Search

IntroductionThe immune response regulates the severity of COVID-19 (sCOVID-19). This study examined the cause-and-effect relationship between immune cell traits (ICTs) and the risk of severe COVID-19. Additionally, we discovered the potential role of plasma metabolome in modulating this risk.MethodsEmploying data from a genome-wide association study (GWAS), we conducted a two-sample Mendelian randomization (MR) assessment of 731 genetic ICTs and sCOVID-19 (5,101 cases, 1,383,241 controls) incidence. The MR analysis was utilized to further quantitate the degree of plasma metabolome-mediated regulation of immune traits in sCOVID-19.ResultsThe inverse variance weighted method recognized 2 plasma metabolites (PMs) responsible for casual associations between immune cells and sCOVID-19 risk. These included Tridecenedioate (C13:1-DC) which regulated the association between CD27 on IgD- CD38br (OR 0.804, 95% CI 0.699–0.925, p = 0.002) and sCOVID-19 risk (mediated proportion: 18.7%); arginine to citrulline ratio which controlled the relationship of CD39 on monocyte (OR 1.053, 95% CI 1.013–1.094, p = 0.009) with sCOVID-19 risk (mediated proportion: -7.11%). No strong evidence that genetically predicted sCOVID-19 influenced the aforementioned immune traits.ConclusionIn this study, we have successfully identified a cause-and-effect relationship between certain ICTs, PMs, and the likelihood of contracting severe COVID-19. Our findings can potentially improve the accuracy of COVID-19 prognostic evaluation and provide valuable insights into the underlying mechanisms of the disease.

BackgroundApoptosis is associated with the pathogenesis of Mycobacterium tuberculosis infection. This study aims to identify apoptosis-related genes as biomarkers for differentiating active tuberculosis (ATB) from latent tuberculosis infection (LTBI).MethodsThe tuberculosis (TB) datasets (GSE19491, GSE62525, and GSE28623) were downloaded from the Gene Expression Omnibus (GEO) database. The diagnostic biomarkers differentiating ATB from LTBI were identified by combining the data of protein-protein interaction network, differentially expressed gene, Weighted Gene Co-Expression Network Analysis (WGCNA), and receiver operating characteristic (ROC) analyses. Machine learning algorithms were employed to validate the diagnostic ability of the biomarkers. Enrichment analysis for biomarkers was established, and potential drugs were predicted. The association between biomarkers and N6-methyladenosine (m6A) or 5-methylated cytosine (m5C) regulators was evaluated.ResultsSix biomarkers including CASP1, TNFSF10, CASP4, CASP5, IFI16, and ATF3 were obtained for differentiating ATB from LTBI. They showed strong diagnostic performances, with area under ROC (AUC) values > 0.7. Enrichment analysis demonstrated that the biomarkers were involved in immune and inflammation responses. Furthermore, 24 drugs, including progesterone and emricasan, were predicted. The correlation analysis revealed that biomarkers were positively correlated with most m6A or m5C regulators.ConclusionThe six ARGs can serve as effective biomarkers differentiating ATB from LTBI and provide insight into the pathogenesis of Mycobacterium tuberculosis infection.

Channel catfish virus (CCV, Ictalurid herpesvirus 1) is the causative pathogen of channel catfish virus disease, which has caused high mortality and substantial economic losses in the catfish aquaculture industry. Due to the lack of licensed prophylactic vaccines and therapeutic drugs, the prevention and control of CCV infection seem to remain stagnant. Active compounds from medicinal plants offer eligible sources of pharmaceuticals and lead drugs to fight against endemic and pandemic diseases and exhibit excellent effect against viral infection. In this study, we evaluated the antiviral ability of 12 natural compounds against CCV with cell models in vitro and found kaempferol exhibited the strongest inhibitory compound against CCV infection among all the tested compounds. Correspondingly, kaempferol decreased transcription levels of viral genes and the synthesis of viral proteins, as well as reduced proliferation and release of viral progeny, the severity of the CPE induced by CCV in a dose-dependent manner, based on quantitative real-time PCR (RT-qPCR), western blotting, viral cytopathic effects (CPE) and viral titer assessment. Moreover, time-of-drug-addition assays, virus attachment, and penetration assays revealed that kaempferol exerted anti-CCV activity probably by blocking attachment and internalization of the viral entry process. Altogether, the present results indicated that kaempferol may be a promising candidate antiviral agent against CCV infection, which shed light on the development of a novel and potent treatment for fish herpesvirus infection.

IntroductionAdolescence is a crucial period for establishing ego identity and becoming a social individual. However, numerous adolescents suffer from mental health problems, especially after the conditions surrounding the COVID-19 outbreak. Personality assessments are often used when adolescents look for psychological self-help services. However, the meaning and mechanism of these personality assessments remain unknown. Taking the increasingly popular MBTI personality assessment as an entry point, the current study examined the potential sequential mediation relationship of Barnum effect – ego identity on the link between personality assessment usage and mental health.MethodsThe current study surveyed 308 Chinese high school students, including 109 males and 199 females. MBTI use, Barnum effect, ego-identity, and mental health (subjective well-being, depression, and anxiety) were measured by seven questionnaires, respectively. Sequential mediation models were constructed to analyze the relationship.ResultsThe results indicate that the Barnum effect and ego identity together function as a sequential mediation path between personality assessment use and teenagers’ mental health, including subjective well-being, depression, and anxiety. Specifically, a higher level of MBTI use triggers a stronger Barnum effect. The Barnum effect then promotes adolescents’ ego identity, ultimately increasing subjective well-being levels and reducing anxiety and depression.DiscussionOur findings suggest that by properly using personality assessment and stimulating the Barnum effect, we can enhance adolescents’ mental health. The theoretical and practical implications of our findings are discussed.

BackgroundCancer stem cells (CSCs) are widely thought to contribute to the dismal prognosis of pancreatic ductal adenocarcinoma (PDAC). CSCs share biological features with adult stem cells, such as longevity, self-renewal capacity, differentiation, drug resistance, and the requirement for a niche; these features play a decisive role in cancer progression. A prominent characteristic of PDAC is metabolic reprogramming, which provides sufficient nutrients to support rapid tumor cell growth. However, whether PDAC stemness is correlated with metabolic reprogramming remains unknown.MethodRNA sequencing data of PDAC, including read counts and fragments per kilobase of transcript per million mapped reads (FPKM), were collected from The Cancer Genome Atlas-Pancreatic Adenocarcinoma (TCGA-PAAD) database. Single-sample gene set enrichment analysis (GSEA) was used to calculate the relative activities of metabolic pathways in each PDAC sample. Quantitative real-time PCR was performed to validate the expression levels of genes of interest.ResultsThe overall survival (OS) of patients with high mRNA expression-based stemness index (mRNAsi) values was significantly worse than that of their counterparts with low mRNAsi values (P = 0.003). This survival disadvantage was independent of baseline clinical characteristics. Gene ontology (GO) analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and GSEA showed that the differentially expressed genes between patients with high and low mRNAsi values were mainly enriched in oncogenic and metabolic pathways. Weighted gene coexpression network analysis (WGCNA) revealed 8 independent gene modules that were significantly associated with mRNAsi and 12 metabolic pathways. Unsupervised clustering based on the key genes in each module identified two PDAC subgroups characterized by different mRNAsi values and metabolic activities. Univariate Cox regression analysis identified 14 genes beneficial to OS from 95 key genes selected from the eight independent gene modules from WGCNA. Among them, MAGEH1, MAP3K3, and PODN were downregulated in both pancreatic tissues and cell lines.ConclusionThe present study showed that PDAC samples with high mRNAsi values exhibited aberrant activation of multiple metabolic pathways, and the patients from whom these samples were obtained had a poor prognosis. Future studies are expected to investigate the underlying mechanism based on the crosstalk between PDAC stemness and metabolic rewiring.

