Search

Antibiotic-tolerant Staphylococcus aureus poses a great challenge to clinicians as well as to microbiological laboratories and is one reason for treatment failure. Antibiotic-tolerant strains survive transient antibiotic exposure despite being fully susceptible in vitro . Thus, fast and reliable methods to detect tolerance in the routine microbiology laboratory are urgently required. We therefore evaluated the feasibility of the replica plating tolerance isolation system (REPTIS) to detect antibiotic tolerance in Staphylococcus aureus isolates derived directly from patients suffering from different types of infections and investigated possible connections to clinical presentations and patient characteristics. One hundred twenty-five S. aureus isolates were included. Replica plating of the original resistance testing plate was used to assess regrowth in the zones of inhibition, indicating antibiotic tolerance. Bacterial regrowth was assessed after 24 and 48 h of incubation, and an overall regrowth score (ORS) was assigned. Regrowth scores were compared to the clinical presentation. Bacterial regrowth was high for most antibiotics targeting protein synthesis and relatively low for antibiotics targeting other cellular functions such as DNA replication, transcription, and cell wall synthesis, with the exception of rifampin. Isolates with a blaZ penicillinase had lower regrowth in penicillin and ampicillin. Low ORSs were more prevalent among isolates recovered from patients with immunosuppression or methicillin-resistant S. aureus (MRSA) isolates. In conclusion, REPTIS is useful to detect antibiotic tolerance in clinical microbiological routine diagnostics. Further studies should evaluate the impact of rapid detection of antibiotic tolerance as a clinical decision-making tool for tailored antibiotic treatments.

Corynebacterium spp. are rarely considered pathogens, but data on Corynebacterium spp. as a cause of orthopedic infections are sparse. Therefore, we asked how often Corynebacterium spp. caused an infection in a defined cohort of orthopedic patients with a positive culture. In addition, we aimed to determine the species variety and the susceptibility of isolated strains to define potential treatment strategies. We retrospectively assessed all bone and joint samples that were collected between 2006 and 2015 from an orthopedic ward and that were positive for Corynebacterium spp. by culture. The isolates were considered relevant to an infection if the same Corynebacterium sp. was present in at least two samples. We found 97 orthopedic cases with isolation of Corynebacterium spp. (128 positive samples). These were mainly Corynebacterium tuberculostearicum ( n = 26), Corynebacterium amycolatum ( n = 17), Corynebacterium striatum ( n = 13), and Corynebacterium afermentans ( n = 11). Compared to the species found in a cohort of patients with positive blood cultures hospitalized in nonorthopedic wards, we found significantly more C. striatum - and C. tuberculostearicum -positive cases but no C. jeikeium -positive cases in our orthopedic cohort. Only 16 out of 66 cases (24.2%) with an available diagnostic set of at least two samples had an infection. Antibiotic susceptibility testing (AST) showed various susceptibility results for all antibiotics except vancomycin and linezolid, to which 100% of the isolates were susceptible. The rates of susceptibility of corynebacteria isolated from orthopedic samples and of isolates from blood cultures were comparable. In conclusion, our study results confirmed that a Corynebacterium sp. is most often isolated as a contaminant in a cohort of orthopedic patients. AST is necessary to define the optimal treatment in orthopedic infections., (Copyright © 2018 American Society for Microbiology.)

Aggregatibacter species are commensal bacteria of human mucosal surfaces that are sometimes involved in serious invasive infections. During the investigation of strains cultured from various clinical specimens, we encountered a coherent group of 10 isolates that could not be allocated to any validly named species by phenotype, mass spectrometry, or partial 16S rRNA gene sequencing. Whole-genome sequencing revealed a phylogenetic cluster related to but separate from Aggregatibacter aphrophilus The mean in silico DNA hybridization value for strains of the new cluster versus A. aphrophilus was 56% (range, 53.7 to 58.0%), whereas the average nucleotide identity was 94.4% (range, 93.9 to 94.8%). The new cluster exhibited aggregative properties typical of the genus Aggregatibacter Key phenotypic tests for discrimination of the new cluster from validly named Aggregatibacter species are alanine-phenylalanine-proline arylamidase, N -acetylglucosamine, and β-galactosidase. The name Aggregatibacter kilianii is proposed, with PN_528 (CCUG 70536 T or DSM 105094 T ) as the type strain., (Copyright © 2018 American Society for Microbiology.)

