Search

Three major directions for the global progress of adeno-associated virus (AAV) vectors for gene therapies (GT) are analyzed: a) engineering vectors to increase transgene expression; b) aligning interests of the health system with costs and challenges for pharmaceutical industry; c) refining patient eligibility criteria, and endpoints definition. Currently employed AAV vectors may cause toxicity and adverse events. Furthermore, studies in animals do not fully predict risks and clinical benefits of AAV-based GT, and animal models reflecting the heterogeneity of certain clinical settings (e.g., congestive heart failure) are poorly available for improving AAV-based GT. Finally, antisense and gene editing approaches will soon complement gene augmentation strategies for the stable solution of unsolved issues of AAV-based GT. While minimizing toxicity, next-generation AAV vectors should decrease the viral load needed to achieve therapeutic efficacy; be functional in a restricted cellular subset; avoid transgene expression in unwanted cells (e.g., hepatocytes), and escape immune oversight in AAV-based GT. The role of stress-induced apoptosis in the loss of transgene expression in GT should be also explored. Aligning interests and obligations of pharmaceutical industry with those of the health system is critical for AAV-based GT success. Costs and challenges for pharmaceutical industry include a) removing impurities from AAV; b) validating tests to measure treatment efficacy, c) promoting training programs to standardize vector genomes delivery, d) collecting long-term follow-up data, and e) maintaining sustainability and cost-effectiveness of AAV-based GT. In rare disorders with small patient numbers (e.g., hemophilia), clearcut outcomes are mandatory as endpoints of unequivocal efficacy data.

Congenital afibrinogenemia is the most severe congenital fibrinogen disorder, characterized by undetectable fibrinogen in circulation. Causative mutations can be divided into two main classes: null mutations with no protein production at all and missense mutations producing abnormal protein chains that are retained inside the cell. The vast majority of cases are due to single base pair mutations or small insertions or deletions in the coding regions or intron-exon junctions of FGB, FGA and FGG. Only a few large rearrangements have been described, all deletions involving FGA. Here we report the characterization of a 403 bp duplication of the FGG exon 8-intron 8 junction accounting for congenital afibrinogenemia in a large consanguineous family from Turkey. This mutation, which had escaped detection by Sanger sequencing of short polymerase chain reaction (PCR) amplicons of coding sequences and splice sites, was identified by studying multiple alignments of reads obtained from whole exome sequencing of a heterozygous individual followed by PCR amplification and sequencing of a larger portion of FGG. Because the mutation duplicates the donor splice site of intron 8, we predicted that the impact of the mutation would be on FGG transcript splicing. Analysis of mRNA produced by cells transiently transfected with normal or mutant minigene constructs showed that the duplication causes production of several aberrant FGG transcripts generating premature truncating codons.

This report contains the updated consensus recommendations for optimal hemophilia care produced in 2019 by three Working Groups (WG) on behalf of the European Directorate for Quality of Medicines and Healthcare in the frame of the Kreuth V Initiative. WG1 recommended access to prophylaxis for all patients, the achievement of plasma factor trough levels of at least 3-5% when extended half-life factor VIII (FVIII) and FIX products are used, a personalized treatment regimen, and a choice of chromogenic assays for treatment monitoring. It was also emphasized that innovative therapies should be supervised by hemophilia comprehensive care centers. WG2 recommended mandatory collection of postmarketing data to assure the long-term safety and efficacy of new hemophilia therapies, the establishment of national patient registries including the core data recommended by the European Medicines Agency and the International Society on Thrombosis and Haemostasis, with adequate support under public control, and greater collaboration to facilitate a comprehensive data evaluation throughout Europe. WG3 discussed methodological aspects of hemophilia care in the context of access decisions, particularly for innovative therapies, and recommended that clinical studies should be designed to provide the quality of evidence needed by regulatory authorities, HTA bodies and healthcare providers. The dialogue between all stakeholders in hemophilia care and patient organizations should be fostered to implement these recommendations., (Copyright© 2020 Ferrata Storti Foundation.)

