Search

Patients with atrial septal defects (ASDs) have increased mortality and morbidity. This can only partly be explained by hemodynamic changes caused by the ASD, suggesting additional underlying causes. Patients with an ASD have an increased burden of pathogenic gene variants in ASD-related genes, indicating genetics as an important factor in etiology. Inheritance of genetic variants with high impact can cause ASD in relatives (familial ASD). This study aimed to investigate whether lifelong outcomes were different in patients with familial ASD compared with patients with sporadic ASD. We used health registries and a nationwide cohort of 2,151 patients with ASD to compare the incidences of atrial fibrillation or flutter (together abbreviated as AF), heart failure, and mortality between patients with familial and sporadic ASD using Cox proportional hazard ratio and Fine and Gray analysis. Patients with familial ASD experienced AF and heart failure earlier in life than patients with sporadic ASD, with hazard ratios of 1.6 and 1.7, respectively. Subdistribution hazard ratios showed an increased risk of AF and heart failure in patients with familial ASD compared with patients with sporadic ASDs (2.3 and 3.1, respectively). Our results suggest that genetic variants with high impact may influence the outcomes of patients with ASD. In conclusion, patients with familial ASD have an increased risk and an earlier onset of AF and heart failure compared with patients with sporadic ASD, hence clinical awareness of arrhythmias and heart failure in patients with familial ASD may lead to timely treatment.

Battery electric buses are seen as a well-suited technology for the electrification of road-based public transport. However, the transition process from conventional diesel to electric buses faces major hurdles caused by range limitations and required charging times of battery buses. This work addresses these constraints and provides a methodology for the cost-optimized planning of depot charging battery bus fleets and their corresponding charging infrastructure. The defined problem covers the scheduling of battery buses, the fleet composition, and the optimization of charging infrastructure in a joint process. Vehicle schedule adjustments are monetized and evaluated together with the investment and operational costs of the bus system. The resulting total cost of ownership enables a comparison of technical alternatives on a system level, which makes this approach especially promising for feasibility studies comprising a wide range of technical concepts. Two scenarios of European cities are analyzed and discussed in a case study, revealing that the cost structure is influenced significantly by the considered bus type and its technical specifications. For example, the total energy consumption of the considered lightweight bus is up to 32% lower than the total consumption of the high range bus, although the deadheading mileage increases. However, the total costs of ownership for operating both bus types are relatively close, due to the increased fleet size and driver expenses required for the lightweight bus system. The case study furthermore reveals that a mixed fleet of different bus types could be advantageous depending on the operational characteristics of the bus route.

CDK5RAP2 gene encodes a centrosomal protein, highly expressed in fetal brain and essentially indispensable for its normal development, as biallelic mutations in it lead to primary microcephaly (MCPH). Despite being known as MCPH linked gene for more than a decade, the phenotypic spectrum of CDK5RAP2 mutations is still under explored as only eleven families have been reported worldwide. Here, we analyzed a consanguineous Pakistani MCPH family, characterized by moderate to severe intellectual disability, speech impairment, moderately short stature and sparse eyebrows. Whole exome sequencing of the proband identified a 2bp duplication in exon 34 of CDK5RAP2 that causes frame-shift, leading to a premature stop codon. The resultant transcript is resistant to nonsense mediated decay, suggesting that the mutation leads to a truncated protein lacking C-terminal domains; CDK5R1, and Cnn motif 2 (CM2), required for its localization to centrosome and Golgi Apparatus. Clinical variability observed in the family highlights the importance of further detailed clinical description of patients with CDK5RAP2 mutations.