Diagnosis of Propionibacterium acnes bone and joint infection is challenging due to the long cultivation time of up to 14 days. We retrospectively studied whether reducing the cultivation time to 7 days allows accurate diagnosis without losing sensitivity. We identified patients with at least one positive P. acnes sample between 2005 and 2015 and grouped them into "infection" and "no infection." An infection was defined when at least two samples from the same case were positive. Clinical and microbiological data, including time to positivity for different cultivation methods, were recorded. We found 70 cases of proven P. acnes infection with a significant faster median time to positivity of 6 days (range, 2 to 11 days) compared to 9 days in 47 cases with P. acnes identified as a contamination (P < 0.0001). In 15 of 70 (21.4%) patients with an infection, tissue samples were positive after day 7 and in 6 patients (8.6%) after day 10 when a blind subculture of the thioglycolate broth was performed. The highest sensitivity was detected for thioglycolate broth (66.3%) and the best positive predictive values for anaerobic agar plates (96.5%). A prolonged transportation time from the operating theater to the microbiological laboratory did not influence time to positivity of P. acnes growth. By reducing the cultivation time to 7 days, false-negative diagnoses would increase by 21.4%; thus, we recommend that biopsy specimens from bone and joint infections be cultivated to detect P. acnes for 10 days with a blind subculture at the end., (Copyright © 2016, American Society for Microbiology. All Rights Reserved.)

We analyzed the diagnostic value of microorganisms cultured from negative-pressure-wound-therapy (NPWT) foam samples compared to that of microorganisms cultured from deep tissue samples from patients with vascular graft infections. The sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV) were 58%, 86%, 81%, and 66%, respectively. The diagnostic value of microbiological cultures from NPWT foams was poor., (Copyright © 2016, American Society for Microbiology. All Rights Reserved.)

Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has entered clinical laboratories, facilitating identification of bacteria. Here, we evaluated the MALDI Biotyper (Bruker Daltonics) for the identification of fastidious Gram-negative rods (GNR). Three sample preparation methods, direct colony transfer, direct transfer plus on-target formic acid preparation, and ethanol-formic acid extraction, were analyzed for 151 clinical isolates. Direct colony transfer applied with the manufacturer's interpretation criteria resulted in overall species and genus identification rates of 43.0% and 32.5%, respectively; 23.2% of the isolates were not identified, and two misidentifications (1.3%) were observed. The species identification rates increased to 46.4% and 53.7% for direct transfer plus formic acid preparation and ethanol-formic acid extraction, respectively. In addition, we evaluated score value cutoff alterations. The identification rates hardly increased by reducing the genus cutoff, while reducing the 2.0 species cutoff to 1.9 and to 1.8 increased the identification rates to up to 66.2% without increasing the rate of misidentifications. This study shows that fastidious GNR can reliably be identified using the MALDI Biotyper. However, the identification rates do not reach those of nonfastidious GNR such as the Enterobacteriaceae. In addition, two approaches optimizing the identification of fastidious GNR by the MALDI Biotyper were demonstrated: formic acid-based on-target sample treatment and reductions in cutoff scores to increase the species identification rates., (Copyright © 2016, American Society for Microbiology. All Rights Reserved.)

Reported matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) identification rates of Gram-positive rods (GPR) are low compared to identification rates of Gram-positive cocci. In this study, three sample preparation methods were compared for MALDI-TOF MS identification of 190 well-characterized GPR strains: direct transfer, direct transfer-formic acid preparation, and ethanol-formic acid extraction. Using the interpretation criteria recommended by the manufacturer, identification rates were significantly higher for direct transfer-formic acid preparation and ethanol-formic acid extraction than for direct transfer. Reducing the species cutoff from 2.0 to 1.7 significantly increased species identification rates. In a subsequent prospective study, 215 clinical GPR isolates were analyzed by MALDI-TOF MS, and the results were compared to those for identification using conventional methods, with discrepancies being resolved by 16S rRNA and rpoB gene analysis. Using the direct transfer-formic acid preparation and a species cutoff of 1.7, congruencies on the genus and species levels of 87.4% and 79.1%, respectively, were achieved. In addition, the rate of nonidentified isolates dropped from 12.1% to 5.6% when using an extended database, i.e., the Bruker database amended by reference spectra of the 190 GPR of the retrospective study. Our data demonstrate three ways to improve GPR identification by the Bruker MALDI Biotyper, (i) optimize sample preparation using formic acid, (ii) reduce cutoff scores for species identification, and (iii) expand the database. Based on our results, we suggest an identification algorithm for the clinical laboratory combining MALDI-TOF MS with nucleic acid sequencing.

