Search

None of the current oomycota fungicides are effective towards all species of Phytophthora , Phytopythium , Globisporangium , and Pythium that affect soybean seed and seedlings in Ohio. Picarbutrazox is a new oomyceticide with a novel mode of action towards oomycete pathogens. Our objectives were to evaluate picarbutrazox to determine (i) baseline sensitivity (EC 50 ) to 189 isolates of 29 species, (ii) the efficacy with a base seed treatment with three cultivars with different levels of resistance in 14 field environments; and (iii) if the rhizosphere microbiome was affected by the addition of the seed treatment on a moderately susceptible cultivar. The mycelial growth of all isolates was inhibited beginning at 0.001 μg, and the EC 50 ranged from 0.0013 to 0.0483 μg of active ingredient (a.i.)/ml. The effect of seed treatment was significantly different for plant population and yield in eight of 14 and six of 12 environments, respectively. The addition of picarbutrazox at 1 and 2.5 g of a.i./100 kg seed to the base seed treatment compared to the base alone was associated with higher plant populations and yield in three and one environments, respectively. There was limited impact of the seed treatment mefenoxam 7.5 g of a.i. plus picarbutrazox 1 g of a.i./100 kg seed on the oomycetes detected in the rhizosphere of soybean seedlings collected at the V1 growth stage. Picarbutrazox has efficacy towards a wider range of oomycetes that cause disease on soybean, and this will be another oomyceticide tool to combat early season damping-off in areas where environmental conditions highly favor disease development., Competing Interests: The author(s) declare no conflict of interest.

Heterodera glycines , the soybean cyst nematode (SCN), and fungal pathogen Macrophomina phaseolina are economically important soybean pathogens that may coinfest fields. Resistance remains the most effective management tactic for SCN, and the rhg1-b resistance allele derived from plant introduction 88788 is most commonly deployed in the northern United States. The concomitant effects of SCN and M. phaseolina on soybean performance, as well as the effect of the rhg1-b allele in two different genetic backgrounds, were evaluated in three environments (during 2013 to 2015) and a greenhouse bioassay. Within two soybean populations, half of the lines had the rhg1-b allele, and the other half had the susceptible allele in the backgrounds of the cultivars IA3023 and LD00-3309. Significant interactions between soybean rhg1-b allele and M. phaseolina -infested plots were observed in 2014. In all experiments, initial SCN populations (Pi) and M. phaseolina in roots were associated with reduced soybean yield. SCN reproduction factor (RF = final population/Pi) was affected by SCN Pi, rhg1-b , and genetic background. A background-by-genotype interaction on yield was observed only in 2015, with a stronger rhg1-b effect in the LD00-3309 background, which suggested that the susceptible parent 'IA3023' is tolerant to SCN. SCN female index from greenhouse experiments was compared with field RF, and Lin's concordance and Pearson's correlation coefficients decreased with increasing field SCN Pi in soil. In this study, both SCN and M. phaseolina reduced soybean yield asymptomatically, and the impact of SCN rhg1-b resistance was dependent on SCN virulence but also population density.

Species of Phytophthora , Phytopythium , and Pythium affect soybean seed and seedlings each year, primarily through reduced plant populations and yield. Oxathiapiprolin is effective at managing several foliar diseases caused by some oomycetes. The objectives of these studies were to evaluate oxathiapiprolin in a discriminatory dose assay in vitro; evaluate oxathiapiprolin as a soybean seed treatment on a moderately susceptible cultivar in 10 environments; compare the impact of seed treatment on plant populations and yields in environments with low and high precipitation; and compare a seed treatment mixture on cultivars with different levels of resistance in four environments. There was no reduction in growth in vitro among 13 species of Pythium at 0.1 µg ml -1 . Soybean seed treated with the base fungicide plus oxathiapiprolin (12 and 24 µg a.i. seed -1 ) alone, oxathiapiprolin (12 µg a.i. seed -1 ) plus mefenoxam (6 µg a.i. seed -1 ), or oxathiapiprolin (24 µg a.i. seed -1 ) plus ethaboxam (12.1 µg a.i. seed -1 ) had greater yields in environments that received ≥50 mm of precipitation within 14 days after planting compared with those that received less. Early plant population and yield were significantly higher for seed treated with oxathiapiprolin (24 µg a.i. seed -1 ) + metalaxyl (13.2 µg a.i. seed -1 ) compared with nontreated for six of seven cultivars in at least one of four environments. Oxathiapiprolin combined with another Oomycota fungicide applied to seed has the potential to be used to protect soybean plant establishment and yield in regions prone to poor drainage after high levels of precipitation.

Some Pythium spp. cause damping off and root rot in soybeans and other crop species. One of the most effective management tools to reduce disease is host resistance; however, little is known about resistance in soybean to Pythium spp. The soybean nested associated mapping (SoyNAM) parent lines are a set of germplasms that were crossed to a single hub parent to create recombinant inbred line populations for the purpose of mapping agronomic traits. The SoyNAM parents were screened for resistance to Pythium lutarium , Pythium oopapillum , Pythium sylvaticum , and Pythium torulosum in separate assays to evaluate seed and root rot severity. Of the 40 SoyNAM parents, only 'Maverick' was resistant to the four species tested; however, 13 were resistant to three species. Other lines were resistant to two, one, or none of the species tested. Correlations between seed and root rot severity for the lines assessed were weak or insignificant. Results indicate that mechanisms of resistance to seed and root rot caused by Pythium spp. may not necessarily be the same.