ObjectiveImmune infiltration plays an important role in tumor development and progression and shows promising prognostic value in numerous tumors. In this study, we aimed to identify the role of immune infiltration in pancreatic neuroendocrine tumors (Pan-NETs) and to establish an Immunoscore system to improve the prediction of postsurgical recurrence-free survival.MethodsTo derive transcriptional signatures and deconvolute specific immune populations, two GEO datasets containing 158 Pan-NET patients were reanalyzed to summarize the immune infiltration landscape and identify immune-related signatures. Using real-time reverse transcription-polymerase chain reaction, immunofluorescence and immunochemistry methods, candidate signatures were further detected. The least absolute shrinkage and selection operator (LASSO) logistic regression model used statistically significant survival predicators in the training cohort (n=125) to build an Immunoscore system. The prognostic and predictive accuracy was validated in an external independent cohort of 77 patients.ResultsThe immune infiltration profile in Pan-NETs showed significant heterogeneity, among which accumulated immune cells, T lymphocytes and macrophages were predominant. Fourteen statistically significant immune-related signatures were further identified in the screening cohort. The Immunoscore system for Pan-NETs (ISpnet) consisting of six immune features (CCL19, IL-16, CD163, IRF4, CD8PT and CD8IT) was constructed to classify patients as high and low risk in the training cohort (cutoff value = 2.14). Low-risk patients demonstrated longer 5-year recurrence-free survival (HR, 0.061; 95% CI, 0.026 to 0.14; p < 0.0001), with fewer recurrences and better prognoses. To predict the individual risk of recurrence, a nomogram incorporating both immune signatures and clinicopathological characteristics was developed.ConclusionOur model, ISpnet, captures immune feature-associated prognostic indicators in Pan-NETs and represents the first immune feature-based score for the postsurgical prognostic prediction. The nomogram based on the ISpnet and independent clinical risk factors might facilitate decision-making regarding early recurrence risk monitoring, identify high-risk patients in need of adjuvant therapy, and provide auxiliary guidance for patients with Pan-NETs that may benefit from immunotherapy in clinical trials.

Background: The treatment modalities for pancreatic ductal adenocarcinoma (PDAC) are limited and unsatisfactory. Although many novel drugs targeting the tumor microenvironment, such as immune checkpoint inhibitors, have shown promising efficacy for some tumors, few of them significantly prolong the survival of patients with PDAC due to insufficient knowledge on the tumor microenvironment.Methods: A single-cell RNA sequencing (scRNA-seq) dataset and seven PDAC cohorts with complete clinical and bulk sequencing data were collected for bioinformatics analysis. The relative proportions of each cell type were estimated using the gene set variation analysis (GSVA) algorithm based on the signatures identified by scRNA-seq or previous literature.Results: A meta-analysis of 883 PDAC patients showed that neutrophils are associated with worse overall survival (OS) for PDAC, while CD8+ T cells, CD4+ T cells, and B cells are related to prolonged OS for PDAC, with marginal statistical significance. Seventeen cell categories were identified by clustering analysis based on single-cell sequencing. Among them, CD8+ T cells and NKT cells were universally exhausted by expressing exhaustion-associated molecular markers. Interestingly, signatures of CD8+ T cells and NKT cells predicted prolonged OS for PDAC only in the presence of “targets” for pyroptosis and ferroptosis induction. Moreover, a specific state of T cells with overexpression of ribosome-related proteins was associated with a good prognosis. In addition, the hematopoietic stem cell (HSC)-like signature predicted prolonged OS in PDAC. Weighted gene co-expression network analysis identified 5 hub genes whose downregulation may mediate the observed survival benefits of the HSC-like signature. Moreover, trajectory analysis revealed that myeloid cells evolutionarily consisted of 7 states, and antigen-presenting molecules and complement-associated genes were lost along the pseudotime flow. Consensus clustering based on the differentially expressed genes between two states harboring the longest pseudotime span identified two PDAC groups with prognostic differences, and more infiltrated immune cells and activated immune signatures may account for the survival benefits.Conclusion: This study systematically investigated the prognostic implications of the components of the PDAC tumor microenvironment by integrating single-cell sequencing and bulk sequencing, and future studies are expected to develop novel targeted agents for PDAC treatment.

PurposeHypodensity of pancreatic ductal adenocarcinoma (PDAC) during contrast-enhanced computed tomography (CECT) examination is common, but a minority of PDAC patients exhibit hyperdense images. The present study examined the clinical characteristics and protein landscape of PDAC with hyperdensity.Materials and MethodsA total of 844 pathologically confirmed PDAC patients who underwent CECT before surgery were included. During the parenchymal phase of CECT, patients were assigned to the hyperdense or hypodense group based on CT values. Clinical and CT characteristics for predicting relapse-free survival (RFS) and overall survival (OS) were analyzed using the Kaplan–Meier method and Cox proportional hazards model. The expression of the tumor angiogenesis marker CD31 and stroma-related protein CTHRC1 were analyzed using immunohistochemistry (IHC) assay to evaluate differences between the two groups. Proteomics was performed to compare the possible mechanisms underlying the differential enhancement on CT scans.ResultsBased on CECT, 43 and 801 PDAC patients had hyperdense and hypodense lesions, respectively. All 43 patients presented a hyperdense lesion in the parenchymal phase. The mean CECT values of the hyperdense group were higher than the hypodense group (102.5 ± 17.4 and 53.7 ± 18.7, respectively, P< 0.001). The hyperdense group had a better prognosis than the hypodense group (median RFS, 19.97 vs. 12.34 months, P = 0.0176; median OS, 33.6 vs. 20.3 months, P = 0.047). Multivariate analysis showed that age, higher CA19-9 levels (> 300 U/ml), tumor stage, tumor differentiation, tumor CT density, and adjuvant chemotherapy were significant independent prognostic factors for OS. CD31 immunohistochemical staining showed that the hyperdense PDACs had a higher microvessel density than the hypodense group (P< 0.001). CTHRC1 expression was higher in the hypodense group (P = 0.019). Sixty-eight differentially expressed proteins were found using the tandem mass tag labeling-based quantification of the proteomes of PDAC tissue samples, and 7 proteins (POFUT1, PKP2, P0DOX4, ITPR1, HBG2, IGLC3, SAA2) were related to angiogenesis.ConclusionPatients who presented with a hyperdense mass on CECT had a higher microvessel density and better prognosis. Anti-angiogenic therapy may be suitable for these patients.

Background: Apoptosis is associated with the pathogenesis of Mycobacterium tuberculosis infection. This study aims to identify apoptosis-related genes as biomarkers for differentiating active tuberculosis (ATB) from latent tuberculosis infection (LTBI). Methods: The tuberculosis (TB) datasets (GSE19491, GSE62525, and GSE28623) were downloaded from the Gene Expression Omnibus (GEO) database. The diagnostic biomarkers differentiating ATB from LTBI were identified by combining the data of protein-protein interaction network, differentially expressed gene, Weighted Gene Co-Expression Network Analysis (WGCNA), and receiver operating characteristic (ROC) analyses. Machine learning algorithms were employed to validate the diagnostic ability of the biomarkers. Enrichment analysis for biomarkers was established, and potential drugs were predicted. The association between biomarkers and N6-methyladenosine (m6A) or 5-methylated cytosine (m5C) regulators was evaluated. Results: Six biomarkers including CASP1, TNFSF10, CASP4, CASP5, IFI16, and ATF3 were obtained for differentiating ATB from LTBI. They showed strong diagnostic performances, with area under ROC (AUC) values > 0.7. Enrichment analysis demonstrated that the biomarkers were involved in immune and inflammation responses. Furthermore, 24 drugs, including progesterone and emricasan, were predicted. The correlation analysis revealed that biomarkers were positively correlated with most m6A or m5C regulators. Conclusion: The six ARGs can serve as effective biomarkers differentiating ATB from LTBI and provide insight into the pathogenesis of Mycobacterium tuberculosis infection. [ABSTRACT FROM AUTHOR]