This study compared three sample preparation methods (direct transfer, the direct transfer-formic acid method with on-target formic acid treatment, and ethanol-formic acid extraction) for the identification of Gram-positive cocci with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS). A total of 156 Gram-positive cocci representing the clinically most important genera, Aerococcus, Enterococcus, Staphylococcus, and Streptococcus, as well as more rare genera, such as Gemella and Granulicatella, were analyzed using a Bruker MALDI Biotyper. The rate of correct genus-level identifications was approximately 99% for all three sample preparation methods. The species identification rate was significantly higher for the direct transfer-formic acid method and ethanol-formic acid extraction (both 77.6%) than for direct transfer (64.1%). Using direct transfer-formic acid compared to direct transfer, the total time to result was increased by 22.6%, 16.4%, and 8.5% analyzing 12, 48, and 96 samples per run, respectively. In a subsequent prospective study, 1,619 clinical isolates of Gram-positive cocci were analyzed under routine conditions by MALDI-TOF MS, using the direct transfer-formic acid preparation, and by conventional biochemical methods. For 95.6% of the isolates, a congruence between conventional and MALDI-TOF MS identification was observed. Two major limitations were found using MALDI-TOF MS: the differentiation of members of the Streptococcus mitis group and the identification of Streptococcus dysgalactiae. The Bruker MALDI Biotyper system using the direct transfer-formic acid sample preparation method was shown to be a highly reliable tool for the identification of Gram-positive cocci. We here suggest a practical algorithm for the clinical laboratory combining MALDI-TOF MS with phenotypic and molecular methods.

Two mechanisms account for AmpC activity in Escherichia coli, namely, mutations in the ampC promoter and attenuator regions resulting in ampC overexpression and acquisition of plasmid-carried ampC genes. In this study, we analyzed 51 clinical E. coli isolates with reduced susceptibility to amoxicillin-clavulanic acid, piperacillin-tazobactam, or extended-spectrum cephalosporins for the presence of AmpC production. Three phenotypic AmpC confirmation assays (cefoxitin-cloxacillin disk diffusion test, cefoxitin-EDTA disk diffusion test, and AmpC Etest) were compared for the detection of AmpC activity. All 51 isolates were characterized genetically by mutational analysis of the chromosomal ampC promoter/attenuator region and by PCR detection of plasmid-carried ampC genes. Altogether, 21/51 (41%) E. coli isolates were considered true AmpC producers. AmpC activity due to chromosomal ampC promoter/attenuator mutations was found in 12/21 strains, and plasmid-carried ampC genes were detected in 8/21 isolates. One strain contained both ampC promoter mutations and a plasmid-carried ampC gene. All three phenotypic tests were able to detect the majority (>90%) of AmpC-positive strains correctly. Cefoxitin resistance was found to be a discriminative parameter, detecting 20/21 AmpC-producing strains. Susceptibility to extended-spectrum cephalosporins, e.g., ceftriaxone, ceftazidime, and cefotaxime, was found in 9 of the 21 AmpC-positive strains. Considering the elevated zone diameter breakpoints of the 2010 CLSI guidelines, 2/21 AmpC-positive strains were categorized as susceptible to extended-spectrum cephalosporins.

Ninety strains of a collection of well-identified clinical isolates of gram-negative nonfermentative rods collected over a period of 5 years were evaluated using the new colorimetric VITEK 2 card. The VITEK 2 colorimetric system identified 53 (59%) of the isolates to the species level and 9 (10%) to the genus level; 28 (31%) isolates were misidentified. An algorithm combining the colorimetric VITEK 2 card and 16S rRNA gene sequencing for adequate identification of gram-negative nonfermentative rods was developed. According to this algorithm, any identification by the colorimetric VITEK 2 card other than Achromobacter xylosoxidans, Acinetobacter sp., Burkholderia cepacia complex, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia should be subjected to 16S rRNA gene sequencing when accurate identification of nonfermentative rods is of concern.