Neurological symptoms related to microthrombosis are the hallmark of acute manifestations of acquired thrombotic thrombocytopenic purpura (TTP). Despite the achievement of hematological remission, patients may report persisting neurological impairment that affects their quality of life. To assess the long-term neuropsychological consequences of acute TTP, we recruited 35 acquired TTP patients (77% females, median age at onset 41 years, interquartile range: 35-48) regularly followed at our out-patient clinic of thrombotic microangiopathies in Milan (Italy) from December 2015 to October 2016. Patients underwent a psychological evaluation of memory and attentional functions, emotional wellbeing and health-related quality of life at least three months after their last acute TTP event (median 36 months, interquartile range: 17-54). During the psychological consultation, 17 patients (49%) referred persisting subjective neurological impairment in the frame of a remission phase, with at least one symptom as disorientation, loss of concentration, dizziness, lack of balance, headache and diplopia. Neuropsychological assessment revealed lower scores than the Italian general population pertaining to direct, indirect and deferred memory. A higher degree of impairment of memory domains was found in patients with neurological involvement at the time of presentation of the first acute TTP episode. Anxiety and depression were detected in seven (20%) and 15 (43%) patients, respectively. Health-related quality of life was lower than the Italian general population, with mental domains more impacted than physical domains (mean difference 58.43, 95% confidence interval: 71.49-45.37). Our study demonstrates compromised memory and attention functions, persisting anxiety/depression symptoms and a generally reduced quality of life in patients recovering from acute acquired TTP. New clinical strategies should be considered to improve these symptoms., (Copyright© 2020 Ferrata Storti Foundation.)

Plasminogen deficiency is an ultra-rare multisystem disorder characterized by the development of fibrin-rich pseudomembranes on mucous membranes. Ligneous conjunctivitis, which can result in vision impairment or loss, is the most frequent symptom reported. Affected systems may also include the respiratory tract, oropharynx, female reproductive tract, gingiva, middle ear, renal collecting system, skin and central nervous system. Untreated, plasminogen deficiency may result in significant reduction in quality of life and morbidity with potential life-threatening complications. Non-specific therapies are inadequate and plasminogen concentrates are not commercially available. The current understanding of plasminogen deficiency and management of disease symptoms and its progression are based on case reports/series and two small clinical trials. To date there has never been a comprehensive, international study to examine the natural history or optimal therapeutic intervention; knowledge gaps include identification of contributing factors and triggers of disease manifestations, inability to predict disease course, and insufficient real-world data for use of therapeutics. We have created an international, observational study (HISTORY) in a large cohort of persons with plasminogen deficiency and first-degree family members to address these gaps and to advance knowledge and care. HISTORY will build upon the established relationship between the Indiana Hemophilia and Thrombosis Center and the Fondazione Angelo Bianchi Bonomi, IRCCS Ca' Granda Ospedale Maggiore Policlinico - University of Milan and will utilize a modified version of the Prospective Rare Bleeding Disorders Database (PRO-RBDD). A biorepository containing samples from subjects with plasminogen deficiency will be established. This article describes the rationale behind the study and efforts towards its goals., (Copyright© 2020 Ferrata Storti Foundation.)

