Search

Abstract Background Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent–offspring trios and proband only analysis. Methods We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. Results Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. Conclusion CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Abstract Background Preeclampsia, one of the most lethal pregnancy-related diseases, is associated with the disruption of uterine spiral artery remodeling during placentation. However, the early molecular events leading to preeclampsia remain unknown. Results By analyzing placentas from preeclampsia, non-preeclampsia, and twin pregnancies with selective intrauterine growth restriction, we show that the pathogenesis of preeclampsia is attributed to immature trophoblast and maldeveloped endothelial cells. Delayed epigenetic reprogramming during early extraembryonic tissue development leads to generation of excessive immature trophoblast cells. We find reduction of de novo DNA methylation in these trophoblast cells results in selective overexpression of maternally imprinted genes, including the endoretrovirus-derived gene PEG10 (paternally expressed gene 10). PEG10 forms virus-like particles, which are transferred from the trophoblast to the closely proximate endothelial cells. In normal pregnancy, only a low amount of PEG10 is transferred to maternal cells; however, in preeclampsia, excessive PEG10 disrupts maternal vascular development by inhibiting TGF-beta signaling. Conclusions Our study reveals the intricate epigenetic mechanisms that regulate trans-generational genetic conflict and ultimately ensure proper maternal–fetal interface formation.

Abstract Background β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. Results In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Conclusion Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Abstract Objective To share our experience on prenatal diagnosis of 7q11.23 microduplication syndrome and to further delineate the fetal phenotypes of the syndrome. Methods A retrospective study was conducted to evaluate seven cases of dup7q11.23 syndrome diagnosed prenatally by chromosomal microarray (CMA). Clinical data were reviewed, including maternal characteristics, indications for prenatal diagnosis, sonographic findings, CMA results, pregnancy outcomes and follow-ups. Results Seven cases, including 2 pairs of MCDA twins, were prenatally identified with dup7q11.23 syndrome. The most common prenatal sonographic features were ventriculomegaly, low-lying conus medullaris, and dilated ascending aorta. All 7 fetuses presented with typical 7q11.23 duplications (1.40–1.55 Mb). Parental chromosome analysis was performed in four pairs of parents, and indicated that the duplications of Case 6 and 7 were inherited from their asymptomatic mother. Conclusion Our case series suggest that prenatal features of dup7q11.23 cases are diversified, with ventriculomegaly and low-lying conus medullaris being the most common intrauterine phenotypes. Additionally, cleft palate, dilated ascending aorta, and renal abnormalities were also observed, and should be taken into consideration in subsequent studies.

Abstract Background Trisomy 16 (T16) is thought to be the most frequent chromosome abnormality at conception, which is often associated with a high risk of abnormal outcomes. Methods A retrospective analysis of 14 cases with high risk of T16 by noninvasive prenatal testing (NIPT) was conducted. All cases in the analysis involved prenatal diagnosis, karyotyping and chromosomal microarray analysis. Case reports NIPT detected 12 cases of T16 and 2 cases of T16 mosaicism. Prenatal diagnosis confirmed 5 true positive cases and 9 false positive cases. Among the 5 true positive cases, 3 cases had ultrasound abnormalities. All of the 9 false positive cases continued their pregnancies. The newborns who were from these 9 false positive cases except 1 case (case 7) had low birth weights (

Abstract Objective To evaluate the performance of noninvasive prenatal testing (NIPT) and NIPT-PLUS for the detection of genome-wide microdeletion and microduplication syndromes (MMSs) at different sequencing depths. The NIPT sequencing depth was 0.15X, and the data volume was 3 million reads; the NIPT-PLUS sequencing depth was 0.4X, and the data volume was 8 million reads. Methods A cohort of 50,679 pregnancies was recruited. A total of 42,969 patients opted for NIPT, and 7710 patients opted for NIPT-PLUS. All high-risk cases were advised to undergo invasive prenatal diagnosis and were followed up. Results A total of 373 cases had a high risk of a copy number variation (CNV) as predicted by NIPT and NIPT-PLUS: NIPT predicted 250 high-risk CNVs and NIPT-PLUS predicted 123. NIPT-PLUS increased the detection rate by 1.02% (0.58% vs 1.60%, p < 0.001). A total of 291 cases accepted noninvasive prenatal diagnosis, with 197 cases of NIPT and 94 cases of NIPT-PLUS. The PPV of CNV > 10 Mb for NIPT-PLUS was significantly higher than that for NIPT (p = 0.02). The total PPV of NIPT-PLUS was 12.56% higher than that of NIPT (43.61% vs 30.96%, p = 0.03). Conclusion NIPT-PLUS had a better performance in detecting CNVs in terms of the total detection rate and total PPV. However, great care must be taken in presenting results and providing appropriate counseling to patients when deeper sequencing is performed in clinical practice.