Over a period of 26 months, we have evaluated in a prospective fashion the use of 16S rRNA gene sequencing as a means of identifying clinically relevant isolates of nonfermenting gram-negative bacilli (non-Pseudomonas aeruginosa) in the microbiology laboratory. The study was designed to compare phenotypic with molecular identification. Results of molecular analyses were compared with two commercially available identification systems (API 20 NE, VITEK 2 fluorescent card; bioMérieux, Marcy l'Etoile, France). By 16S rRNA gene sequence analyses, 92% of the isolates were assigned to species level and 8% to genus level. Using API 20 NE, 54% of the isolates were assigned to species and 7% to genus level, and 39% of the isolates could not be discriminated at any taxonomic level. The respective numbers for VITEK 2 were 53%, 1%, and 46%, respectively. Fifteen percent and 43% of the isolates corresponded to species not included in the API 20 NE and VITEK 2 databases, respectively. We conclude that 16S rRNA gene sequencing is an effective means for the identification of clinically relevant nonfermenting gram-negative bacilli. Based on our experience, we propose an algorithm for proper identification of nonfermenting gram-negative bacilli in the diagnostic laboratory.

Over a period of 18 months we have evaluated the use of 16S ribosomal DNA (rDNA) sequence analysis as a means of identifying aerobic catalase-negative gram-positive cocci in the clinical laboratory. A total of 171 clinically relevant strains were studied. The results of molecular analyses were compared with those obtained with a commercially available phenotypic identification system (API 20 Strep system; bioMérieux sa, Marcy l'Etoile, France). Phenotypic characterization identified 67 (39%) isolates to the species level and 32 (19%) to the genus level. Seventy-two (42%) isolates could not be discriminated at any taxonomic level. In comparison, 16S rDNA sequencing identified 138 (81%) isolates to the species level and 33 (19%) to the genus level. For 42 of 67 isolates assigned to a species with the API 20 Strep system, molecular analyses yielded discrepant results. Upon further analysis it was concluded that among the 42 isolates with discrepant results, 16S rDNA sequencing was correct for 32 isolates, the phenotypic identification was correct for 2 isolates, and the results for 8 isolates remained unresolved. We conclude that 16S rDNA sequencing is an effective means for the identification of aerobic catalase-negative gram-positive cocci. With the exception of Streptococcus pneumoniae and beta-hemolytic streptococci, we propose the use of 16S rDNA sequence analysis if adequate species identification is of concern.

We have evaluated over a period of 18 months the use of 16S ribosomal DNA (rDNA) sequence analysis as a means of identifying aerobic gram-positive rods in the clinical laboratory. Two collections of strains were studied: (i) 37 clinical strains of gram-positive rods well identified by phenotypic tests, and (ii) 136 clinical isolates difficult to identify by standard microbiological investigations, i.e., identification at the species level was impossible. Results of molecular analyses were compared with those of conventional phenotypic identification procedures. Good overall agreement between phenotypic and molecular identification procedures was found for the collection of 37 clinical strains well identified by conventional means. For the 136 clinical strains which were difficult to identify by standard microbiological investigations, phenotypic characterization identified 71 of 136 (52.2%) isolates at the genus level; 65 of 136 (47.8%) isolates could not be discriminated at any taxonomic level. In comparison, 16S rDNA sequencing identified 89 of 136 (65.4%) isolates at the species level, 43 of 136 (31.6%) isolates at the genus level, and 4 of 136 (2.9%) isolates at the family level. We conclude that (i) rDNA sequencing is an effective means for the identification of aerobic gram-positive rods which are difficult to identify by conventional techniques, and (ii) molecular identification procedures are not required for isolates well identified by phenotypic investigations.

The activities of BAL9141 (formerly Ro 63-9141), a novel pyrrolidinone-3-ylidenemethyl cephalosporin, against 244 strains of gram-negative nonfermenters were evaluated. The overall MIC at which 50% of isolates are inhibited (MIC50) and the overall MIC90 were 2 and 64 microg/ml, respectively, which are similar to those of imipenem, lower than those of the other cephalosporins tested, amoxicillin, and the ticarcillin-clavulanic acid combination, and much higher than those of ciprofloxacin. BAL9141 shows species-dependent activity in vitro against a variety of gram-negative nonfermentative pathogens.

