Search

HIV-1 often acquires drug-resistant mutations in spite of the benefits of antiretroviral therapy (ART). HIV-1 integrase (IN) is essential for the concerted integration of HIV-1 DNA into the host genome. IN further contributes to HIV-1 RNA binding, which is required for HIV-1 maturation. Non-catalytic-site integrase inhibitors (NCINIs) have been developed as allosteric IN inhibitors, which perform anti-HIV-1 activity by a multimodal mode of action such as inhibition of the IN-lens epithelium-derived growth factor (LEDGF)/p75 interaction in the early stage and disruption of functional IN multimerization in the late stage of HIV-1 replication. Here, we show that IN undergoes an adaptable conformational change to escape from NCINIs. We observed that NCINI-resistant HIV-1 variants have accumulated 4 amino acid mutations by passage 26 (P26) in the IN-encoding region. We employed high-performance liquid chromatography (HPLC), thermal stability assays, and X-ray crystallographic analysis to show that some amino acid mutations affect the stability and/or dimerization interface of the IN catalytic core domains (CCDs), potentially resulting in the severely decreased multimerization of full-length IN proteins (IN undermultimerization). This undermultimerized IN via NCINI-related mutations was stabilized by HIV-1 RNA and restored to the same level as that of wild-type HIV-1 in viral particles. Recombinant HIV-1 clones with IN undermultimerization propagated similarly to wild-type HIV-1. Our study revealed that HIV-1 can eventually counteract NCINI-induced IN overmultimerization by IN undermultimerization as one of the escape mechanisms. Our findings provide information on the understanding of IN multimerization with or without HIV-1 RNA and may influence the development of anti-HIV-1 strategies. IMPORTANCE Understanding the mechanism of HIV-1 resistance to anti-HIV-1 drugs could lead to the development of novel drugs with increased efficiency, resulting in more effective ART. ART composed of more potent and long-acting anti-HIV-1 drugs can greatly improve drug adherence and also provide HIV-1 prevention such as preexposure prophylaxis. NCINIs with a multimodal mode of action exert potent anti-HIV-1 effects through IN overmultimerization during HIV-1 maturation. However, HIV-1 can acquire some mutations that cause IN undermultimerization to alleviate NCINI-induced IN overmultimerization. This undermultimerized IN was efficiently stabilized by HIV-1 RNA and restored to the same level as that of wild-type HIV-1. Our findings revealed that HIV-1 eventually acquires such a conformational escape reaction to overcome the unique NCINI actions. The investigation into drug-resistant mutations associated with HIV-1 protein multimerization may facilitate the elucidation of its molecular mechanism and functional multimerization, allowing us to develop more potent anti-HIV-1 drugs and unique treatment strategies., (Copyright © 2020 American Society for Microbiology.)

Unlabelled: We identified three nonpeptidic HIV-1 protease inhibitors (PIs), GRL-015, -085, and -097, containing tetrahydropyrano-tetrahydrofuran (Tp-THF) with a C-5 hydroxyl. The three compounds were potent against a wild-type laboratory HIV-1 strain (HIV-1(WT)), with 50% effective concentrations (EC50s) of 3.0 to 49 nM, and exhibited minimal cytotoxicity, with 50% cytotoxic concentrations (CC50) for GRL-015, -085, and -097 of 80, >100, and >100 μM, respectively. All the three compounds potently inhibited the replication of highly PI-resistant HIV-1 variants selected with each of the currently available PIs and recombinant clinical HIV-1 isolates obtained from patients harboring multidrug-resistant HIV-1 variants (HIVMDR). Importantly, darunavir (DRV) was >1,000 times less active against a highly DRV-resistant HIV-1 variant (HIV-1DRV(R) P51); the three compounds remained active against HIV-1DRV(R) P51 with only a 6.8- to 68-fold reduction. Moreover, the emergence of HIV-1 variants resistant to the three compounds was considerably delayed compared to the case of DRV. In particular, HIV-1 variants resistant to GRL-085 and -097 did not emerge even when two different highly DRV-resistant HIV-1 variants were used as a starting population. In the structural analyses, Tp-THF of GRL-015, -085, and -097 showed strong hydrogen bond interactions with the backbone atoms of active-site amino acid residues (Asp29 and Asp30) of HIV-1 protease. A strong hydrogen bonding formation between the hydroxyl moiety of Tp-THF and a carbonyl oxygen atom of Gly48 was newly identified. The present findings indicate that the three compounds warrant further study as possible therapeutic agents for treating individuals harboring wild-type HIV and/or HIVMDR., Importance: Darunavir (DRV) inhibits the replication of most existing multidrug-resistant HIV-1 strains and has a high genetic barrier. However, the emergence of highly DRV-resistant HIV-1 strains (HIVDRV(R) ) has recently been observed in vivo and in vitro. Here, we identified three novel HIV-1 protease inhibitors (PIs) containing a tetrahydropyrano-tetrahydrofuran (Tp-THF) moiety with a C-5 hydroxyl (GRL-015, -085, and -097) which potently suppress the replication of HIVDRV(R) . Moreover, the emergence of HIV-1 strains resistant to the three compounds was considerably delayed compared to the case of DRV. The C-5 hydroxyl formed a strong hydrogen bonding interaction with the carbonyl oxygen atom of Gly48 of protease as examined in the structural analyses. Interestingly, a compound with Tp-THF lacking the hydroxyl moiety substantially decreased activity against HIVDRV(R) . The three novel compounds should be further developed as potential drugs for treating individuals harboring wild-type and multi-PI-resistant HIV variants as well as HIVDRV(R) ., (Copyright © 2016, American Society for Microbiology. All Rights Reserved.)