Introduction: Traumatic brain injury (TBI) seriously affects the quality of human health and the prognosis of the patient, but the epidemiological characteristics of TBI can vary among populations. Numerous changes have occurred in the epidemiological characteristics of individuals with TBI in the fast-paced city of Shenzhen, China. However, little is known about these characteristics. This study aimed to investigate the changes in TBI epidemiology, help clinicians improve medical treatment. Methods: In this retrospective cross-sectional analysis, we collected the data of 4,229 patients with TBI admitted to 20 hospitals in Shenzhen in 2017. We collected data on age, gender, cause and severity of the injury, eventual diagnosis, time from injury to admission in a neurosurgery department, and patient outcomes. Two neurosurgeons simultaneously collected the data. We compared these results with a similar study conducted in Shenzhen during the period from 1994 to 2003 to clarify and explain the changes in the epidemiological characteristics of TBI. Results: The majority of respondents were men [2,830 (66.9%)]. The mean age was 32.5  ±  21.4  years. The youngest patient was less than 1  year old, and the oldest patient was 101  years old. A total of 3,947 (93.3%) patients had a favorable outcome, 219 (5.2%) had an unfavorable outcome, and 63 (1.5%) died. The predominant external cause was falls (1,779 [42.1%]); this was the most common cause of TBI in children and older adults. Riders of electric bicycles (423 [29.0%]) were the most vulnerable to traffic accident-related injuries. Time greater than 50  h from injury to admission to a neurosurgical department had a significant effect on prognosis (p  <  0.001). Conclusion: The epidemiological characteristics of TBI have changed significantly over the past 20  years. Falls, rather than traffic accidents, were the most common cause of TBI. Further research is needed to devise solutions to decrease the incidence of falls and improve the outcomes of TBI. [ABSTRACT FROM AUTHOR]

Foodborne diseases are caused by food contaminated by pathogenic bacteria such as Escherichia coli, Salmonella, Staphylococcus aureus, Listeria monocytogenes, Campylobacter, and Clostridium, a critical threat to human health. As a novel antibacterial agent against foodborne pathogens, endolysins are peptidoglycan hydrolases encoded by bacteriophages that lyse bacterial cells by targeting their cell wall, notably in Gram-positive bacteria due to their naturally exposed peptidoglycan layer. These lytic enzymes have gained scientists' interest in recent years due to their selectivity, mode of action, engineering potential, and lack of resistance mechanisms. The use of endolysins for food safety has undergone significant improvements, which are summarized and discussed in this review. Endolysins can remove bacterial biofilms of foodborne pathogens and their cell wall-binding domain can be employed as a tool for quick detection of foodborne pathogens. We explained the applications of endolysin for eliminating pathogenic bacteria in livestock and various food matrices, as well as the limitations and challenges in use as a dietary supplement. We also highlight the novel techniques of the development of engineering endolysin for targeting Gram-negative bacterial pathogens. In conclusion, endolysin is safe and effective against foodborne pathogens and has no adverse effect on human cells and beneficial microbiota. As a result, endolysin could be employed as a functional bio-preservative agent to improve food stability and safety and maintain the natural taste of food quality. [ABSTRACT FROM AUTHOR]

Angioimmunoblastic T-cell lymphoma (AITL) is an aggressive subtype of peripheral T-cell lymphoma (PTCL) characterized by its T-follicular helper (TFH) phenotype. Relapsed and refractory disease is common in AITL and often associated with a poor prognosis. The presence of epigenetic abnormalities, immune dysregulation, hyperinflammation and active angiogenesis in AITL offers potential targets for histone deacetylase (HDAC) inhibitors and immunomodulatory drugs (IMiDs). Herein, we present a case of AITL with multiple relapses over a decade. Following intensive chemotherapy and autologous stem cell transplantation (ASCT), the patient relapsed with extensive nodal and extranodal involvement, particularly pulmonary lesions, and subsequently pursued chemo-free treatments. Initially, the patient exhibited a remarkable response to single-agent chidamide, the first oral HDAC inhibitor. Soon after developing resistance to chidamide, continuous treatment with lenalidomide led to an impressive sustained complete remission lasting 64 months, followed by a diminished response for an additional 11 months. Genetic profiling of the patient revealed mutations in KMT2D and ARID1A, along with chromosomal aberrations such as del(5q). Notably, genes commonly mutated in AITL, including RHOA, TET2, DNMT3A, and IDH2, were absent in this case. A review of the literature highlights the heterogeneous genomic landscape of AITL and the diversity of treatment options available, underscoring the importance of tailored approaches to overcome resistance and improve outcomes in this distinct lymphoma subtype.

SummaryIn the development of diabetic retinopathy (DR), neutrophil infiltration hastens the adhesion between neutrophils and endothelial cells, leading to inflammation. Meanwhile, neutrophil extracellular traps (NETs) produced by neutrophils could clear aging blood vessels, setting the stage for retinal vascular regeneration. To explore the mechanism of NETs-related genes in DR, the transcriptome of NETs from normal and DR individuals were analyzed with gene sequencing and mendelian randomization (MR) analysis. Five NETs-related genes were identified as key genes. Among these genes, CLIC3, GBP2, and P2RY12 were found to be risk factors for Proliferative DR(PDR), whereas HOXA1 and PSAP were protective factors. Further verification by qRT-PCR recognized GBP2, P2RY12 and PSAP as NETs-associated biomarkers in PDR.PurposeTo investigate neutrophil extracellular traps (NETs) related genes as biomarkers in the progression of diabetic retinopathy (DR).MethodsWe collected whole blood samples from 10 individuals with DR and 10 normal controls (NCs) for transcriptome sequencing. Following quality control and preprocessing of the sequencing data, differential expression analysis was conducted to identify differentially expressed genes (DEGs) between the DR and NC groups. Candidate genes were then selected by intersecting these DEGs with key module genes identified through weighted gene co-expression network analysis. These candidate genes were subjected to mendelian randomization (MR) analysis, then least absolute shrinkage and selection operator analysis to pinpoint key genes. The diagnostic utility of these key genes was evaluated using receiver operating characteristic curve analysis, and their expression levels were examined. Additional analysis, including nomogram construction, gene set enrichment analysis, drug prediction and molecular docking, were performed to investigate the functions and molecular mechanisms of the key genes. Finally, the expression of key genes was verified by qRT-PCR and biomarkers were identified.ResultsIntersection of 1,004 DEGs with 1,038 key module genes yielded 291 candidate genes. Five key genes were identified: HOXA1, GBP2, P2RY12, CLIC3 and PSAP. Among them, CLIC3, GBP2, and P2RY12 were identified as risk factors for DR, while HOXA1 and PSAP were protective. These key genes demonstrated strong diagnostic performance for DR. With the exception of P2RY12, all other key genes exhibited down-regulation in the DR group. Furthermore, the nomogram incorporating multiple key genes demonstrated superior predictive capacity for DR compared to a single key genes. The identified key genes are involved in oxidative phosphorylation and ribosome functions. Drug predictions targeting P2RY12 suggested prasugrel, ticagrelor, and ticlopidine as potential options owing to their high binding affinity with this key genes. The qRT-PCR results revealed that the results of GBP2, PSAP and P2RY12 exhibited consistent expression patterns with the dataset.ConclusionThis study identified GBP2, P2RY12 and PSAP as NETs-associated biomarkers in the development of PDR, offering new insights for clinical diagnosis and potential treatment strategies for DR.

Since Artificial ground Freezing (AGF) appeared in the 1880s in the mining sector in Europe, it has been used for various construction applications worldwide. In recent years, it has been increasingly popular in urban projects due to its versatility and applicability to complicated site conditions. So far, it has been used to stabilize substrata to nearly 1,000 m below the ground surface, which is considered not possible for many other ground improvement technologies. Due to the growth in field applications, the practice and theories related to AGF have become more mature in the most recent two decades. The improvement in understanding of this topic is a result of lessons that have been learned through numerous projects, as well as a variety of comprehensive studies that have been completed. This paper reviews the existing practice, the recent development on AGF and the challenges of AGF.