Disasters such as fires, earthquakes, and floods cause severe casualties and enormous economic losses. One effective method to reduce these losses is to construct a disaster relief network to deliver disaster supplies as quickly as possible. This method requires solutions to the following problems. 1) Given the established distribution centers, which center(s) should be open after a disaster? 2) Given a set of vehicles, how should these vehicles be assigned to each open distribution center? 3) How can the vehicles be routed from the open distribution center(s) to demand points as efficiently as possible? 4) How many supplies can be delivered to each demand point on the condition that the relief allocation plan is made a priority before the actual demands are realized? This study proposes a model for risk-averse optimization of disaster relief facility location and vehicle routing under stochastic demand that solves the four problems simultaneously. The novel contribution of this study is its presentation of a new model that includes conditional value at risk with regret (CVaR-R)—defined as the expected regret of worst-case scenarios—as a risk measure that considers both the reliability and unreliability aspects of demand variability in the disaster relief facility location and vehicle routing problem. Two objectives are proposed: the CVaR-R of the waiting time and the CVaR-R of the system cost. Due to the nonlinear capacity constraints for vehicles and distribution centers, the proposed problem is formulated as a bi-objective mixed-integer nonlinear programming model and is solved with a hybrid genetic algorithm that integrates a genetic algorithm to determine the satisfactory solution for each demand scenario and a non-dominated sorting genetic algorithm II (NSGA-II) to obtain the non-dominated Pareto solution that considers all demand scenarios. Moreover, the Nash bargaining solution is introduced to capture the decision-maker’s interests of the two objectives. Numerical examples demonstrate the trade-off between the waiting time and system cost and the effects of various parameters, including the confidence level and distance parameter, on the solution. It is found that the Pareto solutions are distributed unevenly on the Pareto frontier due to the difference in the number of the distribution centers opened. The Pareto frontier and Nash bargaining solution change along with the confidence level and distance parameter, respectively.

A stochastic method of generating a synthetic turbulent flow field is combined with a 2D mesh-free vortex method to simulate the effect of an oncoming turbulent flow on a bridge deck cross-section within the atmospheric boundary layer. The mesh-free vortex method is found to be capable of preserving the a priori specified statistics as well as anisotropic characteristics of the synthesised turbulent flow field. From the simulation, the aerodynamic admittance is estimated and the instantaneous effect of a time varying angle of attack is briefly investigated. The obtained aerodynamic admittance of four aerodynamically different bridge sections is compared to available wind tunnel data, showing good agreement between the two.

Most of the operational problems in container terminals are strongly interconnected. In this paper, we study the integrated Berth Allocation and Quay Crane Assignment Problem in seaport container terminals. We will extend the current state-of-the-art by proposing novel set partitioning models. To improve the performance of the set partitioning formulations, a number of variable reduction techniques are proposed. Furthermore, we analyze the effects of different discretization schemes and the impact of using a time-variant/invariant quay crane allocation policy. Computational experiments show that the proposed models significantly improve the benchmark solutions of the current state-of-art optimal approaches.

A comparison of the aeroelastic response of four 1:220 aeroelastic models representing three different construction stages and the completion stage of the Izmit Bay suspension bridge in Turkey is presented. Wind tunnel tests were performed in the same laboratory both in smooth and turbulent flow conditions to investigate the aeroelastic stability and the buffeting response. Completion bridge results are used as a reference for considerations on how the variation of the structural characteristics and the different aerodynamics of the various construction stages influence the bridge stability and the buffeting response.

SummaryTransforming growth factor β (TGF-β) signaling is regulated by clathrin-dependent endocytosis (CDE) for the control of cellular processes during development and in tissue homeostasis. The primary cilium coordinates several signaling pathways, and the pocket surrounding the base and proximal part of the cilium is a site for CDE. We report here that TGF-β receptors localize to the ciliary tip and endocytic vesicles at the ciliary base in fibroblasts and that TGF-β stimulation increases receptor localization and activation of SMAD2/3 and ERK1/2 at the ciliary base. Inhibition of CDE reduced TGF-β-mediated signaling at the cilium, and TGF-β signaling and CDE activity are reduced at stunted primary cilia in Tg737orpk fibroblasts. Similarly, TGF-β signaling during cardiomyogenesis correlated with accumulation of TGF-β receptors and activation of SMAD2/3 at the ciliary base. Our results indicate that the primary cilium regulates TGF-β signaling and that the ciliary pocket is a compartment for CDE-dependent regulation of signal transduction.Video Abstract

This paper presents a wind tunnel study carried out with the objective of exploring the effect of shape on vortex induced vibrations of trapezoidal box girder bridge decks. It is demonstrated that it is possible to derive a virtually vibration free deck and that the angle between the horizontal bottom plate and the inclined side panes is an important parameter in achieving this goal., 13th International Conference on Wind Engineering, July 10-15, 2011, Amsterdam, Netherlands

We present a novel method for the simulation of the aerodynamic admittance in bluff body aerodynamics. The method introduces a model for describing oncoming turbulence in two-dimensional discrete vortex method simulations by seeding the upstream flow with vortex particles. The turbulence is generated prior to the simulations and is based on analytic spectral densities of the atmospheric turbulence and a coherence function defining the spatial correlation of the flow. The method is validated by simulating the turbulent flow past a flat plate and past the Great Belt East bridge. The results are generally found in good agreement with the potential flow solution due to Liepmann.