Abstract Background Small subchromosomal deletions and duplications caused by copy number variants (CNVs) can now be detected with noninvasive prenatal testing (NIPT) technology. However, the clinical utility and validity of this screening for CNVs are still unknown. Here, we discuss some special conditions in which both cases simultaneously exhibited false positives caused by maternal CNVs and false negatives due to limitations of the technology. Case presentation In case 1, NIPT indicated a 1.1 Mb deletion at 21q21.1, but the umbilical cord for array CGH (aCGH) revealed a 422 kb deletion at 15q13.3. Peripheral blood of the parents for aCGH showed a 1.1 Mb deletion at 21q21.1 in the mother’s sample, and the same deletion at 15q13.3 was detected in the father’s blood. In case 2, NIPT showed a 1.5 Mb deletion at 22q11.21, but aCGH of amniocytes revealed a 1.377 Mb duplication rather than a 1.5 Mb deletion at 22q11.21. Furthermore, aCGH analysis of the parental blood revealed a 647 kb deletion at 22q11.21 in the mother and a 2.8 Mb duplication of 22q11.21 in the father. Conclusions Our findings not only highlight the significance of diagnostic testing following a positive cfDNA sequencing result but also the necessity for additional analytical and clinical validation before routine use in practice.

Abstract Background The identification of cell-free fetal DNA (cffDNA) facilitated non-invasive prenatal screening (NIPS) through analysis of cffDNA in maternal plasma. However, challenges regarding its clinical implementation become apparent. Factors affecting fetal fraction should be clarified to guide its clinical application. Results A total of 13,661 pregnant subjects with singleton pregnancies who undertook NIPS were included in the study. Relationship of gestational age, maternal BMI, and maternal age with the cffDNA fetal fraction in maternal plasmas for NIPS was investigated. Compared with 13 weeks (12.74%) and 14–18 weeks group (12.73%), the fetal fraction in gestational ages of 19–23 weeks, 24–28 weeks, and more than 29 weeks groups significantly increased to 13.11%, 16.14%, and 21.17%, respectively (P

Abstract Background Hearing loss is a prevalent sensorineural disorder and a major public health issue in China. It is suggested that half of all cases of hearing loss can be prevented through public health measures. However, national strategies for hearing healthcare are not implemented well in Guangdong and some other regions in China. Methods To develop a community-based service model for the prevention and control of hearing loss in Guangdong, we integrated the model with multiple maternal and child healthcare models, and set up a series of clinical programs along with an optimum timeline for the preventive measures and intervention treatments to take place. A total of 36,090 families were enrolled in the study, including 358 high-risk families and 35,732 general-risk families. Results The study lasted for 6.5 years, and 30,769 children were born during that period. A total of 42 children were born with congenital deafness; 17 of them were born into families with advanced genetic risks for hearing loss, 9 were born with specific medical conditions, and 16 were born into general-risk families. About one third of them were diagnosed prenatally, others were diagnosed within 3 months of age, and 72% of them received interventions initiated before 6 months of age. 13 children presented with delayed hearing loss; 9 of them were diagnosed with delayed hereditary sensorineural deafness in neonatal period, and 4 were diagnosed within 3 months after onset. Timely interventions were provided to them, with appropriate referrals and follow-ups. Beside these, 80 families were identified with genetic susceptibility to aminoglycoside ototoxicity. Detailed medication guides were provided to prevent aminoglycoside-induced hearing loss. Moreover, through health education and risk reduction strategies, the prevalence of TORCH syndrome decreased from 10.7 to 5.2 per 10,000. Additionaly, the awareness rates of health knowledge about hearing healthcare significantly increased in the cohort. Conclusions Adapting national strategies for local or district projects could be an important step in implementing hearing loss prevention measures, and developing community-based service models could be of importance in carrying them out.