Recurrent soft tissue abscesses of the jaw, wrist, and arm developed in a 73-year-old housewife with nephrotic syndrome and immunoglobulin A(kappa) gammopathy of unknown etiology. Conventional cultures remained negative, despite visible gram-negative rods on microscopy. Broad-spectrum PCR revealed Legionella cincinnatiensis, which was confirmed by isolation of the organism on special Legionella medium. Infections due to Legionella species outside the lungs are rare. L. cincinnatiensis has been implicated in only four cases of clinical infection; these involved the lungs in three patients and the central nervous system in one patient. We conclude that broad-spectrum PCR can be a valuable tool for the evaluation of culture-negative infections with a high probability of bacterial origin and that Legionella might be an underdiagnosed cause of pyogenic soft tissue infection.

Ertapenem (MK-0826, L-749,345) is a 1-beta-methyl carbapenem with a long serum half-life. Its in vitro activity was determined by broth microdilution against 3,478 bacteria from 12 centers in Europe and Australia, with imipenem, cefepime, ceftriaxone, and piperacillin-tazobactam used as comparators. Ertapenem was the most active agent tested against members of the family Enterobacteriaceae, with MICs at which 90% of isolates are inhibited (MIC(90)s) of < or =1 microg/ml for all species. Ertapenem also was more active than imipenem against fastidious gram-negative bacteria and Moraxella spp.; on the other hand, ertapenem was slightly less active than imipenem against streptococci, methicillin-susceptible staphylococci, and anaerobes, but its MIC(90)s for these groups remained < or =0.5 microg/ml. Acinetobacter spp. and Pseudomonas aeruginosa were also much less susceptible to ertapenem than imipenem, and most Enterococcus faecalis strains were resistant. Ertapenem resistance, based on a provisional NCCLS MIC breakpoint of > or =16 microg/ml, was seen in only 3 of 1,611 strains of the family Enterobacteriaceae tested, all of them Enterobacter aerogenes. Resistance was also seen in 2 of 135 anaerobes, comprising 1 Bacteroides fragilis strain and 1 Clostridium difficile strain. Ertapenem breakpoints for streptococci have not been established, but an unofficial susceptibility breakpoint of < or =2 microg/ml was adopted for clinical trials to generate corresponding clinical response data for isolates for which MICs were as high as 2 microg/ml. Of 234 Streptococcus pneumoniae strains tested, 2 required ertapenem MICs of 2 microg/ml and one required an MIC of 4 microg/ml, among 67 non-Streptococcus pyogenes, non-Streptococcus pneumoniae streptococci, single isolates required ertapenem MICs of 2 and 16 microg/ml. These streptococci also had diminished susceptibilities to other beta-lactams, including imipenem as well as ertapenem. The Etest and disk diffusion gave susceptibility test results in good agreement with those of the broth microdilution method for ertapenem.

A newly marketed rapid agglutination kit for the identification of Staphylococcus aureus, Slidex Staph Plus (bioMérieux), was compared to Staphaurex Plus (Murex Diagnostics) and Pastorex Staph-Plus (Sanofi Diagnostics Pasteur). The study took place in three clinical microbiology laboratories in three different European countries. A total of 892 staphylococcal isolates, including 278 methicillin-sensitive S. aureus (MSSA) isolates, 171 methicillin-resistant S. aureus (MRSA) isolates, and 443 coagulase-negative staphylococcal isolates, were analyzed. The sensitivities (MSSA/MRSA) and specificities, respectively, were 98. 2% (98.9%/97.1%) and 98.9% for Slidex Staph Plus, 98.2% (98.2%/98. 2%) and 96.2% for Staphaurex Plus, and 98.7% (98.6%/98.8%) and 95.7% for Pastorex Staph Plus. The specificity of the Slidex Staph Plus kit was statistically significantly higher than the specificities of Staphaurex Plus and Pastorex Staph-Plus. The Slidex Staph Plus is a very reliable test for the identification of S. aureus.

Brevibacterium sp. was isolated from the blood of an acutely ill 18-year-old female with AIDS. The isolate was identified as Brevibacterium casei by use of carbohydrate assimilation tests. Treatment was successful with intravenously administered ciprofloxacin. To our knowledge, this is the first report of sepsis caused by B. casei in a human immunodeficiency virus-infected patient.

We present the case of a 77-year-old woman who developed an Actinomyces naeslundii infection of a hip prosthesis. The isolate grew well aerobically with 5% CO(2). Possible diagnostic problems may arise in the microbiological laboratory because aerobic growth is not sufficiently accounted for in some of the traditional identification schemes and commercial test kits. Therefore, besides presenting an unusual pathogen in this setting, this report focuses on possible diagnostic problems in the microbiological laboratory.

