Search

The type IV pili of plasmid R64 belonging to the type IVB group are required only for liquid mating. They consist of the major and minor components PilS pilin and PilV adhesin, respectively. PilS pilin is first synthesized as a 22-kDa prepilin from the pilS gene and is then processed to a 19-kDa mature pilin by PilU prepilin peptidase. In a previous genetic analysis, we identified four classes of the pilS mutants (T. Horiuchi and T. Komano, J. Bacteriol. 180:4613-4620, 1998). The products of the class I pilS mutants were not processed by prepilin peptidase; the products of the class II mutants were not secreted; in the class III mutants type IV pili with reduced activities in liquid mating were produced; and in the class IV mutants type IV pili with normal activities were produced. Here, we describe a novel class, class V, of pilS mutants. Mutations in the pilS gene at Gly-56 or Tyr-57 produced type IV pili lacking PilV adhesin, which were inactive in liquid mating. Residues 56 and 57 of PilS pilin are suggested to function as an interface of PilS-PilV interactions.

The OspE2 product of Shigella spp., the expression of which is regulated by the mxiE gene, is secreted through a type III secretion system into host cells. We investigated the function of OspE2 of Shigella sonnei by using cultured epithelial cells. Cells invaded by an ospE2 deletion mutant altered their morphology into the rounding shape, which was not due to cell death, whereas cells invaded by the wild-type strain kept their cell shape intact. The ospE2 mutation did not affect initial cell entry and multiplication in cells, but the mutant formed smaller-than-normal plaques on cell monolayers, indicating a deficiency in cell-to-cell spread by the bacteria. An mxiE deletion mutant also showed changes in cell morphology and deficiency in bacterial spread to adjacent cells. In cells invaded by the ospE2 mutant, disturbance of actin stress fibers was prominent at 3 h after invasion. Analysis of OspE2 localization indicated that the OspE2 protein accumulated on focal contact-like structures in the infected host cells. These results suggest that colocalization of the OspE2 protein in the focal contacts of infected cells may function to maintain an intact cell morphology. The morphological change induced by invasion of the ospE2 mutant may affect secondary bacterial transmission.

IncI1 plasmid R64 encodes a type IV pilus called a thin pilus, which includes PilV adhesins. Seven different sequences for the C-terminal segments of PilV adhesins can be produced by shufflon DNA rearrangement. The expression of the seven PilV adhesins determines the recipient specificity in liquid matings of plasmid R64. Salmonella enterica serovar Typhimurium LT2 was recognized by the PilVA' and PilVB' adhesins, while Escherichia coli K-12 was recognized by the PilVA', PilVC, and PilVC' adhesins. Lipopolysaccharide (LPS) on the surfaces of recipient cells was previously shown to be the specific receptor for the seven PilV adhesins. To identify the specific receptor structures of LPS for various PilV adhesins, R64 liquid matings were carried out with recipient cells consisting of various S. enterica serovar Typhimurium LT2 and E. coli K-12 waa mutants and their derivatives carrying various waa genes of different origins. From the mating experiments, including inhibition experiments, we propose that the GlcNAc(alpha1-2)Glc and Glc(alpha1-2)Gal structures of the LPS core of S. enterica serovar Typhimurium LT2 function as receptors for the PilVB' and PilVC' adhesins, respectively, while the PilVC' receptor in the wild-type LT2 LPS core may be masked. We further propose that the GlcNAc(beta1-7)Hep and Glc(alpha1-2)Glc structures of the LPS core of E. coli K-12 function as receptors for the PilVC and PilVC' adhesins, respectively.

The origin of transfer (oriT) of a bacterial plasmid plays a key role in both the initiation and termination of conjugative DNA transfer. We have previously shown that a conjugation-dependent recombination between the tandem R64 oriT sequences cloned into pHSG398 occurred, resulting in the deletion of the intervening sequence during DNA transfer. In this study, we tandemly cloned two oriT sequences of IncI1 plasmid R64 into pUC18. Specific recombination between the two oriT sequences in pUC18 was observed within Escherichia coli cells harboring mini-R64. This recombination was found to be independent of both the recA gene and conjugative DNA transfer. The R64 genes nikA and nikB, required for conjugal DNA processing, were essential for this recombination. Although a fully active 92-bp oriT sequence was required at one site for the recombination, the 44-bp oriT core sequence was sufficient at the other site. Furthermore, when two oriT sequences were tandemly cloned into the single-stranded phage vector M13 and propagated within E. coli cells, recombination between the two oriT sequences was observed, depending on the nikB gene. These results suggest that the R64 relaxase protein NikB can execute cleavage and rejoining of single-stranded oriT DNA within E. coli cells, whereas such a reaction in double-stranded oriT DNA requires collaboration of the two relaxosome proteins, NikA and NikB.