Abstract Background Phenotypic difference is general in Mendelian disease. Due to the extremely low incidence for a single disease, phenotype spectrum needs to be expanded. Meanwhile, earlier knowledge says patients who suffered from two kinds of different Mendelian disease are very rare. Case presentation We describe a case of neonatal male with genital anomalies, growth delay, skin hyperpigmentation, chronic lung disease with recurrent infection, anemia, and severe deafness. Without any clear etiology after routine workflow, whole exome sequencing was carried on. A pathogenic de novo SAMD9 mutation and compound heterozygous likely-pathogenic variants in SLC19A2 were identified. Some symptoms were improved after the patient was treated with vitamin B1. Unfortunately, the boy died from sepsis and multiple organ failure before 1 year old. Conclusion Combining the phenotype and clinical progress of treatment, we report that it is the first case of a patient with both MIRAGE syndrome and TRMA syndrome.

Abstract Background This study was an evaluation of the role of noninvasive prenatal testing (NIPT) in the detection of trisomy 7 in prenatal diagnosis. Method A total of 35 consecutive cases underwent screening for trisomies by cell-free DNA testing between April 2015 and November 2017 due to suspicious NIPT results; these cases represented 0.11% of patients (35/31,250) with similar frequencies of abnormal results among the laboratories performing the tests. NIPT was offered to further screen for common fetal chromosomal abnormalities. Karyotype analysis, chromosomal microarray analysis (CMA), and next-generation sequencing (NGS) were used to detect 20, 14, and 25 patients, respectively, who accepted confirmatory diagnostic testing. Results High-risk results by NIPT were recorded for trisomy 7 alone in 29 women: dual aneuploidy in 4 patients and multiple aneuploidy in 2 patients. Karyotype analysis of amniotic fluid cells was normal in all 20 pregnancies, suggesting a probability of confined placental mosaicism. Further CMA data were obtained in 14 of the cases mentioned above, and 2 fetuses were detected with positive results with copy number variation. The NGS results suggested that all these samples were placental chimerisms of chromosome 7, except for one sample that was found to be an additional chimerism of chromosome 2, which was also consistent with the NIPT result. Conclusion Our results may be useful for the counseling of pregnant women in the detection of trisomy 7 by NIPT.

Abstract Background Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are clinically distinct neurodevelopmental disorders caused by absence of paternally or maternally expressed imprinted genes on chromosome 15q11.2-q13.3 region. Methods 3331 individuals was recruited from June 2013 to December 2016 under an institutional review board-approved protocol of informed consent. The methylation-specific PCR was employed as a first-tier screening test. The multiplex-fluorescent-labeled STR linkage analysis was carried out to define the underlying genetic mechanisms. The chromosomal microarray analysis was employed to identify chromosomal breakpoints in confirmed cases, and to detect other chromosomal abnormalities in undiagnosed cases. Genetic counseling and recurrence risk assessment were provided to families with affected individuals. Results The methylation-specific PCR identified 36 PWS suspected patients and 13 AS suspected patients. UBE3A sequence analysis identified another 1 patient with AS. The STR linkage analysis define the underlying genetic mechanisms. Thirty PWS patients were with paternal deletions on chromosome region 15q11-q13, 5 with isodisomic uniparental disomy and 1 with mixed segmental isodisomic/ heterodisomic uniparental disomy of maternal chromosome 15. Twelve AS patients were with maternal deletions, 1 with isodisomic uniparental disomy and 1 with UBE3A gene mutation. The chromosomal microarray analysis identified chromosomal breakpoints in confirmed cases, and detected chromosomal abnormalities in another 4 patients with clinically overlapped features but tested negative for PWS/AS. Genetic counseling was offered to all families with affected individuals. Conclusions Identifying the disorders at early age, establishing the molecular mechanisms, carrying out treatment intervention and close monitoring can significantly improve the prognosis of PWS/AS patients.