Primary platelet secretion defects constitute a heterogeneous group of functional defects characterized by reduced platelet granule secretion upon stimulation by different agonists. The clinical and laboratory heterogeneity of primary platelet secretion defects warrants a tailored approach. We performed a pilot study in order to develop DNA sequence analysis pipelines for gene discovery and to create a list of candidate causal genes for platelet secretion defects. Whole-exome sequencing analysis of 14 unrelated Italian patients with primary secretion defects and 16 controls was performed on Illumina HiSeq. Variant prioritization was carried out using two filtering approaches: identification of rare, potentially damaging variants in platelet candidate genes or by selecting singletons. To corroborate the results, exome sequencing was applied in a family in which platelet secretion defects and a bleeding diathesis were present. Platelet candidate gene analysis revealed gene defects in 10/14 patients, which included ADRA2A , ARHGAP1 , DIAPH1 , EXOC1 , FCGR2A , ITPR1 , LTBP1 , PTPN7 , PTPN12 , PRKACG , PRKCD , RAP1GAP , STXBP5L , and VWF The analysis of singletons identified additional gene defects in PLG and PHACTR2 in two other patients. The family analysis confirmed a missense variant p.D1144N in the STXBP5L gene and p.P83H in the KCNMB3 gene as potentially causal. In summary, exome sequencing revealed potential causal variants in 12 of 14 patients with primary platelet secretion defects, highlighting the limitations of the genomic approaches for causal gene identification in this heterogeneous clinical and laboratory phenotype., (Copyright© 2019 Ferrata Storti Foundation.)

In autoantibody-mediated autoimmune diseases, autoantibody profiling allows patients to be stratified and links autoantibodies with disease severity and outcome. However, in immune-mediated thrombotic thrombocytopenic purpura (iTTP) patients, stratification according to antibody profiles and their clinical relevance has not been fully explored. We aimed to develop a new type of autoantibody profiling assay for iTTP based on the use of anti-idiotypic antibodies. Anti-idiotypic antibodies against 3 anti-spacer autoantibodies were generated in mice and were used to capture the respective anti-spacer idiotopes from 151 acute iTTP plasma samples. We next deciphered these anti-spacer idiotope profiles in iTTP patients and investigated whether these limited idiotope profiles could be linked with disease severity. We developed 3 anti-idiotypic antibodies that recognized particular idiotopes in the anti-spacer autoantibodies II-1, TTP73 or I-9, that are involved in ADAMTS13 binding; 35%, 24% and 42% of patients were positive for antibodies with the II-1, TTP73 and I-9 idiotopes, respectively. Stratifying patients according to the corresponding 8 anti-spacer idiotope profiles provided a new insight into the anti-spacer II-1, TTP73 and I-9 idiotope profiles in these patients. Finally, these limited idiotope profiles showed no association with disease severity. We successfully developed 3 anti-idiotypic antibodies that allowed us to determine the profiles of the anti-spacer II-1, TTP73 and I-9 idiotopes in iTTP patients. Increasing the number of patients and/or future development of additional anti-idiotypic antibodies against other anti-ADAMTS13 autoantibodies might allow idiotope profiles of clinical, prognostic value to be identified., (Copyright© 2019 Ferrata Storti Foundation.)

Dissection of pleiotropic effects of missense mutations, rarely investigated in inherited diseases, is fundamental to understanding genotype-phenotype relationships. Missense mutations might impair mRNA processing in addition to protein properties. As a model for hemophilia A, we investigated the highly prevalent F8 c.6046c>t/p.R2016W (exon 19) mutation. In expression studies exploiting lentiviral vectors, we demonstrated that the amino acid change impairs both Factor VIII (FVIII) secretion (antigen 11.0±0.4% of wild-type) and activity (6.0±2.9%). Investigations in patients' ectopic F8 mRNA and with minigenes showed that the corresponding nucleotide change also decreases correct splicing to 70±5%, which is predicted to lower further FVIII activity (4.2±2%), consistently with patients' levels (<1-5%). Masking the mutated exon 19 region by antisense U7snRNA supported the presence of a splicing regulatory element, potentially affected by several missense mutations causing hemophilia A. Among these, the c.6037g>a (p.G2013R) reduced exon inclusion to 41±3% and the c.6053a>g (p.E2018G) to 28±2%, similarly to a variant affecting the 5' splice site (c.6113a>g, p.N2038S, 26±2%), which displayed normal protein features upon recombinant expression. The p.G2013R reduced both antigen (7.0±0.9%) and activity (8.4±0.8%), while the p.E2018G produced a dysfunctional molecule (antigen: 69.0±18.1%; activity: 19.4±2.3%). In conclusion, differentially altered mRNA and protein patterns produce a gradient of residual activity, and clarify genotype-phenotype relationships. Data detail pathogenic mechanisms that, only in combination, account for moderate/severe disease forms, which in turn determine the mutation profile. Taken together we provide a clear example of interplay between mRNA and protein mechanisms of disease that operate in shaping many other inherited disorders., (Copyright© 2018 Ferrata Storti Foundation.)