This paper provides a thorough review of the current state-of-the-art within airline disruption management of resources, including aircraft, crew, passenger and integrated recovery. An overview of model formulations of the aircraft and crew scheduling problems is presented in order to emphasize similarities between solution approaches applied to the planning and recovery problems. A brief overview of research within schedule robustness in airline scheduling is included in the review, since this proactive measure is a natural complement to disruption management.

The 22q11 deletion syndrome, which is caused by a 1.5- to 3.0-megabase hemizygous deletion in chromosome 22q11.2, has a prevalence of 1/2000 to 1/4000. However, the syndrome presents with highly variable phenotypes and thus may be underestimated among Danish newborns. To establish a true incidence of 22q11.2 deletions among certain manifestations, eg, congenital heart disease, on selected Danes, a multiplex ligation-dependant probe amplification (MLPA) analysis was designed. The analysis was planned to be performed on DNA extracted from dried blood spot samples (DBSS) obtained from Guthrie cards collected during neonatal screening programs. However, the DNA concentration necessary for a standard MLPA analysis (20 ng) could not be attained from DBSS, and a novel MLPA design was developed to permit for analysis on limited amounts of DNA (2 ng). A pilot study is reported here that validates the new MLPA design using nine patients diagnosed with the 22q11.2 deletion and 101 controls. All deletions were identified using DNA extracted from DBSS, and no copy number variations were detected in the controls, resulting in a specificity and sensitivity of 100%. It is thereby concluded that the novel MLPA probe design is successful and reliable using minimal amounts of DNA. This allows for use of DBSS samples in a retrospective study of 22q11.2 deletion among certain manifestations associated with DiGeorge Syndrome.

The two current models of invasive amebiasis both hold that direct contact of toxic molecules and amebas with tissue produces the necrotic areas characteristic of this disorder. Whereas one model characterizes these toxic molecules as amebic products (e.g., lectins, amebapores, cysteine proteinases and other proteolytic enzymes), the other describes them as products of the inflammatory response (e.g., cytokines, nitric oxide, reactive oxygen intermediates and cytotoxic granules). Both these models can account for necrotic areas with many amebas present and with acute inflammation, but not those with few or no amebas present or with scarce inflammation. A new model poses that an inadequate immune response leads to a continuous and prolonged activation of endothelial cells (ECs) by amebas, amebic molecules and cytokines, which triggers the mechanisms leading to necrosis. Other toxic molecules later contribute to EC activation: nitric oxide, reactive oxygen intermediates, the activated complement and proteases. Hyperactivated endothelial cells continuously express adhesion molecules (e.g., ICAM-1 and E-selectin), pro-coagulant molecules (e.g., tissue factor, von Willebrand factor, and the plasminogen activator inhibitor), resulting in ever greater inflammation and thrombosis, which eventually reduces or blocks blood flow in some vessels and starves certain tissue areas of an adequate oxygen and nutrient supply. When necrotic areas first develop, they are surrounded by inflammatory cells due to the acute inflammation at this stage. However, these cells are starved of oxygen and essential nutrients by the same microcirculatory dysfunction. The increasing concentration of nitric oxide during amebiasis eventually has an anti-inflammatory and vasodilating effect, creating a new mechanism for the microcirculatory dysfunction. This local microcirculatory dysfunction can explain necrotic areas in the presence of many, few, or no amebas, with abundant or scarce inflammation.