Carcinoembryonic antigen (CEA) and calcitonin (Ctn) are pivotal biomarkers in the diagnosis and management of medullary thyroid carcinoma (MTC). However, their diagnostic reliability in perioperative period remains a topic of ongoing debate. This review synthesizes researches on perioperative fluctuations in CEA and Ctn levels, and evaluates the impact of their different combinations on MTC diagnosis, treatment decisions, and prognosis. Our findings highlight it is crucial to understand and interpret the various combinations of CEA and Ctn fluctuations within a clinical context. Furthermore, to reduce diagnostic errors and improve patient outcomes, we recommend follow-up diagnostic and treatment protocols designed to address the potential pitfalls associated with the use of these biomarkers.

Continuous cropping of the same crop leads to soil degradation and a decline in crop production, and these impacts could be mitigated through rotation cropping. Although crop rotation enhances soil fertility, microbial community diversity, and potato yield, its effects on the soil ecosystem multifunctionality (EMF) remain unclear. In the present research, we comparatively examined the effects of potato continuous cropping (PP) and rotation cropping [potato–oat rotation (PO) and potato–forage maize rotation (PFM)] on the soil EMF as well as the roles of keystone taxa, microbes abundance, and chemical properties in EMF improvement. It was demonstrated that soil EMF is increased in rotation cropping (PO and PFM) than PP. Soil pH was higher in rotation cropping (PO and PFM) than in PP, while total phosphorus (TP) and available phosphorus (AP) were significantly decreased than that in PP. Rotation cropping (PO and PFM) markedly changed the bacterial and fungal community compositions, and improved the potential plant-beneficial fungi, e.g., Schizothecium and Chaetomium, while reducing the abundances of the potentially phytopathogenic fungi, e.g., Alternaria, Fusarium, Verticillium dahiae, Gibberella, Plectosphaerella, Colletotrichum, Phoma, and Lectera in comparison with PP. Also, co-occurrence patterns for bacteria and fungi were impacted by crop rotation, and keystone taxa, e.g., Nitrospira.1, Lysinibacillus, Microlunatus.1, Sphingomonas.3, Bryobacter.1, Micromonospora, and Schizothecium, were enriched in PO and PFM than PP. The structural equation model (SEM) further demonstrated that cropping systems increased soil ecosystem multifunctionality through regulating SOM and keystone taxa (Schizothecium1), and keystone taxa were mediated by soil pH. This study suggested that rotation cropping might contribute to the improvement of soil ecosystem multifunctionality as well as the development of disease-suppressive soils in comparison with potato continuous cropping. [ABSTRACT FROM AUTHOR]

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.

BackgroundIron deficiency and iron deficiency anemia cause a huge disease burden worldwide. Diet is an important factor affecting the iron levels. This study aims to explore the dietary patterns of school-aged children in rural areas of Guangzhou and their association with iron deficiency.MethodsData on dietary surveys, lifestyle, demographic and laboratory tests were gathered from rural school-age children in Guangzhou. Factor analysis was applied to derive dietary patterns. Robust Poisson regression and subgroup analysis were used to analyze the association between dietary patterns and iron deficiency.ResultsA total of 2,530 children and adolescents aged 9–17 years were enrolled. The prevalence of iron deficiency was 13.36%. Four dietary patterns were identified including snack and fast-food pattern, fruit and vegetable pattern, cereal and tuber pattern and meat and offal pattern. Both children and adolescents in the Q4 group (the highest propensity) of snack and fast-food pattern and cereal and tuber pattern had a higher risk of iron deficiency than the Q1 group (the lowest propensity). Both children and adolescents in the Q4 group of meat and offal pattern and fruit and vegetable pattern had a lower risk of iron deficiency than the Q1 group. The results of stratified analysis showed the negative effect of snack and fast-food pattern and the protective benefits of meat and offal pattern are more obvious for boys, and the negative effect of cereal and tuber pattern were obvious for girls. The negative effect or protective benefits of the four dietary patterns were obvious for children aged 9–13.ConclusionFemales, older children, and those with shorter sleep duration are at higher risk of iron deficiency. Snack and fast-food pattern and cereal and tuber pattern are risk factors for iron deficiency, and fruit and vegetable pattern and meat and offal pattern are protective factors for iron deficiency. The impact of diet on body iron levels is more obvious in boys and younger children. The findings of this study can provide evidence for formulating prevention and control measures on children and adolescents iron deficiency and iron deficiency anemia.

BackgroundDuck enteritis virus (DEV) belongs to Alphaherpesvirinae; little is known about the DEV UL7 gene and its encoded protein. This study examined the molecular characteristics of DEV pUL7 in vitro and determined whether DEV pUL7 co-localizes with pUL51.ResultsThe results showed that UL7 can be regarded as a late gene. Moreover, immunofluorescence assay revealed that pUL7 was located around the perinuclear cytoplasmic region and co-localized with pUL51 in the cytoplasm and nucleus after transfection into duck embryo fibroblast cells (DEFs).ConclusionIn conclusion, we identified the molecular characteristics of the DEV UL7 gene, which is a late gene, and the co-localization of its encoded protein with pUL51 in transfected DEFs, enriching our understanding of pUL7 and future research directions.

ObjectiveIn the past, the localization of seizure onset zone (SOZ) primarily relied on traditional EEG signal analysis methods. However, due to their limited spatial and temporal resolution, accurately pinpointing neural activity was challenging, thereby restricting their clinical applicability. Compared with traditional EEG signals, SEEG signals have superior spatial and temporal resolution, and can more accurately record neural activity near epileptic foci, making them better suited for studying SOZ. In addition, the traditional EEG signal analysis methods still have limitations, mainly focusing on the analysis of local signal features, while ignoring the complexity and interconnection of the overall brain network. How to more accurately locate SOZ is still not well resolved. The purpose of this study is to develop an effective positioning method for more accurate positioning.MethodTo overcome these limitations, this study proposed a model integrating brain functional network analysis with nonlinear dynamics. We utilized weighted phase lag index (WPLI) to construct brain functional network, epilepic network connectivity strength (ENCS) as the feature, and introduced persistence entropy (PE) for feature fusion, subsequently employing support vector machine (SVM) classification.ResultsThe proposed method was verified on the HUP-iEEG dataset, our solution identified the SOZ with 0.9440 accuracy, 0.9848 precision, 0.8974 recall rate, 0.9340 F1 score and 0.9697 area under the ROC curve across patients, which outperforms the existing approaches. It exhibits a 2.30 percentage point enhancement in localisation accuracy along with a 2.97 percentage points in AUC compared to others.ConclusionOur method consider the interactions between nodes in brain network connections, as well as the inherent nonlinear and non-stationary properties of neural signals, to be more robust.

This review delves into the profound implications of flooding events on buried infrastructures, specifically pipelines, tunnels, and culverts. While these buried infrastructures are vital for community resilience, their susceptibility to damage from flooding, storm surges, and hurricanes poses significant challenges. Unlike the obvious impact on above-ground structures, the effects of flooding on buried infrastructures, being out of sight, are not quickly and easily observable. This review aims to 1) review the state-of-the-art research on the flooding effects on buried structures and summarize causes of failures of buried infrastructures induced by flooding; 2) identify the research gaps on this topic to motivate in-depth investigations; and 3) discuss the future research directions. This review sheds light on how factors contributing to the vulnerability of buried infrastructures are multifaceted and can vary based on the specific characteristics of the infrastructure, the local environment, and the nature of the flood event. Despite the availability of many articles on the topic, this review also highlights a lack of methodologies to assess flooding damage and its impact on the serviceability of buried infrastructures. We suggested three future research directions to bridge this research gap including investigating and distinguishing key factors to quantify flooding damage to buried infrastructures, developing advanced modeling techniques, and exploring the integration of smart technologies in health monitoring of buried infrastructures.

