Search

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant. [ABSTRACT FROM AUTHOR]

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Research, production, and use of genetically modified (GM) crops have split the world between supporters and opponents. Up to now, this technology has been limited to the control of weeds and pests, whereas the second generation of GM crops is expected to assist farmers in abiotic stress tolerance or improved nutritional features. Aiming to analyze this subject holistically, in this presentation we address an advanced technology for drought-tolerant GM crops, upscaling from molecular details obtained in the laboratory to an extensive network of field trials as well as the impact of the introduction of this innovation into the market. Sunflower has divergent transcription factors, which could be key actors in the drought response orchestrating several signal transduction pathways, generating an improved performance to deal with water deficit. One of such factors, HaHB4, belongs to the homeodomain-leucine zipper family and was first introduced in Arabidopsis. Transformed plants had improved tolerance to water deficits, through the inhibition of ethylene sensitivity and not by stomata closure. Wheat and soybean plants expressing the HaHB4 gene were obtained and cropped across a wide range of growing conditions exhibiting enhanced adaptation to drought-prone environments, the most important constraint affecting crop yield worldwide. The performance of wheat and soybean, however, differed slightly across mentioned environments; whereas the improved behavior of GM wheat respect to controls was less dependent on the temperature regime (cool or warm), differences between GM and wild-type soybeans were remarkably larger in warmer compared to cooler conditions. In both species, these GM crops are good candidates to become market products in the near future. In anticipation of consumers’ and other stakeholders’ interest, spectral analyses of field crops have been conducted to differentiate these GM crops from wild type and commercial cultivars. In this paper, the potential impact of the release of such market products is discussed, considering the perspectives of different stakeholders.

Research, production, and use of genetically modified (GM) crops have split the world between supporters and opponents. Up to now, this technology has been limited to the control of weeds and pests, whereas the second generation of GM crops is expected to assist farmers in abiotic stress tolerance or improved nutritional features. Aiming to analyze this subject holistically, in this presentation we address an advanced technology for drought-tolerant GM crops, upscaling from molecular details obtained in the laboratory to an extensive network of field trials as well as the impact of the introduction of this innovation into the market. Sunflower has divergent transcription factors, which could be key actors in the drought response orchestrating several signal transduction pathways, generating an improved performance to deal with water deficit. One of such factors, HaHB4, belongs to the homeodomain-leucine zipper family and was first introduced in Arabidopsis. Transformed plants had improved tolerance to water deficits, through the inhibition of ethylene sensitivity and not by stomata closure. Wheat and soybean plants expressing the HaHB4 gene were obtained and cropped across a wide range of growing conditions exhibiting enhanced adaptation to drought-prone environments, the most important constraint affecting crop yield worldwide. The performance of wheat and soybean, however, differed slightly across mentioned environments; whereas the improved behavior of GM wheat respect to controls was less dependent on the temperature regime (cool or warm), differences between GM and wild-type soybeans were remarkably larger in warmer compared to cooler conditions. In both species, these GM crops are good candidates to become market products in the near future. In anticipation of consumers' and other stakeholders' interest, spectral analyses of field crops have been conducted to differentiate these GM crops from wild type and commercial cultivars. In this paper, the potential impact of the release of such market products is discussed, considering the perspectives of different stakeholders. [ABSTRACT FROM AUTHOR]

The Panax ginseng TIP gene PgTIP1 was previously demonstrated to have high water channel activity by its heterologous expression in Xenopus laevis oocytes and in yeast; it also plays a significant role in growth of PgTIP1-transgenic Arabidopsis plants under favorable conditions and has enhanced tolerance toward salt and drought treatment. In this work, we first investigated the physiological effects of heterologous PgTIP1 expression in soybean cotyledon hairy roots or composite plants mediated by Agrobacterium rhizogenes toward enhanced salt tolerance. The PgTIP1-transgenic soybean plants mediated by the pollen tube pathway, represented by the lines N and J11, were analyzed at the physiological and molecular levels for enhanced salt tolerance. The results showed that in terms of root-specific heterologous expression, the PgTIP1-transformed soybean cotyledon hairy roots or composite plants displayed superior salt tolerance compared to the empty vector-transformed ones according to the mitigatory effects of hairy root growth reduction, drop in leaf RWC, and rise in REL under salt stress. Additionally, declines in K+ content, increases in Na+ content and Na+/K+ ratios in the hairy roots, stems, or leaves were effectively alleviated by PgTIP1-transformation, particularly the stems and leaves of composite soybean plants. At the whole plant level, PgTIP1-trasgenic soybean lines were found to possess stronger root vigor, reduced root and leaf cell membrane damage, increased SOD, POD, CAT, and APX activities, steadily increased leaf Tr, RWC, and Pn values, and smaller declines in chlorophyll and carotenoid content when exposed to salt stress compared to wild type. Moreover, the distribution patterns of Na+, K+, and Cl- in the roots, stems, and leaves of salt-stressed transgenic plants were readjusted, in that the absorbed Na+ and Cl- were mainly restricted to the roots to reduce their transport to the shoots, and the transport of root-absorbed K+ to the shoots was simultaneously promoted. PgTIP1 transformation into soybean plants enhanced the expression of some stress-related genes (GmPOD, GmAPX1, GmSOS1, and GmCLC1) in the roots and leaves under salt treatment. This indicates that the causes of enhanced salt tolerance of heterologous PgTIP1-transformed soybean are associated with the positive regulation on water relations, ion homeostasis, and ROS scavenging under salt stress both at root-specific and whole plant levels.

Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. About 21 Gb sequence data (~21× coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

Glyphosate is a widely used non-selective herbicide with broad spectrum of weed control around the world. At present, most of the commercial glyphosate tolerant soybeans utilize glyphosate tolerant gene CP4-EPSPS or glyphosate acetyltransferase gene GAT separately. In this study, both glyphosate tolerant gene G2-EPSPS and glyphosate degraded gene GAT were co-transferred into soybean and transgenic plants showed high tolerance to glyphosate. Molecular analysis including PCR, Sothern blot, qRT-PCR and Western blot revealed that target genes have been integrated into genome and expressed effectively at both mRNA and protein levels. Furthermore, the glyphosate tolerance analysis showed that no typical symptom was observed when compared with a glyphosate tolerant line HJ06-698 derived from GR1 transgenic soybean even at four-fold labeled rate of Roundup. Chlorophyll and shikimic acid content analysis of transgenic plant also revealed that these two indexes were not significantly altered after glyphosate application. These results indicated that co-expression of G2-EPSPS and GAT conferred high tolerance to the herbicide glyphosate in soybean. Therefore, combination of tolerant and degraded genes provides a new strategy for developing glyphosate tolerant transgenic crops.