The inherited deficiency of ADAMTS13 is usually associated with severe forms of thrombotic thrombocytopenic purpura. Among the mutations identified in the ADAMTS13 gene, none have been described on the TSP1-6 repeat domain. We investigated an Iranian family with a history of chronic recurrent thrombotic thrombocytopenic purpura, severe ADAMTS13 deficiency and a heterogeneous pattern of clinical symptoms among affected members. Genetic analysis revealed a homozygous deletion of nucleotides 2930-2935 (GTGCCC) in exon 23 of ADAMTS13, leading to the replacement of Cys977 by a Trp and the deletion of Ala978 and Arg979 in the TSP1-6 repeat domain. To explore the mechanism of ADAMTS13 deficiency, in vitro expression studies were performed. Western blotting, pulse-chase labeling and immunofluorescence studies demonstrated a secretion pathway defect of the mutant protein, with no intracellular accumulation. This finding is consistent with the severe ADAMTS13 deficiency but does not explain the heterogeneous clinical picture of the 3 siblings carrying the same mutation.

Background: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts., Design and Methods: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291&#95;319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143&#95;4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay., Results: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143&#95;4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies., Conclusions: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143&#95;4144insA, lead to a severe deficiency of ADAMTS13.

Background: Factor V deficiency is a rare autosomal recessive hemorrhagic disorder, associated with bleeding manifestations of variable severity. In the present study, we investigated the molecular basis of factor V deficiency in three patients, and performed a comprehensive analysis of the factor V gene (F5) splicing pattern., Design and Methods: Mutational screening was performed by DNA sequencing. Wild-type and mutant F5 mRNA were expressed by transient transfection in COS-1 cells, followed by reverse-transcriptase polymerase chain reaction and sequencing. Real-time reverse-transcriptase polymerase chain reaction was used to evaluate degradation of mRNA carrying premature termination codons., Results: Mutational screening identified three hitherto unknown splicing mutations (IVS8+6T>C, IVS21+1G>A, and IVS24+1&#95;+4delGTAG). Production of mutant transcripts in COS-1 cells demonstrated that both IVS21+1G>A and IVS24+1&#95;+4delGTAG cause the activation of cryptic donor splice sites, whereas IVS8+6T>C causes exon-8 skipping (F5-Delta 8-mRNA). Interestingly, F5-Delta 8-mRNA was also detected in wild-type transfected samples, human liver, platelets, and HepG2 cells, demonstrating that F5 exon-8 skipping takes place physiologically. Since F5-Delta 8-mRNA bears a premature termination codons, we investigated whether this transcript is subjected to nonsense-mediated mRNA decay degradation. The results confirmed the involvement of nonsense-mediated mRNA decay in the degradation of F5 PTC(+) mRNA. Moreover, a comprehensive analysis of the F5 splicing pattern led to the identification of two in-frame splicing variants resulting from skipping of exons 3 and 5-6., Conclusions: The functional consequences of three splicing mutations leading to FV deficiency were elucidated. Furthermore, we report the identification of three alternatively spliced F5 transcripts.