Estrogens and glucocorticoids have synergistic effects in the micro and macrovasculature of endothelial cells. Whereas in the former they both have pro-inflammatory effects, in the latter they both inhibit the expression of adhesion molecules. Since the molecular basis of this synergy has not been defined, we propose possible mechanisms of interaction. An understanding of the functional interaction between estrogens and glucocorticoids in the endothelial cells of the micro and macrovasculature may contribute to clarifying the role of the endothelial cells of different vascular beds during the inflammatory response and in chronic inflammation. These advances could contribute to the design of more effective therapeutic strategies for the prevention of diseases, such as atherosclerosis, systemic lupus erythematosus and rheumatoid arthritis, in which the inflammatory process plays an important pathogenic role.

The vortex shedding response of a twin box bridge girder deck with and without guide vanes has been investigated at three different Reynolds numbers with the objective of identifying the mode of vortex excitation and suitable conditions for testing that will allow faithful evaluation of guide vane mitigation efficiency. It has been established that the displacement thickness must be at the order of 10% of the guide vane offset in order to allow sufficient flow rate to render the guide vane efficient. Conventional section model scales ranging from 1:50 to 1:100 are not likely to be capable of fulfilling such conditions. Measurement of the fluctuating pressure field around the twin girder deck indicates that vortices shed from the upwind box will impinge on the downwind box resulting in higher fluctuating pressures here than on the upwind box from where the vortices are shed. This process is likely to render the twin deck more susceptible to vortex shedding excitation than the mono box deck.

In this study we report a female patient with an interstitial duplication of a region (10q22-q23) which is rarely reported in the literature. We fine mapped the aberration with array CGH, which revealed an 18.6-Mb duplication, covering 89 annotated genes, at 10q22.2-q23.33. There were no other deletions or duplications elsewhere in the genome. The main clinical features of the patient are microcephaly and congenital heart disease, which are likely to be caused by dosage effect of one or several genes in the duplicated region. Similar phenotypes have been found in other patients with 10q11-q22 duplications and in two out of three patients with 10q22-q25 duplications. However, most of the duplication cases were investigated only by conventional chromosome analyses, and fine mapping of these and other duplications of 10q22-q23 are warranted for genotype-phenotype comparisons.

The drag wind loading on the stay cables of long cable-stayed bridges is discussed based on two recent long-span cable-stayed bridge designs. For wind along the bridge, the available design literature on cable drag coefficients either do not cover the actual cable configurations or are too conservative. Therefore, some simple design values had to be devised. These design values for the cable drag coefficient are then compared with measured drag coefficients for various types of cable surface treatments introduced to suppress rain-wind vibrations. A modified expression depending on cable diameter and inclination is also proposed and the applicability of the expression is discussed.

Over the past decade, airlines have become more concerned with developing an optimal flight schedule, with very little slack left to accommodate for any form of variation from the optimal solution. During operation the planned schedules often have to be revised due to disruptions caused by for example severe weather, technical problems and crew sickness. Thus, the field of Airline Disruption Management has emerged within the past few years. The increased focus on cutting cost at the major airlines has intensified the interest in the development of new and cost efficient methods to handle airline disruptions. The purpose of this paper is twofold. In the first part it offers an introduction to airline disruption management, provides the readers with a description of the planning processes and delivers a detailed overview of the numerous aspects of airline disruption management. In the second part we report on experiences from a large research and development project on airline disruption management. Within the project the first prototype of a multiple resource decision support system at the operations control center in a major airline, has been implemented.

Background: Long QT syndrome [LQTS] is a congenital cardiac disease characterised by prolonged QTC-time, syncopes and sudden cardiac death. LQTS is caused by mutations in genes coding for ion channels involved in the action potential. KCNE5 codes for a novel β-subunit of the ion channel conducting the delayed rectifier repolarizing current IKs. As KCNE5 is expressed in the human heart and suppresses the IKs current in heterologous systems, it is a candidate gene that may be mutated in LQTS families where no causative mutations in known LQTS associated genes have been found. We examined whether this was the case. Methods: Genomic DNA from LQTS patients [n=88] and normal controls [n=90] was screened for mutations in KCNE5 by endonuclease-enhanced single strand conformation polymorphism analysis [EE-SSCP], and DNA sequencing of aberrant conformers. Mutations in other LQTS associated ion channels were excluded by SSCP. Results: No mutations were found in the coding region of the KCNE5 gene in LQTS patients. One polymorphism, a T-to-C transition at nucleotide 97, causing an amino acid polymorphism P33S, was present in 16 persons, nine heterozygotes and seven homozygotes. The T-allele frequency was 0.13 in LQTS patients and 0.10 in controls.