Phytophthora , Phytopythium , and Pythium species that cause early-season seed decay and pre-emergence and post-emergence damping off of soybean are most commonly managed with seed treatments. The phenylamide fungicides metalaxyl and mefenoxam, and ethaboxam are effective toward some but not all species. The primary objective of this study was to evaluate the efficacy of ethaboxam in fungicide mixtures and compare those with other fungicides as seed treatments to protect soybean against Pythium , Phytopythium , and Phytophthora species in both high-disease field environments and laboratory seed plate assays. The second objective was to evaluate these seed treatment mixtures on cultivars that have varying levels and combinations of resistance to these soilborne pathogens. Five of eight environments received adequate precipitation in the 14 days after planting for high levels of seedling disease development and treatment evaluations. Three environments had significantly greater stands, and three had significantly greater yield when ethaboxam was used in the seed treatment mixture compared with treatments containing metalaxyl or mefenoxam alone. Three fungicide formulations significantly reduced disease severity compared with nontreated in the seed plate assay for 17 species. However, the combination of ethaboxam plus metalaxyl in a mixture was more effective than either fungicide alone against some Pythium and Phytopythium species. Overall, our results indicate that the addition of ethaboxam to a fungicide seed treatment is effective in reducing seed rot caused by these pathogens commonly isolated from soybean in Ohio but that these effects can be masked when cultivars with resistance are planted.

High levels of genetic diversity have been described within the Pythium irregulare complex from several host plants; however, little is known about the population structure in fields used for grain production. Therefore, the objective of this study was to evaluate the genetic diversity and population structure of 53 isolates baited from 28 soybean and corn production fields from 25 counties in Ohio. Genetic diversity was characterized based on sequence analysis of the internal transcribed spacer (ITS1-5.8S-ITS2) region and with 21 simple sequence repeat (SSR) markers. In addition, aggressiveness on soybean, optimum growth temperature, and sensitivity to metalaxyl fungicide were determined. ITS sequence analysis indicated that four isolates clustered with P. cryptoirregulare, whereas the remaining isolates clustered with P. irregulare that was subdivided into two groups (1 and 2). Cluster analysis of SSR data revealed a similar subdivision, which was also supported by structure analysis. The isolates from group 2 grew at a slower rate, but both groups of P. irregulare and P. cryptoirregulare recovered in this study had the same optimum growth at 27°C. Variability of aggressiveness and sensitivity toward metalaxyl fungicide was also observed among isolates within each group. The results from this study will help in the selection of isolates to be used in screening for resistance, assessment of fungicide efficacy, and disease management recommendations.

Germplasm screening programs have primarily relied on inoculation with mycelia to determine the resistance reaction of soybean genotypes to Sclerotinia sclerotiorum. However, under field conditions, ascospores are the primary source of inoculum. Therefore, the objective of this study was to determine which components most accurately differentiate the resistance reaction of soybean genotypes inoculated with ascospores of S. sclerotiorum. Ascospores were produced in the laboratory and all of the experiments were carried out under controlled conditions with inoculations at flowering stage. Initially, inoculum densities of 1 × 10 4 , 1 × 10 5 and 1 × 10 6 ascospores ml -1 were compared on six soybean genotypes with known resistance reactions. Disease symptoms developed on all genotypes and at all inoculum densities. The highest ascospore concentration increased infection efficiency but it was not correlated with an increase in lesion length. Components of resistance were then measured on a set of 17 cultivars with known resistance reactions at 1 × 10 5 ascospores ml -1 . Resistance reactions could be differentiated based on the level of infection efficiency and lesion length on the main stem. Although inoculation with ascospores presents some limitations such as the time required for inoculum production as well as the time and space required for plant growth, it has the potential to be used to complement other methods for the characterization of resistance of soybean genotypes.

Pathotype diversity of Phytophthora sojae was assessed in 11 states in the United States during 2012 and 2013. Isolates of P. sojae were recovered from 202 fields, either from soil samples using a soybean seedling bioassay or by isolation from symptomatic plants. Each isolate was inoculated directly onto 12 soybean differentials; no Rps gene or Rps 1a, 1b, 1c, 1k, 3a, 3b, 3c, 4, 6, 7, or 8. There were 213 unique virulence pathotypes identified among the 873 isolates collected. None of the Rps genes were effective against all the isolates collected but Rps6 and Rps8 were effective against the majority of isolates collected in the northern regions of the sampled area. Virulence toward Rps1a, 1b, 1c, and 1k ranged from 36 to 100% of isolates collected in each state, while virulence to Rps6 and Rps8 was less than 36 and 10%, respectively. Depending on the state, the effectiveness of Rps3a ranged from totally effective to susceptible to more than 40% of the isolates. Pathotype complexity has increased in populations of P. sojae in the United States, emphasizing the increasing importance of stacked Rps genes in combination with high partial resistance as a means of limiting losses to P. sojae.

