We performed mutational screening with three custom targeted gene panels based on sets of oligoprimers designed automatically using AmpliSeq Designer® containing 1049 primer pairs for 37 genes with a total length of 153 kb. DNA samples from 232 patients were screened with at least one of these targeted gene panels. We detected six ADO events in both IonTorrent PGM (three cases) and capillary Sanger sequencing (three cases) data, identifying ADO-causing variants in all cases. All ADO events occurred due to common or rare single nucleotide variants (SNVs) in the oligoprimer binding sites and were detected because of the presence of “marker” SNVs in the target DNA fragment. We ultimately identified that PCR-based NGS involves a risk of ADO that necessitates the use of Sanger sequencing to validate NGS results. We assume that oligoprimer design without ADO data affects the amplification efficiency of up to 0.77% of amplicons.

Primary cardiomyopathies (CMPs) are monogenic but multi-allelic disorders with dozens of genes involved in pathogenesis. The implementation of next-generation sequencing (NGS) approaches has resulted in more time- and cost-efficient DNA diagnostics of cardiomyopathies. However, the diagnostic yield of genetic testing for each subtype of CMP fails to exceed 60%. The aim of this study was to demonstrate that allelic dropout (ADO) is a common phenomenon that reduces the diagnostic yield in primary cardiomyopathy genetic testing based on targeted gene panels assayed on the Ion Torrent platform. We performed mutational screening with three custom targeted gene panels based on sets of oligoprimers designed automatically using AmpliSeq Designer® containing 1049 primer pairs for 37 genes with a total length of 153 kb. DNA samples from 232 patients were screened with at least one of these targeted gene panels. We detected six ADO events in both IonTorrent PGM (three cases) and capillary Sanger sequencing (three cases) data, identifying ADO-causing variants in all cases. All ADO events occurred due to common or rare single nucleotide variants (SNVs) in the oligoprimer binding sites and were detected because of the presence of "marker" SNVs in the target DNA fragment. We ultimately identified that PCR-based NGS involves a risk of ADO that necessitates the use of Sanger sequencing to validate NGS results. We assume that oligoprimer design without ADO data affects the amplification efficiency of up to 0.77% of amplicons. [ABSTRACT FROM AUTHOR]

Introduction: Nigeria is one of the most populated countries in the world; however, there is a scarcity of studies in patients with age-related neurodegenerative diseases, such as Parkinson disease (PD). The aim of this study was to screen patients with PD including a small cohort of early-onset PD (EOPD) cases from Nigeria for PRKN, PINK1, DJ1, SNCA multiplication, and LRRK2 p.G2019S.Methods: We assembled a cohort of 109 Nigerian patients with PD from the four main Nigerian tribes: Yoruba, Igbo, Edo, and Hausa. Fifteen cases [14 from the Yoruba tribe (93.3%)] had EOPD (defined as age-at-onset

Next-generation sequencing (NGS)’s crucial role in supporting genetic diagnosis and personalized medicine leads to the definition of Guidelines for Diagnostic NGS by the European Society of Human Genetics. Factors of different nature producing false-positive/negative NGS data together with the paucity of internationally accepted guidelines providing specified NGS quality metrics to be followed for diagnostics purpose made the Sanger validation of NGS variants still mandatory. We reported the analysis of three cases of discrepancy between NGS and Sanger sequencing in a cohort of 218 patients. NGS was performed by Illumina MiSeq® and Haloplex/SureSelect protocols targeting 97 or 57 or 10 gene panels usually applied for diagnostics. Variants called following guidelines suggested by the Broad Institute and identified according to MAF 0.2 were Sanger validated. Three out of 945 validated variants showed a discrepancy between NGS and Sanger. In all three cases, a deep evaluation of the discrepant gene variant results and methodological approach allowed to confirm the NGS datum. Allelic dropout (ADO) occurrence during polymerase chain or sequencing reaction was observed, mainly related to incorrect variant zygosity. Our study extends literature data in which almost 100% “high quality” NGS variants are confirmed by Sanger; moreover, it demonstrates that in case of discrepancy between a high-quality NGS variant and Sanger validation, NGS call should not be a priori assumed to represent the source of the error. Actually, difficulties (i.e., ADO, unpredictable presence of private variants on primer-binding regions) of the so-called gold standard direct sequencing should be considered especially in light of the constantly implemented and accurate high-throughput technologies. Our data along with literature raise a discussion on the opportunity to establish a standardized quality threshold by International Guidelines for clinical NGS in order to limit Sanger confirmation to borderline conditions of variant quality parameters and verification of correct gene variant call/patient coupling on a different blood sample aliquot.