Myxococcus xanthus is a gram-negative soil bacterium that undergoes multicellular development upon nutrient starvation. In the present study, two novel developmental genes, fruC and fruD, of M. xanthus were identified and characterized. The FruD protein has significant amino acid sequence similarity to the DivIVA proteins of many bacteria including Bacillus subtilis. Vegetative cells of the fruD mutant exhibited a filamentous phenotype. The fruC and fruD mutants displayed similar delayed-development phenotypes. The formation of tightly aggregated mounds by fruC and fruD mutants was slower than that by the wild-type strain. Spore formation by the fruC and fruD mutants initiated after 30 h poststarvation, whereas wild-type M. xanthus initiated spore formation after 18 h. The fruCD genes were constitutively expressed as an operon during vegetative growth and development. S1 mapping revealed that transcription initiation sites of the fruCD operon were located 114 (P1) and 55 bp (P2) upstream of the fruC initiation codon. Only the P1 promoter was active during vegetative growth, while both the P1 and P2 promoters were active during development. The FruD protein was produced as a cytoplasmic protein and formed an oligomer during vegetative growth and development.

During lysogenization of myxophage Mx8, phage DNA can be integrated into the attB site of the Myxococcus xanthus chromosome through site-specific recombination. We previously demonstrated that the Mx8 attP site is located within the coding sequence of the Mx8 intP gene. Hence, the integration of Mx8 into the M. xanthus chromosome results in the conversion of the 112-amino-acid C-terminal segment of the IntP protein into a 13-amino-acid C-terminal segment of a new protein, IntR. To examine whether IntR is active for Mx8 excision, we have constructed a series of plasmids carrying various lengths of the intP-attP or intR-attR regions as well as the lacZ gene. The integrated Mx8 was excised at a high frequency, indicating that IntR is active for the excision. For Mx8 excision, a gene designated xis was shown to be required in addition to intR.

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

We have previously shown that the pilL, pilN, pilQ, pilS, pilU, and pilV genes of plasmid R64 encode outer membrane lipoprotein, secretin, cytoplasmic ATPase, major pilin, prepilin peptidase, and minor pilin, respectively, which are required for thin-pilus formation. In this work, we characterized the products of the remaining essential genes, pilK, pilM, pilO, pilP, pilR, and pilT, with regard to their localization and processing. Overexpression systems containing pilM, pilO, and pilP genes fused with N-terminal glutathione S-transferase (GST) or a His tag were constructed. Overproduced proteins were purified and used to raise specific antibodies. Localization of PilM, PilO, and PilP proteins was performed by Western blot analysis with anti-GST-PilM, anti-PilO, and anti-PilP antibodies, respectively. The pilK, pilR, and pilT products were produced with a C-terminal His tag and then detected by anti-His tag antibody. Subcellular fractionation experiments with Escherichia coli cells producing R64 thin pili revealed that PilK, PilM, and PilR are inner membrane proteins, and PilP and PilT are periplasmic proteins. PilO protein was localized to the outer membrane in the presence of other Pil proteins, whereas it was localized to the cytoplasm in the absence of these proteins. Furthermore, the cleavage site of PilP protein was determined by N-terminal amino acid sequencing of purified mature PilP protein. We predict that PilK, PilM, PilO, PilP, and PilT proteins function as the components of the pilin transport apparatus and thin-pilus basal body.