Phytophthora root and stem rot, caused by Phytophthora sojae, is an economically important disease of soybean throughout the Midwestern United States. This disease has been successfully managed with resistance (Rps) genes; however, pathogen populations throughout the Midwest have developed virulence to many Rps genes, including those that have not been deployed. To gain a better understanding of the processes that influence P. sojae evolution, the population genetic structure was compared among populations using one isolate collected from 17, 33, and 20 fields in Iowa, Ohio, and South Dakota, respectively, as well as multiple isolates from individual fields in Iowa, Ohio, and Missouri. Genotypic diversity was measured using 21 polymorphic microsatellite (simple-sequence repeat) markers. and pathotype diversity using 15 soybean differentials. For all but three of the populations with low sample size, there was a high level of pathotype diversity and a low to moderate level of genotypic diversity among the populations for both comparisons between states and within-field variation. None of the Rps-gene differentials were resistant to all of the isolates. There were 103 unique multilocus genotypes identified in this study and only 2 were identified from the same field. Although no clones were identified in more than one field, pairwise F ST indicated that some gene flow within neighboring fields does occur but not across the region, including fields from neighboring states. These results suggest that there is a strong probability that each state may have their own or several regional populations, as well as provide further evidence of high diversity within this homothallic pathogen which may be due, in part, to limited gene flow, mutation, or outcrossing, and this likely affects the success of deployment of resistance.

Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5' CCATCTTTCTTTCCAGGCATTTCA 3') and SVNaV-S-2421R (5' GATTCAAGTTCAGCGAGTTCTACAA 3'). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.

Fusarium graminearum causes seed decay and damping-off of soybean. This study evaluated the effect of inoculum density of F. graminearum, temperature, and fungicide seed treatments on disease development. To determine the optimum conditions for disease development, individual soybean seed was inoculated with 100 μl of a suspension of 2.5 × 10 2 , 2.5 × 10 3 , 2.5 × 10 4 , or 2.5 × 10 5 macroconidia/ml in a rolled-towel assay at temperatures of 18, 22, and 25°C. Inoculum concentrations of 2.5 × 10 4 macroconidia/ml or higher were necessary for optimum disease development at all temperatures. The efficacy of captan, fludioxonil, mefenoxam + fludioxonil, azoxystrobin, trifloxystrobin, and pyraclostrobin as seed treatments was then evaluated with the same assay at 2.5 × 10 4 and 2.5 × 10 5 macroconidia/ml. Seed treated with captan at 61.9 g a.i. or fludioxonil at 2.5 or 5.0 g a.i. per 100 kg developed smaller lesions than other seed treatments and the nontreated control. Based on these results, there are limited choices in fungicide seed treatments for managing this seedling disease, and it is possible that shifts in seed treatment products may have played a role in the recent emergence of this soybean pathogen.

Brown spot, caused by Septoria glycines, is the most common foliar disease of soybean in Ohio, but its economic impact has not been assessed on modern cultivars. Therefore, the objectives of this study were to (i) evaluate the effect of S. glycines on soybean yield and (ii) evaluate the efficacy of strobilurin- and triazole-based fungicides on the control of brown spot. Yield loss associated with S. glycines was determined using weekly applications of chlorothalonil. The efficacy of azoxystrobin, pyraclostrobin, tebuconazole, and flutriafol alone and in combinations were also assessed using applications at the R3 and R5 growth stages at two locations over 3 years. Significantly different levels of brown spot developed following applications of chlorothalonil, with mean yield differences between treated and nontreated plots ranging from 196 to 293 kg/ha. Pyraclostrobin and azoxystrobin applied at the R3 growth stage significantly reduced final levels of brown spot; however, significant increases in yield occurred in only three of the six location-years. Triazoles, flutriafol and tebuconazole, applied at R3 or R5 did not significantly decrease levels of brown spot or impact yield. More data on the accurate timing of fungicides are still required to establish a long-term management program for this disease, and resistance to brown spot should be monitored in soybean cultivar development to prevent future yield losses.

Bean pod mottle virus (BPMV) infection reduces yield and seed quality in soybean. To test the hypothesis that virus incidence and movement within plots would be reduced in soybean with resistance to feeding by the virus' bean leaf beetle (Cerotoma trifurcata) vector, BPMV spread was evaluated in five soybean genotypes at two inoculum levels over 2 years at two locations in Ohio. Soybean genotypes included two insect-feeding-susceptible genotypes (Williams 82 and Resnik), two insect-feeding-resistant, semidwarf genotypes (HC95-15 and HC95-24), and an insect-feeding-susceptible, semidwarf genotype (Troll). BPMV incidence was assessed in individual plants at growth stages R5/R6 and R7/R8 using enzyme-linked immunosorbent assay. Beetle feeding was visually assessed in 2004. Data for infection of individual plants were analyzed using a generalized linear mixed model, with a binomial distribution and logit-link. Within plots, BPMV incidence was highest in Resnik and Williams 82 and significantly lower in Troll. Incidence in HC95-15 was not significantly different than in Williams 82 and Resnik but incidence in HC95-24 was lower than in Resnik. BPMV incidence was also significantly (P < 0.05) affected by year, location, inoculum level and sampling date, with increasing incidence over time and higher incidence at the higher inoculum level. Beetle feeding damage was affected by the interaction of location-genotype. Significant spatial aggregation of infected plants was found for most plots but aggregation was independent of host genotype and inoculum level. Although the results indicate that BPMV infection varied by genotype, they do not support the hypothesis that insect-feeding resistance is sufficient to reduce the incidence and spread of BPMV.