During the final phases of deck erection and surfacing of the suspended spans of the Storebaelt bridge, vertical deck oscillations of low frequency were observed by workers and supervision staff. The results of on-site monitoring of the oscillations and wind speed measurements at the nearby island of Sprogo correlated well with wind-tunnel test results obtained during design, indicating that the observed oscillations were due to periodic von Karman type vortex shedding in the wake of the girder. The present paper discusses the results of the on-site structural and wind monitoring programme, correlation to wind-tunnel tests and the design and erection of guide vanes to the main span girder for mitigation of the oscillations. The vortex-induced oscillations were found to be harmless from a structural point of view but unacceptable considering possible physiological impact on users of the bridge.

This paper presents the results of aerodynamic studies of the Lions’ Gate Bridge – 3 lane renovation. The studies are divided into two parts: In the first part results of wind tunnel tests on a section model are compared to the results from two-dimensional numerical simulations based on the discrete vortex method. In the second part, changes in aerodynamic behaviour due to design revisions and changed mass and stiffness properties are studied by means of numerical simulations only. This was made possible because the numerical simulations had been calibrated with the results from wind tunnel testing in the first part of the studies and compared favourably. The numerical simulations proved both time and cost efficient. The studies undertaken are exclusively for the renovation of the suspension bridge.

Mutations in the cardiac β -myosin heavy chain gene ( MYH7 ), and other genes encoding cardiac sarcomere proteins may cause familial hypertrophic cardiomyopathy (F-HCM), an autosomal dominant disease, characterized by myocardial hypertrophy. We analysed the MYH7 gene in three generations of a family with one borderline and four clinically verified cases of hypertrophic cardiomyopathy, and identified a mutation in exon 7 changing the 190 arginine residue into a threonine residue. The mutation is located in the ATP-binding region of the myosin head and alters the charge in the F-helix close to the phosphate-binding P-loop. The mutation may thus interfere with the coupling between ATP-hydrolysis and the transition into mechanical energy. In conclusion, the novel Arg190Thr mutation in exon 7 of the MYH7 gene is associated with the development of symptomatic myocardial hypertrophy in adults.

An efficient large eddy simulation model (LES) using finite element method (FEM) is presented. The Navier–Stokes equations are solved using an implicit procedure. The three-dimensional LES model could capture the drag crisis phenomena for a circular cylinder. Only 2% of the grid point used by Tamura is used to capture the drag crisis. This is possible because of the use of accurate approximation of convection term using FEM which reduces the numerical diffusion. This model is used to study the flow over Great Belt East Bridge. The computed drag and Strouhal number are in reasonable agreement with wind tunnel measurement.

Background: Genetic screening requires methods for mutation detection that are sensitive, precise, and robust. In population screening for complex genetic diseases in which large genes and/or several genes may be affected, automation of the mutation detection analysis is desirable. Methods and Results: The combined use of Cleavase nuclease and analysis of the DNA cleavage pattern by capillary electrophoresis was evaluated with respect to sensitivity, reproducibility, and dependency of experimental conditions in detecting mutations in the human genes MYH7 and KVLQT1 (KCNA9). The cleavage patterns obtained by capillary electrophoresis were very reproducible and robust. Conclusions: The combination of a sensitive enzymatic mutation detection method and capillary electrophoresis may prove to be a useful system for automated, large-scale genetic screening.

A common assumption in wind engineering is that the flow around bluff and sharp edged bodies is independent of Reynolds Number, Re. An important practical implication of this assumption is that aerodynamic parameters such as Strouhal number, lift and drag coefficients may be obtained from low speed wind tunnel model tests and applied directly to the prototype structure. Tests conducted in a pressurised wind tunnel capable of reproducing typical model scale (Re≈105) and prototype conditions (Re≈107) revealed pronounced Re effects in the flow around a bluff and sharp edged bridge girder cross section. Similar Re effects are well known from the flow around circular cylinders. Pressurised wind tunnel observations of the Strouhal Number at high and low Re for the bridge girder cross section in question was supported by observations of vortex induced vibrations of the prototype bridge girder and the corresponding 1 : 80 scale section model tested in a conventional low speed wind tunnel.