Intercellular transfer of plasmid DNA during bacterial conjugation initiates and terminates at a specific origin of transfer, oriT. We have investigated the oriT structure of conjugative plasmid R64 with regard to the initiation and termination of DNA transfer. Using recombinant plasmids containing two tandemly repeated R64 oriT sequences with or without mutations, the subregions required for initiation and termination were determined by examining conjugation-mediated deletion between the repeated oriTs. The oriT subregion required for initiation was found to be identical to the 44-bp oriT core sequence consisting of two units, the conserved nick region sequence and the 17-bp repeat A sequence, that are recognized by R64 relaxosome proteins NikB and NikA, respectively. In contrast, the nick region sequence and two sets of inverted repeat sequences within the 92-bp minimal oriT sequence were required for efficient termination. Mutant repeat A sequences lacking NikA-binding ability were found to be sufficient for termination, suggesting that the inverted repeat structures are involved in the termination process. A duplication of the DNA segment between the repeated oriTs was also found after mobilization of the plasmid carrying initiation-deficient but termination-proficient oriT and initiation-proficient but termination-deficient oriT, suggesting that the 3' terminus of the transferred strand is elongated by rolling-circle-DNA synthesis.

The shufflon, a multiple DNA inversion system in plasmid R64, consists of four invertible DNA segments which are separated and flanked by seven 19-bp repeat sequences. The product of a site-specific recombinase gene, rci, promotes site-specific recombination between any two of the inverted 19-bp repeat sequences of the shufflon. To analyze the molecular mechanism of this recombination reaction, Rci protein was overproduced and purified. The purified Rci protein promoted the in vitro recombination reaction between the inverted 19-bp repeats of supercoiled DNA of a plasmid carrying segment A of the R64 shufflon. The recombination reaction was enhanced by the bacterial host factor HU. Gel electrophoretic analysis indicated that the Rci protein specifically binds to the DNA segments carrying the 19-bp sequences. The binding affinity of the Rci protein to the four shufflon segments as well as four synthetic 19-bp sequences differed greatly: among the four 19-bp repeat sequences, the repeat-a and -d sequences displayed higher affinity to Rci protein. These results suggest that the differences in the affinity of Rci protein for the 19-bp repeat sequences determine the inversion frequencies of the four segments.

Dipteran-specific insecticidal protein Cry4A is produced as a protoxin of 130 kDa in Bacillus thuringiensis subsp. israelensis. Here we performed the in vitro processing of Cry4A and showed that the 130-kDa protoxin of Cry4A was processed into the two protease-resistant fragments of 20 and 45 kDa through the intramolecular cleavage of a 60-kDa intermediate. The processing into these two fragments was also observed in vivo. To investigate functional properties of the two fragments, GST (glutathione S-transferase) fusion proteins of the 60-kDa intermediate and the 20- and 45-kDa fragments were constructed. Neither the GST-20-kDa fusion protein (GST-20) nor the GST-45-kDa fusion protein (GST-45) was actively toxic against mosquito larvae of Culex pipiens, whereas the GST-60-kDa intermediate fusion protein (GST-60) exhibited significant toxicity. However, when the two fusion proteins GST-20 and GST-45 coexisted, significant toxicity was observed. The coprecipitation experiment demonstrated that the two fragments associated with each other. Therefore, it is strongly suggested that the two fragments formed an active complex of apparently 60 kDa. A mutant of the 60-kDa protein which was apparently resistant to the intramolecular cleavage with the midgut extract of C. pipiens larvae had toxicity slightly lower than that of GST-60.

The IncI1 plasmid R64 produces two kinds of sex pili: a thin pilus and a thick pilus. The thin pilus, which belongs to the type IV family, is required only for liquid matings. Fourteen genes, pilI to -V, were found in the DNA region responsible for the biogenesis of the R64 thin pilus (S.-R. Kim and T. Komano, J. Bacteriol. 179:3594-3603, 1997). In this study, we introduced frameshift mutations into each of the 14 pil genes to test their requirement for R64 thin pilus biogenesis. From the analyses of extracellular secretion of thin pili and transfer frequency in liquid matings, we found that 12 genes, pilK to -V, are required for the formation of the thin pilus. Complementation experiments excluded the possible polar effects of each mutation on the expression of downstream genes. Two genes, traBC, were previously shown to be required for the expression of the pil genes. In addition, the rci gene is responsible for modulating the structure and function of the R64 thin pilus via the DNA rearrangement of the shufflon. Altogether, 15 genes, traBC, pilK through pilV, and rci, are essential for R64 thin pilus formation and function.