During the spring of 2004, corn seedlings with symptoms of wilting and stunting were observed in corn fields with emergence problems in Madison and Brown counties, Ohio. Phytophthora isolates were recovered from sections of root tissue of diseased seedlings placed on dilute V8 media amended with pentachloronitrobenzene, iprodione, benlate, neomycin sulfate, and chloramphenicol. Colonies were rosaceous on potato dextrose agar, with a growth rate of 5 mm per day. Homothallic isolates with paragynous antheridia were observed on lima bean agar (LBA); oogonia were 35 to 50 μm in diameter. Sporangia were ovoid to obpyriform, nonpapillate, with an average size of 49 × 30 μm. Pathogenicity was tested on corn seeds using a petri dish assay with 3-day-old cultures on LBA and a sand-cornmeal cup test amended with inoculum from 7-day-old cultures on LBA (1). After 1 week in the petri dish assay, the seeds failed to germinate completely and were covered with white, fungal-like, aerial mycelia and the pathogen was recovered from brown discolored radicle roots. In the cup assay, 2-week-old seedlings developed the same symptoms observed in the field; the pathogen was also isolated from brown discolored roots. In both assays, no symptoms developed in the noninoculated controls. Both pathogenicity tests were repeated two times. Genomic DNA was extracted from mycelia of two isolates and the internal transcribed spacer (ITS) region was amplified and sequenced using ITS6/ITS4 primers (2). Both isolates had identical ITS sequences (GenBank Accession No. GQ853880). A BLAST search of the NCBI database showed 100% homology with the sequence of the haplotype isolate of Phytophthora sansomeana (Accession No. EU925375). P. sansomeana is a new species characterized principally by a large oogonial diameter (37 to 45 μm), rapid growth rate (7 to 10 mm/day), and an ITS sequence falling in Cooke's clade 8 (4). Pathogenicity tests, morphological characteristics, and the ITS sequence analysis indicate that P. samsomena is the causal agent of the symptoms observed on corn seedlings. P. sansomeana has been reported as a pathogen of soybean in Indiana, Douglas-fir in Oregon, and weeds in alfalfa fields in New York (4). To our knowledge, this is the first report of P. sansomeana infecting corn in Ohio, albeit other isolates have previously been recovered from soybean in the state. There are four previous reports of Phytophthora spp. affecting corn in the United States and Mexico (3). Crop rotation will have little effect in management of this pathogen since corn and soybean are produced in the same fields continuously throughout the state. References: (1) K. E. Broders et al. Plant. Dis. 91:727, 2007. (2) D. E. L. Cooke et al. Fungal Genet. Biol. 30:17, 2000. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, St. Paul, MN. 1989. (4) E. M. Hansen et al. Mycologia 101:129, 2009.

Phytophthora sojae has re-emerged as a serious soybean pathogen in the past decade. This may be due in part to changes in resistance levels in current cultivars, adoption of P. sojae populations to deployed Rps genes, and highly favorable environments in the past decade. This multilocation study evaluated the effect of seed treatments on the incidence and severity of Phytophthora root and stem rot on soybeans with different combinations of Rps genes and levels of partial resistance. The efficacy of the seed treatments was highly variable across locations. Seed treatments (metalaxyl and mefenoxam) provided protection and increased yields across cultivars in locations where rain or irrigation occurred shortly after planting (Ohio, South Dakota, and Ontario). However, there were no significant differences in stand or yield consistently across cultivars in Iowa, Nebraska, Wisconsin, or Ohio, where heavy precipitation did not occur until later growth stages. The environment, levels of inoculum, and pathogen complex may have played a role in the different responses to the seed treatments and to the different combinations of Rps genes and levels of partial resistance to P. sojae in the cultivars. Fields that are poorly drained and have P. sojae populations with complex pathotypes may benefit the most from seed treatments. Individual fields where producers may see the greatest benefit to utilizing these integrated management strategies will need to be identified.

Fusarium graminearum is an important pathogen of cereal crops in Ohio causing primarily head blight in wheat and stalk and ear rot of corn. During the springs of 2004 and 2005, 112 isolates of F. graminearum were recovered from diseased corn and soybean seedlings from 30 locations in 13 Ohio counties. These isolates were evaluated in an in vitro pathogenicity assay on both corn and soybean seed, and 28 isolates were tested for sensitivity to the seed treatment fungicides azoxystrobin, trifloxystrobin, fludioxonil, and captan. All of the isolates were highly pathogenic on corn seed and moderately to highly pathogenic on soybean seed. Fludioxonil was the only fungicide that provided sufficient inhibition of mycelial growth; however, several fludioxonil-resistant mutants were identified during the sensitivity experiments. These results indicate that F. graminearum is an important pathogen of both corn and soybean seed and seedlings in Ohio, and that continued use of fludioxonil potentially may select for less sensitive isolates of F. graminearum.

Cool, moist conditions in combination with minimum tillage, earlier planting, and recent shifts in commercial fungicide seed-treatment active ingredients have led to an increase in corn (Zea mays) and soybean (Glycine max) seedling establishment problems. This situation resulted in an investigation of Pythium spp. associated with seed and seedling diseases. Samples of diseased corn and soybean seedlings were collected from 42 production fields in Ohio. All isolates of Pythium recovered were identified to species using morphological and molecular techniques and evaluated in an in vitro pathogenicity assay on both corn and soybean seed, and a subset of the isolates was tested for sensitivity to fungicides currently used as seed treatments. Eleven species and two distinct morphological groups of Pythium were identified, of which six species were moderately to highly pathogenic on corn seed and nine species were highly pathogenic on soybean seed. There was significant variation (P < 0.05) in sensitivity to mefenoxam, azoxystrobin, trifloxystrobin, and captan both across and within species. Multiple species of Pythium had the capacity to reduce germination of both corn and soybean seed. Results indicated that mefenoxam, azoxystrobin, trifloxystrobin, or captan, when used individually, may not inhibit all pathogenic species of Pythium found in Ohio soils.