This study investigated whether exercise could improve the reduced HRV in an environment of high altitude. A total of 97 young, healthy male lowlanders living at 3,680 m for >1 year were recruited. They were randomized into four groups, of which three performed—low-, moderate-, and high-intensity (LI, MI, HI) aerobic exercise for 4 weeks, respectively. The remaining was the control group (CG) receiving no intervention. For HI, compared to other groups, heart rate (p = 0.002) was significantly decreased, while standard deviation of RR intervals (p < 0.001), SD2 of Poincaré plot (p = 0.046) and the number of successive RR interval pairs that differ by > 50 ms divided by total number of RR (p = 0.032), were significantly increased after intervention. For MI, significantly increase of trigonometric interpolation in NN interval (p = 0.016) was observed after exercise. Further, a decrease in systolic blood pressure (SBP) after high-intensity exercise was found significantly associated with an increase in SD2 (r = – 0.428, p = 0.042). These results indicated that there was a dose effect of different intensities of aerobic exercise on the HRV of acclimatized lowlanders. Moderate and high-intensity aerobic exercise would change the status of the autonomic nervous system (ANS) and decrease the blood pressure of acclimatized lowlanders exposed to high altitude.

This study aimed to find the determinants of regional public brand development of agri-products in urban areas and to explore the specific enhancement paths for the regional public brand development of agri-products. The regional public brand of agri-products in Shanghai was selected as the research object. The study utilized stratified and random sampling techniques to collect data from 320 questionnaires of agricultural business entities in Shanghai. Then a covariance-based structural equation model with institutional factors as mediating variables was constructed. Furthermore, the study empirically analyzed the mechanism of the role of resource endowment on regional public brand development of agri-products. The study showed that the main factors affecting regional public brand development of agri-products are market maintenance, public marketing, industrial resources, and regional resources, in order of importance. Regional and industrial resources positively affected agricultural regional public brand development through the masking effect of public marketing and the partially mediating role of market maintenance. Among them, market maintenance reversed the significant negative impact of regional resources on the regional public brand development of agri-products. The findings of the study contribute to enriching the existing theoretical literature on regional public branding of agri-products, and provide practical implications for the government to help formulate and improve regional brand development policies in urban areas.

Seasonal environmental shifts and improper eating habits are the important causes of diarrhea in children and growing animals. Whether adjusting feeding time at varying temperatures can modify cecal bacterial structure and improve diarrhea remains unknown. Three batches growing rabbits with two groups per batch were raised under different feeding regimens (fed at daytime vs. nighttime) in spring, summer and winter separately, and contents were collected at six time points in 1 day and used 16S rRNA sequencing to investigate the effects of feeding regimens and season on the composition and circadian rhythms of cecum bacteria. Randomized forest regression screened 12 genera that were significantly associated with seasonal ambient temperature changes. Nighttime feeding reduced the abundance of the conditionally pathogenic bacteria Desulfovibrio and Alistipes in summer and Campylobacter in winter. And also increases the circadian rhythmic Amplicon Sequence Variants in the cecum, enhancing the rhythm of bacterial metabolic activity. This rhythmic metabolic profile of cecum bacteria may be conducive to the digestion and absorption of nutrients in the host cecum. In addition, this study has identified 9 genera that were affected by the combination of seasons and feeding time. In general, we found that seasons and feeding time and their combinations affect cecum composition and circadian rhythms, and that daytime feeding during summer and winter disrupts the balance of cecum bacteria of growing rabbits, which may adversely affect cecum health and induce diarrhea risk.

IntroductionNumerous studies suggest that the risk of tuberculosis (TB) is linked to gene polymorphisms of the interleukin-12 receptor b subunit 1 (IL12RB1), but the association between IL12RB1 polymorphisms and TB susceptibility has not been thoroughly investigated.MethodsA meta-analysis was conducted based on eight case-control studies with 10,112 individuals to further explore this topic. A systematic search of PubMed, Web of Science, Excerpt Medica Database, and Google Scholar up until April 6th, 2023 was performed. ORs and 95% CIs were pooled using the random-effect model. The epidemiological credibility of all significant associations was assessed using the Venice criteria and false-positive report probability (FPRP) analyses.ResultsThe IL12RB1 rs11575934 and rs401502 showed solid evidence of no significant association with TB susceptibility. However, a weak association was observed between the IL12RB1 rs375947 biomarker and pulmonary tuberculosis (PTB) susceptibility (OR = 1.64, 95% CI: 1.22, 2.21).DiscussionThese findings should be confirmed through larger, better-designed studies to clarify the relationship between biomarkers in IL12RB1 gene and different types of TB susceptibility.

Recent reports have shown that wild crabs may be important hosts involved in the transmission and spread of the parasitic Hematodinium in cultured marine crustaceans. Therefore, monitoring the prevalence of Hematodinium infections in wild crabs is necessary to develop effective strategies for the prevention and control of Hematodinium disease. Here we report a wild crab species, Macrophthalmus (Macrophthalmus) abbreviatus Manning & Holthuis, 1981, as a new natural host for Hematodinium sp. infection. It is one of the common wild crab species dwelling in the ponds or waterways connected to the polyculture ponds located on the coast of Rizhao or Weifang, Shandong Peninsula, China. According to the results of PCR detection and phylogenetic analysis targeting the internal transcribed spacer 1 (ITS 1) region, these Hematodinium sp. isolates were identified as H. perezi and fell into the genotype II category within H. perezi. A high monthly prevalence of H. perezi infection was observed during the 2021–2022 field survey, ranging from 33.3% to 90.6% in M. abbreviatus originating from Weifang (n=304 wild crabs) and from 53.6% to 92.9% in those from Rizhao (n=42 wild crabs). Artificial inoculation infection experiments demonstrated that M. abbreviatus could be infected by H. perezi, and massive Hematodinium cells and typical histopathological changes were observed in the hepatopancreas and gill tissues of the infected crabs. To our knowledge, this is the first report of M. abbreviatus as a new natural host for H. perezi infection. Results in the present study extend the known host spectrum for this emerging parasite pathogen, and also provide valuable information for epidemic surveillance of the Hematodinium disease as well.

Intravesical Bacillus Calmette-Guerin (BCG) is an effective immunotherapy for non-muscle invasive bladder cancer (NMIBC). However, recurrence and progression remain frequent warranting deeper insights into its mechanism. We herein comprehensively profiled blood and tissues obtained from NMIBC patients before, during and after BCG treatment using cytometry by time-of-flight (CyTOF) and RNA sequencing to identify the key immune subsets crucial for anti-tumor activity. We observed the temporal changes of peripheral immune subsets including NKT cells, central memory CD4+ T cells, CD8+ T cells and regulatory T cells (Treg) during the course of BCG. Gene expression analysis revealed enriched immune pathways involving in T cell activation and chemotaxis, as well as a more diversified T cell receptor repertoire in post-BCG tissues. Moreover, tissue multiplexed-immunofluorescence (mIF) showed baseline densities of non-Treg and CD8+PD-1+ T cells were predictive of response and better recurrence-free survival after BCG. Remarkably, post-BCG tissues from responders were found to be infiltrated with more active CD8+PD-1- T cells and non-Treg CD4+FOXP3- T cells; but increased exhausted CD8+PD-1+ T cells were found in non-responders. Taken together, we identified predictive biomarkers for response and uncovered the post-treatment expansion of exhausted PD-1+CD8+ T cells as key to BCG resistance, which could potentially be restored by combining with anti-PD-1 immunotherapy. [ABSTRACT FROM AUTHOR]

The fundamental means of addressing the challenges concerning China’s agricultural resources and environment is to achieve green and high-quality development within the agricultural sector. In this study, we measured the level of green high-quality agricultural development (GHQAD) in China from 2003 to 2020, and used Theil index, Moran’s I and Geographic detector to reveal the evolution trend and driving factors of GHQAD in China. The results show that the development level of GHQAD in China is constantly improving while the spatial difference is decreasing, and the primary contributor to this overall variation is the intra-regional variation. The spatial distribution of GHQAD in China was positively correlated, with high concentration in eastern and central regions, and low concentration in western regions. Notably, topographic relief degree and urbanization level are the key driving factors contributing to the spatial differences in GHQAD across China. The insights gained from this study will be particularly valuable for the government decision-making processes, thereby elevating GHQAD development in China and ultimately achieving coordinated development within the agricultural sector.