Factor X deficiency is a severe rare hemorrhagic condition inherited as an autosomal recessive trait. It is one of the most severe recessive inherited coagulation disorders. We analyzed the clinical manifestations, laboratory phenotype and genotype in 10 patients with severe Factor X deficiency and in their heterozygous relatives. The most frequent bleeding episodes were hematomas (70%) and gum bleeding (60%). Fifty percent of the homozygous patients required blood transfusion and one-third of heterozygotes required treatment after surgery or delivery. The genetic characterization revealed six different missense mutations, two of which were novel: p.Glu69Lys and p.Asp103His. Haplotype analysis, performed with intra- and extra- FX gene polymorphic markers in Indian, Iranian and Italian patients with the same mutations failed to establish identity by descent, despite the same Caucasian origin. In conclusion, factor X deficiency was confirmed to be one of the most serious among rare bleeding disorders and genetically heterogeneous in different populations.

Background: The high mutational heterogeneity of hemophilia A is a challenge for the provision of genetic services. We plan to identify the mutation in patients with hemophilia A in order to create a confidential national database of mutations for the optimization of genetic services in Italy., Design and Methods: The factor VIII gene (F8) was analyzed in 1296 unrelated patients with hemophilia A using screening methods for intron 22 and 1 inversions and rare mutations (denaturing high performance liquid chromatography, conformation sensitive gel electrophoresis) and/or direct sequencing., Results: F8 mutations were identified in 874 (89%), 146 (89%), and 133 (94%) families with severe, moderate, or mild hemophilia A, respectively. Mutations predicting a null allele were responsible for 80%, 15%, and less than 1% of cases of severe, moderate, or mild hemophilia A, respectively. About 40% of missense and nonsense mutations occurred at a CpG site, arginines being most frequently affected. Of the small deletions or insertions, 29% occurred at one of two stretches of adenines, codons 1191-1194 (8As) and 1439-1441 (9As). Overall, these "hotspots" accounted for 31% of the point mutations in the patients with hemophilia A. Inhibitors developed in 22% of the patients with severe hemophilia A, 8% of those with moderate disease and in 4% of patients with mild hemophilia A. Patients who had severe hemophilia A and mutations predicting a null allele developed inhibitors more frequently (22 to 67%) than patients with missense mutations (5%)., Conclusions: We report a wide spectrum of mutations in a large national database. The type of mutation was a strong predictor of the clinical phenotype. This database is expected to considerably improve the genetic counselling and medical care of families with hemophilia A in Italy.

Background: From 20 to 50% of patients who survive an acute episode of the acquired form of thrombotic thrombocytopenic purpura relapse but clinical and laboratory markers of recurrence are not well established., Design and Methods: In 109 patients enrolled in an international registry we evaluated, in the frame of a retrospective cohort study, the predictive role of the metalloprotease ADAMTS13 as measured in plasma during remission. Anti-ADAMTS13 antibodies and von Willebrand factor were also evaluated in a smaller number of the same patients., Results: Median values of ADAMTS13 activity and antigen were significantly lower in patients with recurrent thrombotic thrombocytopenic purpura than in those with no recurrence (activity: 12% vs. 41%; p=0.007; antigen: 36% vs. 58%; p=0.003). A severe deficiency of ADAMTS13 activity (10% or less) was associated with a higher likelihood of recurrence (odds ratio 2.9; 95% confidence interval 1.3 to 6.8; p=0.01). Anti-ADAMTS13 antibodies were also more prevalent in patients with recurrent thrombotic thrombocytopenic purpura (odds ratio 3.1; 95% confidence interval 1.4 to 7.3; p=0.006). The presence during remission of both severe ADAMTS13 deficiency and anti-ADAMTS13 antibodies increased the likelihood of recurrence 3.6 times (95% confidence interval 1.4 to 9.0; p=0.006). The presence of ultralarge von Willebrand factor multimers and of associated diseases or conditions did not increase recurrence., Conclusions: Survivors of an acute episode of acquired thrombotic thrombocytopenic purpura with severely reduced levels of ADAMTS13 and/or with anti-ADAMTS13 antibodies during remission have an approximately three-fold greater likelihood of developing another episode of thrombotic thrombocytopenic purpura than patients with higher protease activity and no antibody.