Bean pod mottle virus (BPMV) has become increasingly common in soybean throughout the north-central region of the United States. Yield loss assessments on southern soybean germplasm have reported reductions ranging from 3 to 52%. Currently, no soybean cultivars have been identified with resistance to BPMV. The objective of this study was to determine the impact of BPMV infection on soybean cultivars representing a broad range of northern soybean germ-plasm by comparing inoculated and noninoculated soybean plants in paired row studies. In all, 30 and 24 cultivars were evaluated in Nebraska (NE) in which soybean plants were inoculated at the V3 to V4 growth stage. Eleven cultivars from public and breeding lines were inoculated at the VC and R5 to R6 growth stages in Ohio (OH). Disease severity, yield, and percent seed coat mottling were assessed at both locations, whereas protein and oil content also were assessed at NE. Yield and percent seed coat mottling was significantly reduced following inoculation at the VC (OH) and V3 to V4 (NE) growth stages. In addition, seed oil and protein composition were impacted in 1 of the 2 years of the study. This study demonstrates that substantial yield losses can occur in soybean due to BPMV infection. In addition, protein and oil may be affected depending on the environment during the production season.

The effects of temperature and soil moisture on infection and disease development by Rhizoctonia solani on soybean were studied individually. In addition, the anastomosis group of R. solani isolates recovered from soybean from 35 fields in 15 counties was determined. All of the 44 isolates recovered in this study were AG-2-2 IIIB. Five isolates of R. solani were able to infect and colonize soybean roots and hypocotyls at 20, 24, 28, and 32°C in growth chamber studies. The temperatures evaluated in this study were not limiting to the isolates tested. In greenhouse studies, nine R. solani isolates and a noninoculated control were evaluated at 25, 50, 75, and 100% soil moisture holding capacity (MHC). Root weights were greater and percent stand averages higher at 50 and 75% than at 25 or 100% MHC; however, as percentage of control, the main effect on percent moisture for percent stand, plant height, or root weight was not significant. There were significant differences among the isolates for the percent stand, root rot rating, and root fresh weight of soybean in each study. In both temperature and moisture studies, the R. solani isolates could be separated as predominantly causing (i) seed rot, as detected by greatly reduced plant stand; (ii) root rot generally having no effect on plant stand but a high root rot rating and low root weight; or (iii) hypocotyl lesions, having no effect on plant stand, a low root rot score, and a high number of red lesions on the hypocotyl. In the greenhouse seed treatment evaluations of five fungicides, there was no fungicide by isolate interaction using these pathogenic types of R. solani. None of the seed treatments evaluated in this study provided 100% control of the four isolates tested. Due to the wide range of environmental factors that permit R. solani infection and disease on soybeans, other control measures that last all season, such as host resistance, should be emphasized.

Phytophthora root and stem rot of soybean commonly causes losses in both stand and yield in Ohio. Environmental conditions which favor the pathogen typically occur in many areas of the state during late spring and summer. This study examined the performance of 12 soybean cultivars with partial resistance, with or without Rps genes, to different populations of Phytophthora sojae and various levels of disease pressure. The soybean cultivars were evaluated in seven field environments with and without metalaxyl over 4 years. There was a highly significant genotype-environment interaction which was due in part to variable disease pressure. The incidence of Phytophthora stem rot in subplots ranged from 0 to 10 plants in the most susceptible cultivar, Sloan, while significantly less stem rot developed in cultivars with high levels of partial resistance or partial resistance combined with an Rps gene in three of the seven environments. Metalaxyl applied in-furrow had a significant effect on early and final plant populations as well as yield (P < 0.001) in two of the seven environments, and for yield (P = 0.05) in one environment. This indicates that at these two environments, 2001 Lakeview and VanBuren, early season Phytophthora disease was controlled with the in-furrow fungicide treatment. When diverse populations of P. sojae were present, yields from soybean cultivars with high levels of partial resistance were significantly higher than those with low levels of partial resistance. Soybean cultivars with specific resistance genes Rps1k, Rps1k + Rps6, or Rps1k +Rps3a had higher yields than plants with only partial resistance in environments where race determination indicated that the populations of P. sojae present were not capable of causing disease on plants with the Rps1k gene. However, in an environment with very low disease pressure, yields of soybean cultivars with partial resistance were not significantly different from those with single Rps genes or Rps gene combinations. These results demonstrate that genetic traits associated with high levels of partial resistance do not have a negative effect on yield. Soybean cultivars that had the most consistent ranking across environments were those with moderate levels of partial resistance in combination with either Rps1k or Rps3a.