Introduction: Nigeria is one of the most populated countries in the world; however, there is a scarcity of studies in patients with age-related neurodegenerative diseases, such as Parkinson disease (PD). The aim of this study was to screen patients with PD including a small cohort of early-onset PD (EOPD) cases from Nigeria for PRKN, PINK1, DJ1, SNCA multiplication, and LRRK2 p.G2019S. Methods: We assembled a cohort of 109 Nigerian patients with PD from the four main Nigerian tribes: Yoruba, Igbo, Edo, and Hausa. Fifteen cases [14 from the Yoruba tribe (93.3%)] had EOPD (defined as age-at-onset <50 years). All patients with EOPD were sequenced for the coding regions of PRKN, PINK1 , and DJ1. Exon dosage analysis was performed with a multiplex ligation-dependent probe amplification assay, which also included a SNCA probe and LRRK2 p.G2019S. We screened for LRRK2 p.G2019S in the entire PD cohort using a genotyping assay. The PINK1 p.R501Q functional analysis was conducted. Results: In 15 patients with EOPD, 22 variants were observed [ PRKN , 9 (40.9%); PINK1 , 10 (45.5%); and DJ1 , 3 (13.6%)]. Three (13.6%) rare, nonsynonymous variants were identified, but no homozygous or compound heterozygous carriers were found. No exonic rearrangements were present in the three genes, and no carriers of SNCA genomic multiplications or LRRK2 p.G2019S were identified. The PINK1 p.R501Q functional analysis revealed pathogenic loss of function. Conclusion: More studies on age-related neurodegenerative diseases are needed in sub-Saharan African countries, including Nigeria. Population-specific variation may provide insight into the genes involved in PD in the local population but may also contribute to larger studiesperformed in White and Asian populations. [ABSTRACT FROM AUTHOR]

Next-generation sequencing (NGS)'s crucial role in supporting genetic diagnosis and personalized medicine leads to the definition of Guidelines for Diagnostic NGS by the European Society of Human Genetics. Factors of different nature producing false-positive/negative NGS data together with the paucity of internationally accepted guidelines providing specified NGS quality metrics to be followed for diagnostics purpose made the Sanger validation of NGS variants still mandatory. We reported the analysis of three cases of discrepancy between NGS and Sanger sequencing in a cohort of 218 patients. NGS was performed by Illumina MiSeq® and Haloplex/SureSelect protocols targeting 97 or 57 or 10 gene panels usually applied for diagnostics. Variants called following guidelines suggested by the Broad Institute and identified according to MAF <0.01 and allele balance >0.2 were Sanger validated. Three out of 945 validated variants showed a discrepancy between NGS and Sanger. In all three cases, a deep evaluation of the discrepant gene variant results and methodological approach allowed to confirm the NGS datum. Allelic dropout (ADO) occurrence during polymerase chain or sequencing reaction was observed, mainly related to incorrect variant zygosity. Our study extends literature data in which almost 100% "high quality" NGS variants are confirmed by Sanger; moreover, it demonstrates that in case of discrepancy between a high-quality NGS variant and Sanger validation, NGS call should not be a priori assumed to represent the source of the error. Actually, difficulties (i.e., ADO, unpredictable presence of private variants on primer-binding regions) of the so-called gold standard direct sequencing should be considered especially in light of the constantly implemented and accurate high-throughput technologies. Our data along with literature raise a discussion on the opportunity to establish a standardized quality threshold by International Guidelines for clinical NGS in order to limit Sanger confirmation to borderline conditions of variant quality parameters and verification of correct gene variant call/patient coupling on a different blood sample aliquot. [ABSTRACT FROM AUTHOR]