Cross-section shape is an important parameter for the wind response and aeroelastic stability of long span suspension and cable-stayed bridges. Numerical simulation methods have now been developed to a stage where assessment of the effect of practical cross-section shapes on bridge response is possible. The present paper reviews selected numerical simulations carried out for a long-span suspension bridge using finite difference and discrete vortex methods. Comparison of simulations to existing wind tunnel data is discussed. Further, the paper addresses the aerodynamics and structural response of four generic cross-section shapes developed from the well-known plate girder section of the first Tacoma Narrows Bridge. Finally a case study involving the wind response of a 400 m main span cable-stayed bridge is discussed.

During erection of long-span suspension bridges the stiffening girder lacks torsional continuity. Thus, it becomes important to consider flutter-type aeroelastic instabilities. During the early stages of deck erection, the critical wind speed for onset of flutter becomes particularly low and in this case it may prove interesting to consider flutter control by provision of eccentric ballast. The present paper extends standard bridge flutter routines based on measured aerodynamic derivatives to include the effect of eccentric deployment of ballast. The potential enhancement of the critical wind speed by this method is discussed and the importance of applying actual measured aerodynamic derivatives for the bridge section in question is emphasised as opposed to the use of theoretical “flat plate” aerodynamic derivatives.

Two-dimensional viscous incompressible flow past bridge girder cross-sections are simulated using the discrete vortex method. The flow around stationary cross-sections as well as cross-sections undergoing cross-wind vertical (bending) and rotary (torsional) motions are investigated for assessment of drag coefficient, Strouhal number and aerodynamic derivatives for application in aeroelastic analyses. Good to excellent agreement with wind tunnel test results is demonstrated for analyses of forced wind loading, flutter wind speed and vertical vortex-induced response of four practical girder cross-sections. The success of the simulations is attributed to the bluff nature of the cross-sections and to the two-dimensional (2-D) nature of flow around bridge girders.

The present paper proposes a one degree of freedom (1DOF) non-linear model of self limiting cyclic wind loads for application in finite element method analyses of light structures subjected to vortex shedding excitation under lock-in conditions. Being empirical by nature, the model includes three independent parameters to be determined from response tests with representative aero-elastic wind tunnel models or prototypes. The paper discusses methods for parameter identification from response data. The paper also evaluates the proposed load model versus other 1DOF empirical vortex shedding models which have found some acceptance in wind engineering.