The type IV pili of plasmid R64 belonging to the type IVB group are required only for liquid mating. They consist of the major and minor components PilS pilin and PilV adhesin, respectively. PilS pilin is first synthesized as a 22-kDa prepilin from the pilS gene and is then processed to a 19-kDa mature pilin by PilU prepilin peptidase. In a previous genetic analysis, we identified four classes of the pilS mutants (T. Horiuchi and T. Komano, J. Bacteriol. 180:4613-4620, 1998). The products of the class I pilS mutants were not processed by prepilin peptidase; the products of the class II mutants were not secreted; in the class III mutants type IV pili with reduced activities in liquid mating were produced; and in the class IV mutants type IV pili with normal activities were produced. Here, we describe a novel class, class V, of pilS mutants. Mutations in the pilS gene at Gly-56 or Tyr-57 produced type IV pili lacking PilV adhesin, which were inactive in liquid mating. Residues 56 and 57 of PilS pilin are suggested to function as an interface of PilS-PilV interactions.

Adeno-associated virus (AAV) integrates site specifically into the AAVS1 locus on human chromosome 19. Although recruitment of the AAV nonstructural protein Rep78/68 to the Rep binding site (RBS) on AAVS1 is thought to be an essential step, the mechanism of the site-specific integration, particularly, how the site of integration is determined, remains largely unknown. Here we describe the identification and characterization of a new cellular regulator of AAV site-specific integration. TAR RNA loop binding protein 185 (TRP-185), previously reported to associate with human immunodeficiency virus type 1 TAR RNA, binds to AAVS1 DNA. Our data suggest that TRP-185 suppresses AAV integration at the AAVS1 RBS and enhances AAV integration into a region downstream of the RBS. TRP-185 bound to Rep68 directly, changing the Rep68 DNA binding property and stimulating Rep68 helicase activity. We present a model in which TRP-185 changes the specificity of the AAV integration site from the RBS to a downstream region by acting as a molecular chaperone that promotes Rep68 complex formation competent for 3'-->5' DNA helicase activity.

The OspE2 product of Shigella spp., the expression of which is regulated by the mxiE gene, is secreted through a type III secretion system into host cells. We investigated the function of OspE2 of Shigella sonnei by using cultured epithelial cells. Cells invaded by an ospE2 deletion mutant altered their morphology into the rounding shape, which was not due to cell death, whereas cells invaded by the wild-type strain kept their cell shape intact. The ospE2 mutation did not affect initial cell entry and multiplication in cells, but the mutant formed smaller-than-normal plaques on cell monolayers, indicating a deficiency in cell-to-cell spread by the bacteria. An mxiE deletion mutant also showed changes in cell morphology and deficiency in bacterial spread to adjacent cells. In cells invaded by the ospE2 mutant, disturbance of actin stress fibers was prominent at 3 h after invasion. Analysis of OspE2 localization indicated that the OspE2 protein accumulated on focal contact-like structures in the infected host cells. These results suggest that colocalization of the OspE2 protein in the focal contacts of infected cells may function to maintain an intact cell morphology. The morphological change induced by invasion of the ospE2 mutant may affect secondary bacterial transmission.