Background and objective: An interaction between low-density lipoprotein level, lipid-lowering drugs, and systemic lupus erythematosus (SLE) was reported by previous studies. However, whether lipid-lowering drugs provided protective effect for reducing the risk of SLE was unclear. We aimed to clarify this causal relationship through a drug-target Mendelian randomization (MR) study.Methods: Genetic instruments—single nucleotide polymorphism (SNPs)—were utilized to proxy inhibition of the three genes—3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), proprotein convertase subtilisin/kexin type 9 (PCSK9), and Niemann-Pick C1-Like 1(NPC1L1), which was corresponded to three lipid-lowering drugs—statins, evolocumab, and ezetimibe. Low-density lipoprotein (LDL) cholesterol was selected as the biomarker for the measurement of the inhibitors of HMGCR, PCSK9, and NPC1L1, and the genetic data were acquired from the Global Lipids Genetics Consortium, which consisted of 1.3 million participants of European ancestry and 146.5 thousand participants of East Asian ancestry. The genetic dataset of SLE was acquired from two large-scale GWAS studies; one recruited 23,210 participants (7,219 SLE cases and 15,991 controls) of European ancestry and the other one recruited 12,653 participants (4,222 SLE cases and 8,431 controls) of Chinese ancestry. The primary analysis used the inverse variance weighted (IVW) method. Four additional sensitivity analyses, colocalization analysis, and stratification analysis were performed.Results: The primary analysis showed that inhibition of PCSK9 (evolocumab) was associated with a significantly lower risk of SLE [odds ratio (OR) 0.51, 95%CI 0.34 to 0.76, p = 0.001] in the European population. The secondary analyses had similar findings. Stratification analysis demonstrated that the preventive effect of PCSK9 inhibition for SLE was similar in both males and females. However, the results were not replicated in the East Asian population. The inhibition of HMGCR (statins) and NPC1L1 (ezetimibe) did not cause a lower risk of SLE.Conclusion: Evolocumab might provide a protective effect on the risk of SLE in the European population, but statins and ezetimibe might not have the protective effect. Further research is necessary to elucidate the specific mechanisms and potential therapeutic applications of PCSK9 inhibitors (evolocumab) in the context of SLE protection.

Since the first 70 years of reporting cancer chemotherapy, malignant tumors have been the second most common cause of death in children and adults. Currently, the commonly used anti-cancer methods include surgery, chemotherapy, radiotherapy, and immunotherapy. Although these treatment methods could alleviate cancer, they lead to different forms of side effects and have no particularly significant effect on prolonging the patients’ life span. Glycyrrhizic acid (GL), a native Chinese herbal extract, has a wide range of pharmacological effects, such as anti-cancer, anti-inflammatory, antioxidant, and immune regulation. In this review, the anti-cancer effects and mechanisms of GL are summarized in various cancers. The inhibition of GL on chemotherapy-induced side effects, including hepatotoxicity, nephrotoxicity, genotoxicity, neurotoxicity and pulmonary toxicity, is highlighted. Therefore, GL may be a promising and ideal drug for cancer therapy.

BackgroundPregnant women with gestational diabetes mellitus (GDM) require more analgesics after cesarean delivery than those who do not have GDM. Uncontrolled pain following cesarean delivery is a major problem in women with GDM. We investigate the efficacy of low-dose esketamine combined with sufentanil intravenous patient-controlled analgesia (PCA)for postcesarean analgesia in women with GDM.MethodsOne hundred forty pregnant women with GDM were enrolled participate in this randomized controlled trial and were randomized into two groups (70 in each group). The esketamine (S) group was given esketamine +sufentanil + ondansetron, and the control (C) group was given sufentanil +ondansetron. The primary outcome is sufentanil consumption at 24 hours postoperatively, the secondary outcomes are sufentanil consumption at 6 hours postoperatively, pain scores at 6, 24 and 48 hours postoperatively.ResultsCompared with group C, group S had significantly lower sufentanil consumption at 6 and 24 hours postoperatively (P= 0.049 and P0.05). The time to first lactation was not significantly different between the two groups (P>0.05). There was no significant difference in neonatal neurobehavioral scores between the two groups (P>0.05).ConclusionCompared to sufentanil PCA, adding low dose of esketamine significantly reduced the consumption of sufentanil while providing equally effective post cesarean analgesia in the patients with gestational diabetes.

BackgroundThe amplitude of low-frequency fluctuation (ALFF) is a measure of spontaneous brain activity derived from resting-state functional magnetic resonance imaging (rs-fMRI). Previous research has suggested that abnormal ALFF values may be associated with major depressive disorder (MDD) and suicide attempts in adolescents. In this study, our aim was to investigate the differences in ALFF values between adolescent MDD patients with and without a history of suicide attempts, and to explore the potential utility of ALFF as a neuroimaging biomarker for aiding in the diagnosis and prediction of suicide attempts in this population.MethodsThe study included 34 adolescent depression patients with suicide attempts (SU group), 43 depression patients without suicide attempts (NSU group), and 36 healthy controls (HC group). Depression was diagnosed using a threshold score greater than 17 on the Hamilton Depression Rating Scale (HDRS). The rs-fMRI was employed to calculate zALFF values and compare differences among the groups. Associations between zALFF values in specific brain regions and clinical variables such as emotion regulation difficulties were explored using Pearson partial correlation analysis. Receiver-Operating Characteristics (ROC) analysis assessed the ability of mean zALFF values to differentiate between SU and NSU groups.ResultsSignificant differences in zALFF values were observed in the left and right inferior temporal gyrus (l-ITG, r-ITG) and right fusiform gyrus (r-FG) among the three groups (GRF corrected). Both SU and NSU groups exhibited increased zALFF values in the inferior temporal gyrus compared to the HC group. Furthermore, the SU group showed significantly higher zALFF values in the l-ITG and r-FG compared to both the NSU group and the HC group. Partial correlation analysis revealed a negative correlation between zALFF values in the left superior and middle frontal gyrus (l-SFG, l-MFG) and the degree of emotional dysregulation in the SU group (R = −0.496, p = 0.003; R = −0.484, p = 0.005). Combining zALFF values from the l-ITG and r-FG achieved successful discrimination between depressed adolescents with and without suicide attempts (AUC = 0.855) with high sensitivity (86%) and specificity (71%).ConclusionDepressed adolescents with suicidal behavior exhibit unique neural activity patterns in the inferior temporal gyrus and fusiform gyrus. These findings highlight the potential utility of these specific brain regions as biomarkers for identifying suicide risk in depressed adolescents. Furthermore, associations between emotion dysregulation and activity in their frontal gyrus regions were observed. These findings provide preliminary yet pertinent insights into the pathophysiology of suicide in depressed adolescents.

The incidence of gastric cancer is increasing year by year. Most gastric cancers are already in the advanced stage with poor prognosis when diagnosed, which means the current treatment is not satisfactory. Angiogenesis is an important link in the occurrence and development of tumors, and there are multiple anti-angiogenesis targeted therapies. To comprehensively evaluate the efficacy and safety of anti-angiogenic targeted drugs alone and in combination against gastric cancer, we systematically searched and sorted out relevant literature. In this review, we summarized the efficacy and safety of Ramucirumab, Bevacizumab, Apatinib, Fruquintinib, Sorafenib, Sunitinib, Pazopanib on gastric cancer when used alone or in combination based on prospective clinical trials reported in the literature, and sorted response biomarkers. We also summarized the challenges faced by anti-angiogenesis therapy for gastric cancer and available solutions. Finally, the characteristics of the current clinical research are summarized and suggestions and prospects are raised. This review will serve as a good reference for the clinical research of anti-angiogenic targeted drugs in the treatment of gastric cancer.