Problems with early season soybean stand establishment, and an increase in incidence of Phytophthora root and stem rot caused by Phytophthora sojae, prompted a reassessment of the pathogen population in Ohio. Earlier studies had indicated a potential for pathogen adaptation to commonly deployed Rps genes in soybeans. Fifty-seven fields, part of an earlier study in 1990 and 1991, along with 29 additional fields were sampled in either 1997 or 1999. Two soybean cultivars, Sloan (rps) and Resnik (Rps1k), were used as bait in a seedling bioassay to isolate P. sojae from the soil samples. P. sojae was recovered from 82 of the 86 fields sampled. Of the 429 isolates recovered from these soils, 325 and 104 were baited with soybean cultivars Sloan and Resnik, respectively. The P. sojae population in Ohio increased in the number of pathotypes (races) as well as in complexity since the earlier surveys. There were 72 and 202 pathotypes identified on 8 and 13 Rps gene differentials, respectively, in the current study. When the data were compared by location, 96, 65, 73, 78, 51, and 52% of the locations had at least one isolate with virulences to Rps1a, Rps1b, Rps1c, Rps1k, Rps3a, and Rps6, respectively. The mean complexity, the number of susceptible interactions on 8 differentials, increased from 3.01 to 4.06 between 1991 and 1997/1999. In addition, the pathogenic diversity as measured by the Shannon index increased from 2.71 to 3.28 for isolates recovered from the 57 fields sampled in both surveys. Producers whose fields were sampled were surveyed to determine if changes in the P. sojae population could be linked with production practices. There was a significant association between (P ≤ 0.05) reduced tillage practices and the presence of isolates that had virulence to Rps1k; reduced tillage fields also had isolates with virulence to a greater number of differentials. Due to the percentage of isolates that have virulence to many of the Rps genes, it is questionable how long a single Rps gene or several stacked Rps genes will remain viable disease management tools for P. sojae, unless a novel Rps gene is identified.

Sclerotinia stem rot of soybean, caused by Sclerotinia sclerotiorum, is a major disease in the north central region of the United States. One approach to managing Sclerotinia stem rot on soybean is the use of fungicides. S. sclerotiorum was assayed for sensitivity to benomyl, tebuconazole, thiophanate methyl, and vinclozolin in pure cultures on agar medium, inoculated soybean seedlings, detached inoculated leaves, and in experimental field plots. To evaluate the inhibitory effect of four fungicides on growth of S. sclerotiorum in vitro, potato dextrose agar (PDA) was amended with the fungicides at six concentrations. Based on measurements of fungal radial growth, vinclozolin was the most effective in inhibiting S. sclerotiorum mycelial growth at 1.0 μg a.i./ml of PDA. Ranges of reduction of radial growth of 91 isolates of S. sclerotiorum on PDA amended with thiophanate methyl and vinclozolin were 18 to 93% and 93 to 99%, respectively, when compared with the nonamended agar control. Benomyl, thiophanate methyl, and vinclozolin applied to greenhouse-grown seedlings prevented S. sclerotiorum from expressing symptoms or signs on leaf tissue. Detached leaves sprayed with thiophanate methyl and then inoculated with mycelial plugs of S. sclerotiorum did not express symptoms or signs. Of 13 different environments in Illinois, Indiana, Ohio, and Wisconsin from 1995 through 2000, six had low Sclerotinia stem rot incidence (<1%), three environments had low to moderate Sclerotinia stem rot incidence (5 to 25%), and four environments had high Sclerotinia stem rot incidence (>25%). When disease incidence was high, no consistent control of Sclerotinia stem rot was observed with benomyl or thiophanate methyl using different application systems. However, under low disease incidence, spray systems that were able to penetrate the canopy reduced the incidence of Sclerotinia stem rot an average of 50%.

Phytophthora sojae is a yield-limiting soybean pathogen in areas where soils remain saturated for long periods of time. P. sojae has been successfully managed with single dominant resistance genes (Rps genes). The proportion of fields with populations of P. sojae capable of causing susceptible interactions with many of the Rps genes has increased in number. The fungicides metalaxyl and mefenoxam have been used both as in-furrow and seed treatments to provide protection against damping-off caused by P. sojae. To determine the plant age when partial resistance and Rps genes are effective against P. sojae, we evaluated a greenhouse assay in which soybean seeds were planted and inoculated with a zoospore suspension to compare the disease reaction of soybean seeds and seedlings. Efficacy of different fungicide rates also was evaluated using the cultivar with partial resistance with this inoculation technique. Seeds and seedlings of a cultivar with high levels of partial resistance were susceptible to infection by P. sojae while those of a cultivar with an Rps gene were resistant. For the cultivar with partial resistance, reductions in percent emergence and the number of damped-off seedlings were significantly higher for plants inoculated at the day of planting compared to inoculations of plants with unifoliates present (5 days after planting). Results also indicate that fungicide seed treatment on cultivars with partial resistance may be beneficial when the environmental conditions that favor P. sojae infections occur prior to soybean emergence. This greenhouse assay appears to be useful in examining overall fungicide efficacy; however, it did not detect consistent and quantifiable differences in rates of seed treatment fungicides.