IncI1 plasmid R64 encodes a type IV pilus called a thin pilus, which includes PilV adhesins. Seven different sequences for the C-terminal segments of PilV adhesins can be produced by shufflon DNA rearrangement. The expression of the seven PilV adhesins determines the recipient specificity in liquid matings of plasmid R64. Salmonella enterica serovar Typhimurium LT2 was recognized by the PilVA' and PilVB' adhesins, while Escherichia coli K-12 was recognized by the PilVA', PilVC, and PilVC' adhesins. Lipopolysaccharide (LPS) on the surfaces of recipient cells was previously shown to be the specific receptor for the seven PilV adhesins. To identify the specific receptor structures of LPS for various PilV adhesins, R64 liquid matings were carried out with recipient cells consisting of various S. enterica serovar Typhimurium LT2 and E. coli K-12 waa mutants and their derivatives carrying various waa genes of different origins. From the mating experiments, including inhibition experiments, we propose that the GlcNAc(alpha1-2)Glc and Glc(alpha1-2)Gal structures of the LPS core of S. enterica serovar Typhimurium LT2 function as receptors for the PilVB' and PilVC' adhesins, respectively, while the PilVC' receptor in the wild-type LT2 LPS core may be masked. We further propose that the GlcNAc(beta1-7)Hep and Glc(alpha1-2)Glc structures of the LPS core of E. coli K-12 function as receptors for the PilVC and PilVC' adhesins, respectively.

The origin of transfer (oriT) of a bacterial plasmid plays a key role in both the initiation and termination of conjugative DNA transfer. We have previously shown that a conjugation-dependent recombination between the tandem R64 oriT sequences cloned into pHSG398 occurred, resulting in the deletion of the intervening sequence during DNA transfer. In this study, we tandemly cloned two oriT sequences of IncI1 plasmid R64 into pUC18. Specific recombination between the two oriT sequences in pUC18 was observed within Escherichia coli cells harboring mini-R64. This recombination was found to be independent of both the recA gene and conjugative DNA transfer. The R64 genes nikA and nikB, required for conjugal DNA processing, were essential for this recombination. Although a fully active 92-bp oriT sequence was required at one site for the recombination, the 44-bp oriT core sequence was sufficient at the other site. Furthermore, when two oriT sequences were tandemly cloned into the single-stranded phage vector M13 and propagated within E. coli cells, recombination between the two oriT sequences was observed, depending on the nikB gene. These results suggest that the R64 relaxase protein NikB can execute cleavage and rejoining of single-stranded oriT DNA within E. coli cells, whereas such a reaction in double-stranded oriT DNA requires collaboration of the two relaxosome proteins, NikA and NikB.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development.

During lysogenization of myxophage Mx8, phage DNA can be integrated into the attB site of the Myxococcus xanthus chromosome through site-specific recombination. We previously demonstrated that the Mx8 attP site is located within the coding sequence of the Mx8 intP gene. Hence, the integration of Mx8 into the M. xanthus chromosome results in the conversion of the 112-amino-acid C-terminal segment of the IntP protein into a 13-amino-acid C-terminal segment of a new protein, IntR. To examine whether IntR is active for Mx8 excision, we have constructed a series of plasmids carrying various lengths of the intP-attP or intR-attR regions as well as the lacZ gene. The integrated Mx8 was excised at a high frequency, indicating that IntR is active for the excision. For Mx8 excision, a gene designated xis was shown to be required in addition to intR.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

We have previously shown that the pilL, pilN, pilQ, pilS, pilU, and pilV genes of plasmid R64 encode outer membrane lipoprotein, secretin, cytoplasmic ATPase, major pilin, prepilin peptidase, and minor pilin, respectively, which are required for thin-pilus formation. In this work, we characterized the products of the remaining essential genes, pilK, pilM, pilO, pilP, pilR, and pilT, with regard to their localization and processing. Overexpression systems containing pilM, pilO, and pilP genes fused with N-terminal glutathione S-transferase (GST) or a His tag were constructed. Overproduced proteins were purified and used to raise specific antibodies. Localization of PilM, PilO, and PilP proteins was performed by Western blot analysis with anti-GST-PilM, anti-PilO, and anti-PilP antibodies, respectively. The pilK, pilR, and pilT products were produced with a C-terminal His tag and then detected by anti-His tag antibody. Subcellular fractionation experiments with Escherichia coli cells producing R64 thin pili revealed that PilK, PilM, and PilR are inner membrane proteins, and PilP and PilT are periplasmic proteins. PilO protein was localized to the outer membrane in the presence of other Pil proteins, whereas it was localized to the cytoplasm in the absence of these proteins. Furthermore, the cleavage site of PilP protein was determined by N-terminal amino acid sequencing of purified mature PilP protein. We predict that PilK, PilM, PilO, PilP, and PilT proteins function as the components of the pilin transport apparatus and thin-pilus basal body.