Background: Dyggve-Melchior-Clausen syndrome (DMC) is a skeletal dysplasia with associated defects of brain development and intelligence. The truncating pathogenic variants in DYM are the most frequent cause of DMC. Smith-McCort (SMC), another skeletal dysplasia, is also caused by non-synonymous DYM variants.Methods and Results: In the current study, we examined a Pakistani consanguineous family with three affected members. Clinical features like spondyloepimetaphyseal dysplasia, indicative of characteristic skeletal abnormalities, and intellectual disability were observed. Our male patients had microcephaly and coarse facial features while the female patient did not represent microcephaly or abnormal facies, which are significant features of DMC patients. Sanger sequencing identified a novel homozygous frameshift insertion (c.95_96insT, p.W33Lfs*14) in DYM, which likely leads to nonsense-mediated decay (NMD).Conclusion: The novel frameshift change verifies the fact that pathogenic variants in DYM are the most frequent cause of DMC.

Key insights into the evolutionary history of recently extinct or critically endangered species can be obtained through analysis of genomic data collected using high-throughput sequencing and ancient DNA from museum specimens, particularly where specimens are rare. For instance, the evolutionary history of the critically endangered Puebla deer mouse, Peromyscus mekisturus, remains unclear due to discordance between morphological and molecular phylogenetic analyses. However, previous molecular analyses were based on PCR and Sanger sequencing of only a few mitochondrial genes. Here, we used ancient DNA from historical museum specimens followed by target enrichment and high-throughput sequencing of several thousand nuclear ultraconserved elements and whole mitochondrial genomes to test the validity of the previous phylogenetic placement of P. mekisturus. Based on UCEs and mitogenomes, our results revealed that P. mekisturus forms a well-supported distinct lineage outside the clade containing all other members of the Peromyscus melanophrys group. Additionally, the mitogenome phylogeny further supports the placement of P. mekisturus as the sister species of the genus Reithrodontomys. This conflicts with the previous mtDNA phylogenetic reconstruction, in which P. mekisturus was nested within the species P. melanophrys. Our study demonstrates that high-throughput sequencing of ancient DNA, appropriately controlling for contamination and degradation, can provide a robust resolution of the evolutionary history and taxonomic status of species for which few or no modern genetic samples exist. In light of our results and pending further analysis with denser taxon sampling and the addition of morphological data, a re-evaluation of the taxonomy and conservation management plans of P. mekisturus is needed to ensure that the evolutionary distinctiveness of this species is recognized in future conservation efforts.

BackgroundThis study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients.MethodsWhole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ2- and Fisher's tests were used to analyze the genotype–phenotype correlations.Results(1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021).ConclusionsThis study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling.

Saproxylic beetles are important bioindicators of forest health but their enormous diversity makes their identification challenging. As an example, the French fauna of saproxylic beetles alone contains 2,663 species in 72 families. Recently, DNA barcoding was proposed as a promising tool for the identification and monitoring of saproxylic beetle species. However, the rate of DNA barcode recovery from specimens of natural history collections using standard Sanger sequencing protocols remains low and challenges the construction of reference libraries. In this study, we test the potential of high-throughput sequencing (HTS) technology to reduce this shortfall by increasing sequencing success rate and lowering processing cost per specimen. Using a dual-indexing strategy for library construction and sequencing on the Illumina MiSeq platform, we successfully sequenced the DNA barcodes of 286 dry-pinned saproxylic beetles out of 521 specimens aged from 1 to 17 years and sampled in natural history collections. Age at sequencing did not affect sequence recovery and the success rate (54.9%) of our approach is comparable to that obtained using Sanger sequencing technology in another study targeting beetle specimens from natural history collections, but the cost per specimen is significantly reduced when using HTS. Finally, we shortly discuss how the newly produced DNA barcodes contribute to the existing library and we highlight a few interesting cases in which the new sequences question current species boundaries.