For three human blood culture isolates of beta-hemolytic streptococci with Lancefield's serogroup A antigen, phylogenetic analysis of the 16S rRNA genes confirmed biochemical identification as Streptococcus dysgalactiae subsp. equisimilis. Genes encoding M or M-like proteins, which are considered to be major virulence determinants in streptococci, were detected in all of these strains. Our data clearly demonstrate that for beta-hemolytic streptococci, the species assignment should not be based on the results of serogrouping alone.

Dysgonic fermenter 3 (DF-3)-associated bacteremia occurred in a febrile patient with acute myelocytic leukemia during aplasia. Another DF-3 isolate, identical by ribotyping, was grown 10 weeks later from stool collected in the absence of diarrhea. This is the first case in which DF-3 was isolated from blood and stool specimens from the same patient.

Broad-range PCR amplification of part of the 16S rRNA gene followed by single-strand sequencing was applied to samples of 18 resected heart valves from patients with infective endocarditis. The PCR results were compared with those of cultures of valves and with those of previous blood cultures. For two patients there was agreement with the cultures of the valves; for nine patients there was agreement with the previous blood cultures, which were positive, while the cultures of the valves were negative; a Streptococcus sp. and Tropheryma whippelii each were found in one patient with negative cultures (valve and blood); for two patients the cultures of the valves as well as the PCR results were negative but the blood cultures were positive; for one patient amplification was inhibited; and for two patients the PCR results were positive but the amplicons could not be sequenced. It is concluded that broad-range PCR is a promising tool for patients with culture-negative endocarditis and allows the detection of rare, noncultivable organisms.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

Bartonella henselae, the major causative agent of cat scratch disease, was cocultivated with Vero cells on chamber slides and visualized by indirect immunofluorescence by using a patient serum containing specific antibodies. Confocal microscopy localized the granular B. henselae-specific fluorescence mainly around the nuclei of Vero cells. By transmission electron microscopy, these granules were identified as clusters of multiple intracellular organisms. Fixed slides with the monolayers of Vero cells with intracellular B. henselae were used for an indirect fluorescent-antibody test to investigate the seroprevalence of specific immunoglobulin G in 100 serum samples from blood donors. Seventy-four serum samples were negative; 19, 3, and 4 were positive at dilutions of 1:64, 1:128, and 1:256, respectively. In our population, a serum titer of 1:256 or greater should stimulate further investigations. Moreover, elucidation of the mechanism by which B. henselae enters the cells may help to understand the pathogenesis of cat scratch disease.

An indirect immunofluorescence assay (IFA), a commercial capture enzyme-linked immunosorbent assay (ELISA), and PCR were compared for the diagnosis of Lyme neuroborreliosis in 16 individuals. Borrelia burgdorferi-specific intrathecal immunoglobulin G was found in 10 of 16 patients by IFA and in 8 of 12 patients by capture ELISA. PCRs performed on cerebrospinal fluid samples stored at -70 degrees C were positive for one of eight children and one of four adults with intrathecal antibody production and negative for all four adults without intrathecal antibody production. For two children with facial palsy following erythema chronicum migrans, neither IFA nor capture ELISA detected specific intrathecal antibodies and PCR was also negative. We conclude that both clinical manifestations and laboratory parameters are important for the diagnosis of Lyme neuroborreliosis.

In a prospective survey, all transplant patients at the hospital of the University of Zurich were screened for cytomegalovirus (CMV) infection. CMV infections were detected in a total of 40 of 104 transplant recipients; 31 could be diagnosed by CMV immunoglobulin M serology, 27 could be diagnosed by viremia, 11 could be diagnosed by antigenemia, and 13 could be diagnosed by the start of virus secretion. Combined application of serology and the detection of viremia showed the highest sensitivity (39 of 40 cases). Of the patients with severe clinical symptoms, six of seven had primary CMV infections caused by a positive transplant. Therefore, it is strongly indicated that patients with known risk factors should be regularly surveyed by a combination of methods.

Serratia plymuthica was isolated from the sinus tract and from the infected bone in a case of chronic osteomyelitis following an accident of a motorcyclist. This is the second case in which S. plymuthica was a significant pathogen. Previously, a case of S. plymuthica sepsis associated with infection of a central venous catheter was described.