F hypertrophic cardiomyopathy (FHC) is a phenotypically and genetically heterogenous myocardial disease with an autosomal dominant pattern of inheritance. FHC is a frequent cause of sudden death in young people. Knowledge of morbidity and mortality associated with different mutations in the different sarcomere genes associated with FHC may prove to be of importance for clinical decisions concerning treatment, thus, leading to improved patient management. Hence, based on genotype-phenotype analyses, mutations in the MYBPC3 encoding the cardiac myosin-binding protein C gene have generally been associated with a low morbidity and mortality early in life.1 Mutations in the TNNT2 gene encoding cardiac troponin T have been associated with a high incidence of sudden death at young age,2,3 whereas the prognosis associated with different mutations in the MYH7 gene encoding the cardiac b-myosin heavy chain (bMHC) have been more variable.2 FHC families often have their own “private” mutation, and the prognosis of FHC may vary between, as well as within, families with the same mutation, thereby compromising the value of the genotyping. The ValMet mutation is often presented as the prototype of a “benign” MYH7 gene mutation.4–7 We report the unfavorable prognosis in a family with FHC associated with the ValMet mutation in the MYH7 gene and provide cumulated data on the incidence of sudden death at young age based on the present and previously published studies. • • • From a consecutive cohort of 70 families with FHC, family JO of Danish origin was included in the present study at the The Heart Center, Rigshospitalet, University of Copenhagen. After informed consent was given (Local Science Ethics Committee, Copenhagen. Protocol No. KF V92213), patient and family histories were obtained, and physical examination, electrocardiography, and transthoracic echocardiography were performed. The clinical diagnosis of FHC in relatives was based on: (1) electrocardiographic criteria: pathologic Q-waves or signs of left ventricular hypertrophy,8,9 and/or (2) echocardiographic criteria: a maximal left ventricular wall thickness of $13 mm,8,9 in the absence of evidence of other specific heart muscle diseases.10 For family members with disease, clinical records, family histories, or both were obtained whenever available. The clinical diagnosis was made before molecular genetic analysis. Blood samples were collected from probands and family members. Genomic DNA was extracted using a QIAamp DNA purification kit (Qiagen, Hilden, Germany). Mutation analysis of the MYH7 gene was performed using single-strand conformation polymorphism-heteroduplex (SSCP-HD) formation analysis on exons 3–23.11 Specifically for exon 16 the primers were 16F, GTGATGCTCTCTCCTGCTTCCTCA, and 16R, CCGGGAGCCTCAGTCCCTACTT. DNA preparations from 100 randomly selected Guthriecards were used as controls (Local Science Ethics Committee, Copenhagen. Protocol No. 01 to 119/99). Nucleotide sequence determination was performed by cycle sequencing using a Dye Deoxy Terminator Cycle Sequencing kit (Perkin Elmer, Foster City, California) on an ABI373 DNA sequencer (Perkin Elmer). The presently reported family, JO, were also screened for mutations in 7 other cardiac sarcomere genes known to be associated with FHC. The pedigree of family JO is shown in Figure 1. The proband (V:1, 45 years of age) was diagnosed at the age of 15 years. His previously asymptomatic son (VI:1) died suddenly at the age of 14 years. Postmortem examination confirmed the diagnosis of severe hypertrophic cardiomyopathy. The family history revealed 2 additional sudden deaths at young age (I:1 before 30 years of age and IV:1 at the age of 16 years). No additional information concerning these deaths was available. The proband’s sister (V:3, 40 years of age) has FHC, but only with few symptoms, despite pronounced septal hypertrophy and atrial fibrillation. Neither the proband’s mother nor father was available for inclusion in the study. The proband’s 2 daughters (VI:2, 23 years of age and VI:3, 16 years of age) both developed FHC during adolescence. Reports of syncope, nonsustained ventricular tachycardia on Holter monitoring, or abnormal blood pressure response during exercise, and the present family history, led to From the Department of Medicine B, The Heart Centre, Rigshospitalet, University of Copenhagen; and Department of Clinical Biochemistry, Statens Serum Institut, Copenhagen, Denmark. The study was supported by grants from The Danish Heart Foundation; The “Kong Christian den Tiendes Fond”; The Novo Nordisk Foundation; Director Emil C. Hertz and Inger Hertz’s Foundation; Danish Medical Association Research Foundation; and H:S—Copenhagen Hospital Corporation, Copenhagen, Denmark. Dr. Christiansen’s address is: Department of Clinical Biochemistry, Statens Serum Institut, 5 Artillerivej, DK-2300 S., Copenhagen, Denmark. E-mail: mic@ssi.dk. Manuscript received October 8, 2000; revised manuscript received and accepted December 28, 2000.

The present paper presents a review of simple analytical models available in the literature for assessment of structural dynamic and aerodynamic performance of suspension bridges. Analytical predictions are compared to results obtained from structural FEM-models and comprehensive wind tunnel tests carried out for a box girder suspension bridge of 1624 meter main span. Satisfactory correlation is obtained for basic natural frequencies and for flutter and buffeting predictions. A modification to the Selberg formula is suggested which accounts for the enhancement of aerodynamic stability through a windward shift of the section centre of gravity.

Contact sensitivity to picryl chloride was investigated by means of the ear swelling test and a radiometric test in order to establish optimal experimental conditions for these assays. Contact sensitivity was demonstrated as soon as 2 days after sensitization, with a maximum reaction 3-4 days after sensitization, when a 48 hr test reaction was registered. The test reaction was followed for 72 hr and maximum was arrived at after 24 hr and 48 hr for the ear swelling test and the radiometric test, respectively. Optimal sensitization was reached with a 7% solution of picryl chloride and a maximum test reaction was found with 0.75-1.0% picryl chloride. It is concluded that both assays measure contact sensitivity in quantitative terms and a future replacement of the guinea pig maximization test is discussed.