Setting the pace of life and constraining the role of members in food webs, body size can affect the structure and dynamics of communities across multiple scales of biological organization (e.g., from the individual to the ecosystem). However, its effects on shaping microbial communities, as well as underlying assembly processes, remain poorly known. Here, we analyzed microbial diversity in the largest urban lake in China and disentangled the ecological processes governing microbial eukaryotes and prokaryotes using 16S and 18S amplicon sequencing. We found that pico/nano-eukaryotes (0.22−20 μm) and micro-eukaryotes (20−200 μm) showed significant differences in terms of both community composition and assembly processes even though they were characterized by similar phylotype diversity. We also found scale dependencies whereby micro-eukaryotes were strongly governed by environmental selection at the local scale and dispersal limitation at the regional scale. Interestingly, it was the micro-eukaryotes, rather than the pico/nano-eukaryotes, that shared similar distribution and community assembly patterns with the prokaryotes. This indicated that assembly processes of eukaryotes may be coupled or decoupled from prokaryotes’ assembly processes based on eukaryote cell size. While the results support the important influence of cell size, there may be other factors leading to different levels of assembly process coupling across size classes. Additional studies are needed to quantitatively parse the influence of cell size versus other factors as drivers of coordinated and divergent community assembly processes across microbial groups. Regardless of the governing mechanisms, our results show that there are clear patterns in how assembly processes are coupled across sub-communities defined by cell size. These size-structured patterns could be used to help predict shifts in microbial food webs in response to future disturbance.

ObjectiveTo observe the stability and therapeutic effect of chloroquine phosphate gel on human condylomata acuminata (CA) caused by low-risk human papillomavirus (HPV).MethodsThe appearance, viscosity, pH, chloroquine concentration, deethylchloroquine concentration and content uniformity of chloroquine phosphate gel were examined for 24 months, the gel met the quality standards throughout the 24-month observation. A nude mouse model harboring CA xenografts was used to observe the therapeutic effect of this gel on CA in vivo.ResultsAfter 14 days of gel administration, compared with the control group, the treatment group had significantly smaller warts and significantly reduced DNA copy numbers of HPV6 and HPV11 in the wart tissues. Immunohistochemistry analysis of p53 protein expression in the wart tissues of the treatment group was significantly increased.ConclusionChloroquine phosphate gel was stable and effective against CA, possibly through the promotion of p53 protein expression to induce apoptosis, leading to the involution of warts.

This study aimed to evaluate the effects of dietary bile acids on growth performance, feed utilization, body composition, digestive enzyme activity, and related gene expression in juvenile leopard coral grouper (Plectropomus leopardus). Five diets with varying levels of dietary bile acids (0, 0.15, 0.3, 0.45 and 0.6%) were formulated and each diet was fed to triplicate groups of 15 fish (13.14 ± 0.14 g) for ten weeks. Results showed that the significant enhancement in weight gain (WG) and specific growth rate (SGR) was observed in fish fed 0.3% bile acids (P < 0.05). Additionally, feed conversion ratio (FCR) was significantly improved with bile acids inclusion (P < 0.05). Higher feed intake was also recorded in bile acids inclusion groups, and significantly up-regulated gene expression of hypothalamus neuropeptide Y (NPY) was found in 0.3% group compared with the control group (P < 0.05). Dietary bile acids (0.3%) significantly decreased lipid deposition in the whole-body (P < 0.05), and lower hepatosomatic index (HSI) and viscerosomatic index (VSI) were also found in this group. Moreover, intestinal trypsin and lipase activities were significantly increased in 0.3% group (P < 0.05) to promote feed digestion. In addition, the relative expression levels of intestinal fatty acid binding protein 2 (FABP2) significantly up-regulated with inclusion of dietary bile acids, suggesting an enhancement of fatty acid transport (P < 0.05). In contrast, cholesterol transport related genes NPC1 like intracellular cholesterol transporter 1 (NPC1L1) and CD36 were notably down-regulated as bile acids inclusion (P < 0.05). This study provides valuable information for the formulation of diets for juvenile coral trout and indicates that dietary bile acids could potentially be used to improve growth performance and feed utilization.

Introduction: Metagenomic next-generation sequencing (mNGS) has been increasingly used to detect infectious organisms and is rapidly moving from research to clinical laboratories. Presently, mNGS platforms mainly include those from Illumina and the Beijing Genomics Institute (BGI). Previous studies have reported that various sequencing platforms have similar sensitivity in detecting the reference panel that mimics clinical specimens. However, whether the Illumina and BGI platforms provide the same diagnostic performance using authentic clinical samples remains unclear.Methods: In this prospective study, we compared the performance of the Illumina and BGI platforms in detecting pulmonary pathogens. Forty-six patients with suspected pulmonary infection were enrolled in the final analysis. All patients received bronchoscopy, and the specimens collected were sent for mNGS on the two different sequencing platforms.Results: The diagnostic sensitivity of the Illumina and BGI platforms was notably higher than that of conventional examination (76.9% vs. 38.5%, p < 0.001; 82.1% vs. 38.5%, p < 0.001; respectively). The sensitivity and specificity for pulmonary infection diagnosis were not significantly different between the Illumina and BGI platforms. Furthermore, the pathogenic detection rate of the two platforms were not significantly different.Conclusion: The Illumina and BGI platforms exhibited similar diagnostic performance for pulmonary infectious diseases using clinical specimens, and both are superior to conventional examinations.

BackgroundDiabetic foot ulcers (DFUs) are one of the most popular and severe complications of diabetes. The persistent non-healing of DFUs may eventually contribute to severe complications such as amputation, which presents patients with significant physical and psychological challenges. Fibroblasts are critical cells in wound healing and perform essential roles in all phases of wound healing. In diabetic foot patients, the disruption of fibroblast function exacerbates the non-healing of the wound. This study aimed to summarize the hotspots and evaluate the global research trends on fibroblast-related DFUs through bibliometric analysis.MethodsScientific publications on the study of fibroblast-related DFUs from January 1, 2000 to April 27, 2022 were retrieved from the Web of Science Core Collection (WoSCC). Biblioshiny software was primarily performed for the visual analysis of the literature, CiteSpace software and VOSviewer software were used to validate the results.ResultsA total of 479 articles on fibroblast-related DFUs were retrieved. The most published countries, institutions, journals, and authors in this field were the USA, The Chinese University of Hong Kong, Wound Repair and Regeneration, and Seung-Kyu Han. In addition, keyword co-occurrence networks, historical direct citation networks, thematic map, and the trend topics map summarize the research hotspots and trends in this field.ConclusionCurrent studies indicated that research on fibroblast-related DFUs is attracting increasing concern and have clinical implications. The cellular and molecular mechanisms of the DFU pathophysiological process, the molecular mechanisms and therapeutic targets associated with DFUs angiogenesis, and the measures to promote DFUs wound healing are three worthy research hotspots in this field.

Background: CD38 is involved in the adenosine pathway, which represents one of the immunosuppressive mechanisms in cancer. CD38 is broadly expressed across immune cell subsets, including human macrophages differentiated in vitro from monocytes, but expression by tissue-resident macrophages remains to be demonstrated. Methods: Tissue samples were obtained from 66 patients with hepatocellular carcinoma (HCC) from Singapore and analyzed using immunohistochemistry. Tumor-infiltrating leukocytes (TILs) were further examined using DEPArray™, and the phenotype of freshly isolated TILs was determined using flow cytometry. Results: CD38 was frequently co-expressed with the macrophage-specific marker CD68. CD38+CD68+ macrophage density was associated with improved prognosis after surgery, while total CD68+ macrophage density was associated with poor prognosis. DEPArray™ analysis revealed the presence of large (>10 μm), irregularly shaped CD45+CD14+ cells that resembled macrophages, with concurrent CD38+ expression. Flow cytometry also revealed that majority of CD14+HLA-DR+ cells expressed CD38. Conclusion: CD38 expression was clearly demonstrated on human macrophages in an in vivo setting. The positive association identified between CD38+ macrophage density and prognosis may have implications for routine diagnostic work. [ABSTRACT FROM AUTHOR]

The maize/cassava relay intercropping system can be a specific and efficient cropping pattern in a tropical/subtropical field. Relay intercropping systems contribute to the optimization of land use, fostering sustainable and efficient agriculture. This study entails a first-year comparative intercropping experiment using maize (Zea mays L.) and cassava (Manihot esculenta Crantz). We determined the soil nutrient contents and physicochemical properties as well as the microbial communities by high-throughput sequencing. We found that the relay intercropping system changed the bacterial community structure, especially the rhizosphere microorganisms. The bacterial community was characterized by a higher abundance of the phyla Chloroflexi, Proteobacteria, and Actinobacteria and of the genus AD3, which are related to nutrient cycling and decreased bioavailability of Cd. At the same time, the relay intercropping system reduces the relative abundance of pathogenic bacteria and biomarkers of organic pollution. The relay intercropping systems significantly boosted soil pH and available K levels in addition to the monocropping yield. The results of this study suggest that maize/cassava relay intercropping, starting from the first year, not only provides a stable supply of food and income due to the diversified cropping systems but is also beneficial for the improvement of soil quality and the soil microbial community.