Background: Sexually transmitted diseases (STD) are a major cause of infertility, long-term disability, ectopic pregnancy, and premature birth. Therefore, the development of fast and low-cost laboratory STD diagnostic screening methods will contribute to reducing STD-induced reproductive tract damage and improve women's health worldwide. In this study, we evaluated a novel multiplex real-time PCR melting curve assay method for the simultaneous detection of 9 STD pathogens, including Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Mycoplasma hominis, Ureaplasma urealyticum, Ureaplasma parvum, and herpes simplex virus.Methods: The analytical performance of the method, including its limit of detection (LOD), specificity, repeatability, and effect on different DNA extraction kits were evaluated. Additionally, we obtained 1,328 clinical specimens from 3 hospitals to detect the 9 STD pathogens using multiplex real-time PCR melting curve and Sanger sequencing, to evaluate the sensitivity, specificity, and consistency of the assay method.Results: The results showed that the analytical sensitivity of the novel multiplex real-time PCR melting curve assay is very excellent, with LOD of DNA corresponding to

Agenesis of the corpus callosum (ACC) is a birth defect in which the corpus callosum is either partially or completely missing. With recent advances in prenatal ultrasound, detection of ACC in obstetric practices is becoming more common. Etiologies of ACC include chromosome errors, genetic factors, prenatal infections, and other factors related to the prenatal environment. In an effort to elucidate more about the genetic influence in the pathogenesis of ACC, we identified, through whole-exome sequencing (WES), two gene mutations in two families with complete agenesis of the corpus callosum. These two mutations are located on chromosome X: one is a hemizygous missense mutation c.3746T>C (p. L1249P) in the gene mediator complex subunit 12 (MED12); the other one is a heterozygous missense mutation c.128+5G>C in gene ephrin B1 (EFNB1). Historically, early diagnosis of complete ACC during pregnancy has been difficult; however, WES has provided us with a creative avenue of diagnosis, combining identification of genetic mutations with prenatal imaging.

Background: This study aimed to investigate the genetic causes of hypohidrotic ectodermal dysplasia (HED) in two families and elucidate the molecular pathogenesis of HED in Chinese Han patients. Methods: Whole-exome sequencing (WES) was used to screen HED-related genes in two family members, followed by confirmatory Sanger sequencing. Bioinformatics analysis was performed for the mutations. We reviewed HED-related articles in PubMed. χ 2- and Fisher's tests were used to analyze the genotype–phenotype correlations. Results: (1) WES identified EDA missense mutations [c.1127 C > T (p.T376M; NM_001005609)] in family 1 and an EDA nonframeshift deletion mutation [c.648_683delACCTGGTCCTCCAGGTCCTCCTGGTCCTCAAGGACC (p.216_228delPPGPPGPPGPQGP; NM_001005609)] in family 2. Sanger sequencing validated the results. ANNOVAR (ANNOtate VARiation) annotation indicated that c.1127 c > T was a deleterious mutation. (2) The review of published papers revealed 68 novel mutations related to HED: 57 (83.8%) were EDA mutations, 8 (11.8%) were EDAR mutations, 2 (2.9%) were EDARADD mutations, 1 (1.5%) was a WNT10A mutation, 31 (45.6%) were missense mutations, 23 (33.8%) were deletion mutations, and 1 (1.5%) was an indel. Genotype–phenotype correlation analysis revealed that patients with EDA missense mutations had a higher frequency of hypohidrosis (P = 0.021). Conclusions: This study identified two EDA gene mutations in two Chinese Han HED families and provides a foundation for genetic diagnosis and counseling. [ABSTRACT FROM AUTHOR]

Agenesis of the corpus callosum (ACC) is a birth defect in which the corpus callosum is either partially or completely missing. With recent advances in prenatal ultrasound, detection of ACC in obstetric practices is becoming more common. Etiologies of ACC include chromosome errors, genetic factors, prenatal infections, and other factors related to the prenatal environment. In an effort to elucidate more about the genetic influence in the pathogenesis of ACC, we identified, through whole-exome sequencing (WES), two gene mutations in two families with complete agenesis of the corpus callosum. These two mutations are located on chromosome X: one is a hemizygous missense mutation c.3746T>C (p. L1249P) in the gene mediator complex subunit 12 (MED12); the other one is a heterozygous missense mutation c.128+5G>C in gene ephrin B1 (EFNB1). Historically, early diagnosis of complete ACC during pregnancy has been difficult; however, WES has provided us with a creative avenue of diagnosis, combining identification of genetic mutations with prenatal imaging. [ABSTRACT FROM AUTHOR]