Background and Objectives: Afibrinogenemia and hypofibrinogenemia are rare inherited coagulation disorders characterized by hemorrhagic manifestations of variable entity and by plasma fibrinogen deficiency. So far, 57 mutations have been associated with these disorders, and 18 of these are missense mutations. The aim of this study was to characterize the molecular mechanism underlying severe hypofibrinogenemia in a proband from India., Design and Methods: The mutational screening was accomplished by DNA sequencing of the three fibrinogen genes. The mutant protein was expressed in COS-1 cells, and intracellular and secreted mutant fibrinogen was analyzed by means of pulse-chase experiments., Results: A novel homozygous G-->A transition in exon 8 (nucleotide position 8017) was found in the proband's fibrinogen Bbeta-chain gene. The resulting G434D missense mutation (fibrinogen Mumbai) involves a highly conserved amino acid residue, located in the C-terminal globular D domain. In vitro expression experiments demonstrated intracellular retention of the mutant fibrinogen and marked reduction of its secretion., Interpretation and Conclusions: The G434D substitution causes severe hypofibrinogenemia by impairing fibrinogen secretion. Expression data confirm the importance of Bbeta-chain D domain folding in the intracellular processing of fibrinogen.

Background and Objectives: Factor XI (FXI) deficiency is a rare autosomal recessive coagulopathy which is, however, frequent among Ashkenazi Jews. Two mutations, type II (Glu117stop) and type III (Phe283Leu), account for the majority of abnormal alleles in this population. The aim of this study was to analyze the molecular basis of FXI deficiency in six unrelated Italian probands with severe deficiency, a population hitherto largely unexplored., Design and Methods: All patients showed unmeasurable functional FXI levels in plasma. Mutational screening was performed by sequencing. Haplotype analysis was performed using intragenic polymorphisms. Expression studies were performed by transient transfection in COS-1 cells., Results: Sequencing identified two novel mutations: a nonsense mutation (Cys118stop) in exon 5 in two probands, and a 6-bp deletion (643-648delATCGAC) in exon 7 in one proband. The Cys118stop is predicted to cause FXI deficiency by a secretion defect and/or by increased mRNA degradation. The 6-bp deletion causes the loss of residues Ile197 and Asp198. There was a remarkable secretion impairment of the deleted FXI protein. In four of the six probands, the type II mutation was found. Haplotype analysis in patients carrying the type II mutation revealed that they share a common haplotype, perhaps derived from a Jewish ancestor., Interpretation and Conclusions: The identification and characterization of two novel mutations widen the mutational spectrum of FXI deficiency. Haplotype analysis is compatible with a Jewish origin of the type II mutation. The high occurrence of the type II mutation among Italian patients will be helpful to direct future genetic screenings.

Background and Objectives: Although a large number of gene mutations have been characterized in patients with factor VII (FVII) deficiency, few naturally occurring mutations have been described in epidermal growth factor (EGF)-like domains. We investigated a 6-year old Italian girl who had low functional and antigenic FVII plasma levels., Design and Methods: Plasma levels of FVII activity and antigen were evaluated in the propositus and her relatives. Mutation screening was performed by sequencing the FVII gene. The effect of the identified FVII mutations was investigated by protein expression in transfected cells., Results: The propositus was shown to be a compound heterozygote for a known (Arg110Cys) and a novel (Asp123Tyr) missense mutation both occurring in the second EGF-like domain. In transfected cells, expression of the Arg110Cys mutation reduced the amount of intracellular and secreted FVII protein (48% and 18%, respectively). Likewise, cells transfected with the Asp123Tyr mutation gave rise to low intracellular (40%) and extracellular (4%) FVII antigen levels. In conditioned media, FVII procoagulant activity was reduced accordingly (10% and <1%, respectively)., Interpretation and Conclusions: Transient expression of the identified FVII mutations caused severely reduced but detectable FVII antigen and activity levels. The present findings suggest that the two naturally occurring missense mutations identified within the second EGF-like domain severely affect FVII protein handling, impairing the correct folding of FVII.