Soybean has been increasing in importance and acreage over wheat and corn for the past decade in Ohio and is now planted on 4.5 million acres. Previous surveys in Ohio of viruses infecting soybean failed to identify Bean pod mottle virus (BPMV) and soybean virus diseases have rarely caused economic losses (1). During 1999, producers in Ohio noticed virus-like symptoms in soybeans in a few isolated locations. Soybeans with green stems, undersized and "turned up pods" were collected from Union, Wood and Wyandot Counties during October 1999 and soybeans with crinkled, mottled leaves were collected in Henry, Licking and Sandusky during August 2000. Five to six plants were collected from a single field from each county each year. In 1999, samples were sent to the University of Wisconsin-Madison, where one symptomatic leaflet/sample was ground in 3 ml of chilled phosphate buffered saline (pH 7.2). Leaf sap was placed in 1.5-ml centrifuge tubes and stored at 4°C for 24 h. Sap was assayed for the presence of BPMV using an alkaline phosphatase-labeled double-antibody sandwich enzyme-linked immunosorbent assay (DAS ELISA) for BPMV (AgDia Inc., Elkhart, IN). All samples tested were positive for BPMV. Samples collected in 1999 were also maintained at The Ohio State University in Harosoy soybean and in 2000 assayed serologically along with samples collected in 2000 for BPMV and Soybean mosaic virus (SMV) by ELISA and for Tobacco ringspot virus (TRSV) and Bean yellow mosaic virus (BYMV) by a host-range symptom assay; SMV, BYMV and TRSV had been identified from soybean in previous Ohio surveys. Soybean leaf samples were assayed using F(ab') 2 -Protein A ELISA with antiserum prepared in 1968 to a southern U.S. isolate of BPMV and to an Ohio isolate of Soybean mosaic virus (SMV) prepared in 1967, both stored at -20°C. Diseased and non-symptomatic soybean leaf samples were ground in 4 ml 0.025M Tris pH 8.0, 0.015M NaCl and 0.05% Tween 20. Extracts were tested for BPMV and SMV by ELISA following a protocol described elsewhere (2). All of the samples collected during 1999 and maintained in the greenhouse tested positive for both BPMV and SMV while all of those samples collected during 2000 tested positive for BPMV and negative for SMV. Host-range symptom assays were conducted with leaf extracts prepared by grinding 1 g tissue:10 ml potassium phosphate buffer, pH 7.0. Extracts were inoculated by leaf rub method to Harosoy soybean, Phaseolus vulgaris cvs. Red Kidney and Bountiful, cowpea, and cucumber. The host-range symptom assays of both the 1999 and 2000 samples were negative for TRSV and BYMV; cowpea failed to express local lesions and cucumber systemic mosaic characteristic of TRSV infection and the two Phaseolus cultivars the yellow mosaic characteristic of BYMV infection. These results indicate that both BPMV and SMV were present in the samples in 1999 but only BPMV in 2000. The distribution of BPMV within Ohio and economic impact of this virus have yet to be determined. This is the first report of BPMV in Ohio. References: (1) A. F. Schmitthenner and D. T. Gordon. Phytopathology 59:1048, 1969. (2) R. Louie et al. Plant Dis. 84:1133-1139, 2000.

Single dominant Rps genes have been highly effective in managing Phytophthora sojae. However, numerous physiological races of P. sojae have developed in response to deploying single gene resistance. New sources of resistance with potentially novel Rps genes are needed. A selection of accessions (PI273483 to PI427107) from the United States Department of Agriculture Soybean Germplasm collection were evaluated for resistance to P. sojae using the hypocotyl inoculation technique for Rps genes and the layer test for partial resistance. Of the 1,015 accessions tested, 159 accessions were susceptible to races 7 (vir 1a, 2, 3a, 3c, 4, 5, 6, 7), 17 (1b, 1d, 2, 3a, 3b, 3c, 4, 5, 6, 7), and 25 (1a, 1b, 1c, 1k, 7). However, 162 accessions were resistant to these three races and 32 accessions were resistant to an additional five races chosen specifically to elicit a susceptible interaction with two and three Rps gene combinations. In addition, 55.5% of the 887 accessions tested had high levels of partial resistance or tolerance (scores ≤4.0) to P. sojae. The majority of the accessions that were resistant to all of the races tested and those that had very high levels of partial resistance originated in the Republic of Korea. These results indicate that this region is an area with many sources of resistance to P. sojae for both specific Rps genes and partial resistance.

Isolates of Stenocarpella maydis from seed companies and plant disease clinics in the United States and the Republic of South Africa were assayed for isozyme polymorphisms and cultural variability. A low level of isozyme polymorphisms was detected in this collection of isolates. Isozyme polymorphisms were detected for α-esterase, hexose kinase, and malate dehydroge-nase of the enzymes assayed. Fungi often have limited variability among isozyme profiles, and this is especially true for fungi that have host specialization such as biotrophs or fungi with formae speciales designations. Optimum growth temperature, colony color, and pycnidiospore production were also measured. All isolates had an optimum temperature of 28 to 31°C for colony growth on acidified potato dextrose agar. Colony color and pycnidiospore production were variable over the course of several experiments, indicating that these phenotypes are poor genetic markers.