Background: In recent years, tumor immunotherapy has become a viable treatment option for triple negative breast cancer (TNBC). Among these, immune checkpoint inhibitors (ICIs) have demonstrated good efficacy in advanced TNBC patients with programmed death-ligand 1 (PD-L1) positive expression. However, only 63% of PD-L1-positive individuals showed any benefit from ICIs. Therefore, finding new predictive biomarkers will aid in identifying patients who are likely to benefit from ICIs. In this study, we used liquid biopsies and next-generation sequencing (NGS) to dynamically detect changes in circulating tumor DNA (ctDNA) in the blood of patients with advanced TNBC treated with ICIs and focused on its potential predictive value.Methods: From May 2018 to October 2020, patients with advanced TNBC treated with ICIs at Shandong Cancer Hospital were included prospectively. Patient blood samples were obtained at the pretreatment baseline, first response evaluation, and disease progression timepoints. Furthermore, 457 cancer-related genes were evaluated by NGS, and patients’ ctDNA mutations, gene mutation rates, and other indicators were determined and coupled with clinical data for statistical analysis.Results: A total of 11 TNBC patients were included in this study. The overall objective response rate (ORR) was 27.3%, with a 6.1-month median progression-free survival (PFS) (95% confidence interval: 3.877–8.323 months). Of the 11 baseline blood samples, 48 mutations were found, with the most common mutation types being frame shift indels, synonymous single-nucleotide variations (SNVs), frame indel missenses, splicing, and stop gains. Additionally, univariate Cox regression analysis revealed that advanced TNBC patients with one of 12 mutant genes (CYP2D6 deletion and GNAS, BCL2L1, H3F3C, LAG3, FGF23, CCND2, SESN1, SNHG16, MYC, HLA-E, and MCL1 gain) had a shorter PFS with ICI treatment (p < 0.05). To some extent, dynamic changes of ctDNA might indicate the efficacy of ICIs.Conclusion: Our data indicate that ICI efficacy in patients with advanced TNBC may be predicted by 12 mutant ctDNA genes. Additionally, dynamic alterations in peripheral blood ctDNA might be used to track the effectiveness of ICI therapy in those with advanced TNBC.

ObjectivesThis work aimed to observe the effect of consuming Chinese herb tea on glucolipid metabolism and gut microbiota in patients with type 2 diabetes mellitus (T2DM).MethodsNinety patients with T2DM were recruited from a community and randomly divided into the control group (CG) and intervention group (IG). CG maintained conventional treatment and lifestyle, and IG accepted additional “maccog” traditional Chinese medicine (TCM) tea (mulberry leaf, radix astragali, corn stigma, cortex lycii, radix ophiopogonis, and gynostemma) for 12 weeks. Glucolipid metabolism, hepatorenal function, and gut microbiota were then measured.ResultsAfter the intervention, the decreases in fasting plasma glucose (FPG) and total cholesterol (TC) were greater (P

Based on panel data of 282 cities in China from 2005 to 2019, this paper constructs an economic resilience evaluation index system in three dimensions and applies the entropy value method to measure it. The two-stage nested Thiel index, kernel density estimation and geographic detector methods are also used to explore the characteristics of their spatial and temporal divergence and their driving factors. We find that the economic resilience of Chinese cities has increased rapidly over the sample period, but with significant spatial variation, with the intra-provincial variation being the main source of the overall variation. Without considering the spatial conditions, the economic resilience of cities has a strong stability. In the case of spatial conditions, spatial factors have a significant impact on cities with low economic resilience, but not on cities with high economic resilience. Differences in technological innovation capabilities are a key driver of spatial divergence in the economic resilience of Chinese cities. The interaction of any two factors enhances their respective effects on the spatial differentiation of economic resilience in Chinese cities. Based on the above findings, cities should actively explore targeted and differentiated ways to improve economic resilience based on their comparative advantages, accelerate the construction of a collaborative improvement mechanism for urban economic resilience, and support the collaborative improvement of urban economic resilience in China. Our findings provide a useful reference for promoting the concerted improvement of economic resilience in Chinese cities.

ObjectiveSepsis is a life-threatening condition secondary to infection that evolves into a dysregulated host response and is associated with acute organ dysfunction. Sepsis-induced cardiac dysfunction is one of the most complex organ failures to characterize. This study performed comprehensive metabolomic profiling that distinguished between septic patients with and without cardiac dysfunction.MethodPlasma samples collected from 80 septic patients were analysed by untargeted liquid chromatography-mass spectrometry (LC-MS) metabolomics. Principal component analysis (PCA), partial least squares discrimination analysis (PLS-DA), and orthogonal partial least square discriminant analysis (OPLS-DA) were applied to analyse the metabolic model between septic patients with and without cardiac dysfunction. The screening criteria for potential candidate metabolites were as follows: variable importance in the projection (VIP) >1, P < 0.05, and fold change (FC) > 1.5 or < 0.7. Pathway enrichment analysis further revealed associated metabolic pathways. In addition, we constructed a subgroup metabolic analysis between the survivors and non-survivors according to 28-day mortality in the cardiac dysfunction group.ResultsTwo metabolite markers, kynurenic acid and gluconolactone, could distinguish the cardiac dysfunction group from the normal cardiac function group. Two metabolites, kynurenic acid and galactitol, could distinguish survivors and non-survivors in the subgroup analysis. Kynurenic acid is a common differential metabolite that could be used as a candidate for both diagnosis and prognosis for septic patients with cardiac dysfunction. The main associated pathways were amino acid metabolism, glucose metabolism and bile acid metabolism.ConclusionMetabolomic technology could be a promising approach for identifying diagnostic and prognostic biomarkers of sepsis-induced cardiac dysfunction.

AimsThe distribution of residual esophageal squamous cell carcinoma (ESCC) in the esophageal wall and resected lymph nodes was evaluated after neoadjuvant chemoimmunotherapy (nICT).Methods and resultsClinical data were collected from 137 ESCC patients who underwent anti-programmed death 1 therapy and esophagectomy. Ninety (65.7%) achieved an major pathological response (MPR) in the esophageal wall, and 27 (19.7%) achieved an MPR in the lymph nodes. Pathologically complete response (pCR, ypT0N0) was observed in 26 patients (19%). Residual tumors located in the mucosa and/or submucosa were found in 94.6% of nonpCR patients. In the minor responders, 97.8% had residual tumor >10% in the mucosa or submucosa. A preferential regression direction toward the lumen was found in 76.4% of prepT2 nonpCR patients, or 60.7% of prepT3-4a nonpCR patients. The correlation between pCR in the esophageal wall and in lymph nodes was not significant (P=0.143). Among 19 patients with pCR in resected recurrent laryngeal nerve (RLN) lymph nodes, 31.6% had residual tumor cells in other resected lymph nodes. A significant correlation was found between ypT/ypN downstaging and tumor regression grade (P