Abstract Background Isodicentric chromosomes are the most frequent structural aberrations of human Y chromosome, and usually present in mosaicism with a 45, X cell line. Several cytogenetic techniques have been used for diagnosing of uncommon abnormal sex chromosome abnormalities in prenatal cases. Case presentation A 26-year-old healthy woman was referred to our centre at 24 weeks of gestation age. Ultrasound examination indicated she was pregnant with imbalanced development of twins. Amniocentesis was referred to the patient for further genetic analyses. Quantitative Fluorescent Polymerase Chain Reaction (QF-PCR) indicated the existence of an extra Y chromosome or a structurally abnormal Y chromosome in primary amniotic cells. Chromosome microarray (CMA) analysis based on Comparative Genomic Hybridization (aCGH) platform was performed and identified a 10.1 Mb deletion on Y chromosome in 8-days cultured amniotic cells. Combined with the data of QF-PCR and aCGH, karyotyping and fluorescence in situ hybridization (FISH) revealed a mosaic cell line of 45,X[27]/46,X, idic(Y)(q11.22) [14] in fetus.The karyotyping analysis of cord blood sample was consistent with amniotic cells. The parental karyotypes were normal, which indicated this mosaic case of isodicentric Y (idicY) chromosomes of the fetus was a de novo case. Conclusion Several approaches have been used for the detection of numerical and structural chromosomal alterations of on prenatal cases. Our report supported the essential role of incorporating multiple genetic techniques in prenatal diagnosing and genetic counseling of potential complex sex chromosomal rearrangements.

Abstract Background Cell-free fetal DNA in maternal plasma represents a source of fetal genetic material that can be sampled noninvasively. There are ample studies confirming the accuracy of NIPT in singleton pregnancies, but there is still relatively little studies demonstrate the feasibility and clinical application of a NIPT for fetal aneuploidy screening in twin pregnancies. Results In this study, we have finished 432 twin pregnancies screening by NIPT. There were 4 double chorionic dichorionic diamniotic (DCDA) cases of true positive NIPT results, including 1of T18 and 3 of T21, and 1 monochorionic diamniotic (MCDA) cases of true positive NIPT results, including 1of T21. The combined false-positive frequency for trisomies 21, 18 was 0%. Furthermore, there were 2 cases of false positive NIPT results, including 1 of T7 and 1 of sex chromosome aneuploidy. There was no false negative case, which gave a combined sensitivity and specificity of 100 and 99.53% respectively. Conclusion Our study demonstrated NIPT performed well in the detection of trisomy 21 in twin pregnancy. It is feasible and clinical applicable of NIPT for fetal aneuploidy screening in twin pregnancies. But, it needs a large number of clinical samples to demonstrate the applicability of other chromosomal abnormalities besides trisomies 21 and 18 in both singleton pregnancies and twin pregnancies.

Abstract Background The non-invasive prenatal testing that evaluates circulating cell free DNA, and has been established as an additional pregnancy test for detecting the common fetal trisomies 21, 18 and 13 is rapidly revolutionizing prenatal screening as a result of its increased sensitivity and specificity. However, false positive and false negative results still exist. Case presentation We presented a case in which the non-invasive prenatal testing results were normal at 15 gestational age (GA), but an ultrasound examination at 30GA showed that the fetus had heart abnormalities, and the third trimester ultrasound at 33GA noted multiple anomalies including a 3.0 mm ventricular septal defect. Along with cordocentesis at 33GA, the cord blood sample cytogenetics analysis showed a mos 47,XN,+18[61]/46,XN[39] T18 karyotype. Six placental biopsies confirmed that the chromosome 18 placenta chimerism ratio had changed from 33% to 72%. Ultimately, the pregnancy was interrupted at 34GA. Conclusions We presented this case to highlight the need to clearly explain false positive or false negative results to patients. We believe that this information will also influence the development of future diagnostic test methodologies.