The first detection in the United States of isolates of Phytophthora infestans having metalaxyl insensitivity and complex pathotypes occurred in western Washington during the early 1990s. To determine the genetic structure of the current population in western Washington, a total of 115 isolates of P. infestans were obtained during 1996 from infected tubers or foliage of potato, tomato, nightshade, and bittersweet throughout the region. An additional 45 isolates were collected from a single field. Based on mating type, metalaxyl-insensitivity, and molecular markers (allozymes of glucose-6-phosphate isomerase, peptidase, and RG57 DNA fingerprint), all of the isolates were A1 mating type and had the US-11 multilocus genotype. Analyses of an additional 120 isolates collected during 1997 from potato, tomato, and nightshade were performed. As in 1996, US-11 was the predominant genotype detected on all three hosts. However, three additional A2 mating type genotypes were also detected: US-7, US-8, and US-14. These three genotypes represent the first A2 mating type isolates detected in western Washington. Most of a subset of 60 isolates infected 4 to 7 of the 10 potato differentials tested. This included 90% of the isolates collected in 1996 (all US-11), plus 72% of the US-11 and 100% of the US-8 and US-14 isolates collected during 1997. Virulence phenotypes in this region are complex even without the selection pressure of R-genes in the local commercial cultivars. The apparent increase in genetic variation observed in populations of P. infestans in western Washington from 1996 to 1997 most likely occurred by migration rather than by sexual recombination.

Curative applications of thiophanate-methyl + mancozeb to blighted seed pieces of three potato (Solanum tuberosum) cultivars significantly reduced the amount of surface area colonized by Phytophthora infestans compared with treatment with thiophanate-methyl or no fungicide under laboratory conditions. Percent blighted tuber surface area over six tests averaged 3.5, 11.4, and 21.2% for the three treatments, respectively. Seed pieces inoculated with P. infestans US-8 or US-11 incubated, and then treated with the same fungicides and planted at Oregon and Washington field sites, respectively, had higher emergence across locations for thiophanate-methyl + mancozeb than for thiophanate-methyl (30 versus 12.5%). Emergence of healthy thiophanate-methyl + mancozeb-treated seed pieces averaged 93%. When protective applications of these fungicides, mancozeb, or fludioxinil were made to healthy potato seed pieces prior to inoculation with P. infestans, plant emergence in the greenhouse was significantly increased with thiophanate-methyl + mancozeb compared with fludioxinil (92 versus 36%) in Oregon and with thiophanate-methyl or fludioxinil (90 versus 20 and 24%) in Washington. Inoculation of healthy seed pieces reduced plant stand in all greenhouse tests; however, treatment with thiophanate-methyl + mancozeb or mancozeb alone prior to inoculation resulted in sprout emergence similar to that of the noninoculated control. In a late blight management program, treatment of seed pieces with a registered fungicide that has activity against P. infestans contributes to an increase in plant emergence and improved crop uniformity. However, for maximum benefit, the fungicide must be in place before coming in contact with the pathogen.

A diallel cross of seven inbreds and one synthetic line of maize were analyzed in 1994 and 1995 for their reaction to Diplodia ear rot. An additional inbred line was included in the 1995 analysis. Plants were inoculated by placing a pycnidiospore suspension (5 × 10 3 spores per ml) of Stenocarpella maydis in the whorl at the V14 to V15 growth stage. Crosses were evaluated for disease incidence of Diplodia ear rot at harvest, and the percentage of plants with Diplodia ear rot in a plot was used for analysis. In both years, general combining ability (GCA) effects were significant. In 1995, specific combining ability effects were also significant. There were no reciprocal effects. There was no significant interaction between year and genotypes, indicating that crosses reacted the same in both years. Inbred lines B37, H111, B68, and MS had negative GCA effects that contributed toward resistance in both years. VA26, with intermediate resistance to Diplodia ear rot, contributed toward susceptibility. Only inbred lines with a high degree of resistance should be used as parents.

Two laboratory methods (whole tuber and tuber slice) were evaluated and compared with field assessment of potato tubers for resistance to late blight caused by Phytophthora infestans. Altogether, the resistance responses of 20 cultivars and advanced selections were compared by the three methods. All three assays separated materials into resistant and susceptible groups. The majority of cultivars and advanced selections did not react in the same way within the field and tuber-slice assays but did react similarly within the whole-tuber assay. Some cultivars were susceptible in the field at harvest but were resistant in the whole-tuber assay. The differences may be due to the extent of lenticel and eye development during tuber formation. In contrast, other cultivars resistant in the field at harvest were susceptible in the whole-tuber assay. In this case, placement in the hill may affect whether or not the tuber is exposed to inoculum or whether aging of tubers during storage affects susceptibility to tuber blight. Our study shows that high levels of tuber resistance are available in certain commercial cultivars and advanced potato selections. For laboratory assessments to be reliable, however, both pre- and poststorage evaluations may be necessary.

Greenhouse and laboratory screening methods for assessing potato foliage for resistance to late blight were compared using 15 cultivars and advanced breeding selections with known field response to late blight. Screening methods included greenhouse inoculation of plants in several age classes, and laboratory assays of detached leaflets, leaf disks, and stem cuttings. Greenhouse inoculation of plants 7 to 11 weeks after planting, near the time of flowering, corresponded best to results obtained in field evaluations, but there were significant differences in disease severity between separate greenhouse tests. This is consistent with variation in late blight severity on a year-to-year basis when cultivars are compared in the field. The greenhouse inoculation method allowed for testing of several components of partial resistance, such as infection efficiency and lesion growth rate, which may exist for each cultivar. Laboratory assays proved less reliable than greenhouse assays for overall ratings of partial resistance, but could be useful for measuring specific components of resistance. Screening evaluations for late blight resistance should include standard cultivars with known reaction to Phytophthora infestans to reference the disease potential within the screening evaluation.