Background and Objectives: Patients with disseminated malignancies have been noted to have a deficiency of von Willebrand factor (VWF) cleaving protease, ADAMTS-13. The very low or undetectable plasma levels of this protease are said to be similar to those found in patients with thrombotic thrombocytopenic purpura (TTP). This observation, which challenges the paradigm that severe ADAMTS-13 deficiency is a specific diagnostic marker for TTP, remains so far unconfirmed., Design and Methods: We measured the protease and VWF antigen (VWF:Ag) in parallel in 49 Iranian patients with solid tumors, which in 29 cases were localized (stages I and II) and in 20 disseminated (stage IV). Forty-nine healthy individuals matched with cases for sex, age and smoking habits were taken as controls., Results: Patients with disseminated tumors had lower mean plasma levels of ADAMTS-13 than those with localized tumors, but these differences did not reach the level of statistical significance (p=0.059). However, in no patient was the level of ADAMTS-13 below 18% of normal, at variance with previous findings of lower or unmeasurable levels (<15%). The level of ADAMTS-13 was significantly lower in patients with localized tumors than in controls ( p = 0.0003 ), but higher than in patients with disseminated disease (p=0.0001 vs controls)., Interpretation and Conclusions: Malignancy, whether localized or disseminated, is another condition associated with low ADAMTS-13 levels not accompanied by signs and symptoms of TTP and other thrombotic microangiopathies.

Background and Objectives: Congenital afibrinogenemia is a rare coagulation disorder whose molecular basis is still poorly characterized. Most mutations have been identified in the fibrinogen Aalpha- and gamma-chain genes, whereas only two missense mutations have been reported in the Bbeta-chain gene. The aim of this work was to widen knowledge about the mutational spectrum of this disease by analyzing the molecular bases of congenital afibrinogenemia in three unrelated Iranian patients., Design and Methods: All patients showed unmeasurable levels of clottable fibrinogen in plasma. Mutational screening was performed by sequencing the whole coding region, including exon-intron boundaries and part of the promoter region of the three fibrinogen genes., Results: Sequencing in one patient revealed the presence of a novel nonsense mutation (3282C-->T) in exon 2 of the fibrinogen Bbeta-chain gene, causing a severe truncation of the corresponding polypeptide (R17X). In the remaining probands, two already known small deletions (4209delA and 4220delT), both located in exon 5 of the fibrinogen Aalpha-chain gene, were identified, and their effect at the protein level explored by computer-assisted analysis., Interpretation and Conclusions: The identification of the first truncating mutation in the fibrinogen Bbeta-chain gene confirms the involvement of all three fibrinogen genes in the pathogenesis of congenital afibrinogenemia and widens the mutational spectrum of the disease. This knowledge is clinically essential in order to carry out prenatal diagnosis in families at risk.

Background and Objectives: In patients with factor XI(FXI) deficiency the bleeding tendency is poorly correlated with plasma factor levels. The purpose of this study was to evaluate whether or not this discrepancy is also present in a large series of patients from Iran, a previously unexplored ethnic group., Design and Methods: In 28 FXI - deficient patients bleeding symptoms and their relation to FXI levels were compared with those of 100 patients with factor VIII (FVIII)deficiency (classic hemophilia), matched for severity of factor deficiency., Results: Spontaneous bleeding was definitely less frequentin FXI deficiency than in hemophilia, whereas postoperative and post-traumatic bleeding occurred with comparable frequencies. Among FXI-deficient patients the severity of symptoms was poorly correlated with FXI levels, mildly deficient patients bleeding almost as frequently as those severely deficient. In contrast, in patients with classic hemophilia there was a close relation between the severity of bleeding and degree of FVIII deficiency., Interpretation and Conclusions: As in other ethnic groups, in Iranians factor XI deficiency is less severe than classic hemophilia and the bleeding tendency is poorly correlated to plasma factor levels., (©2002, Ferrata Storti Foundation)