Search

A synthetic protocol has been designed to incorporate the DO3A ligand to the focal point of cationic or anionic carbosilane dendrons, affording a set of bifunctional chelating agents (BFCAs) useful for potential biomedical applications. The complexation behavior study of ionic BFCAs has been accomplished by UV-vis and electron paramagnetic resonance spectroscopy as well as potentiometric titrations. The presence of the dendron branches modifies the complexation capacity of the macrocyclic ring with respect to that of the 1,4,7,10-tetraazacyclodocecane-N,N′,N″,N‴-tetraacetic acid (DOTA) ligand. Also, a different behavior has been observed in the carboxylate-terminated dendrons against analogous sulfonate- or amine-terminated dendrons in the contribution of the branches and peripheral groups to the coordination modes. The presence or not of Cu-S2O2 coordination sites and the generation can be important factors to take into account for considering a particular biomedical application. [ABSTRACT FROM AUTHOR]

The importance of ion pairing in different fields of chemistry is widely recognized. In this work, we have synthesized a set of cationic p -cymene ruthenium complexes of general formula [( p -cym)Ru(L')(κ 2 -O^N-L)]X ( p -cym = p -cymene; L' = N -methylimidazole (MeIm), N-ethylpiperidylimidazole (EpipIm), 1,3,5-triaza-7-phosphaadamantane (PTA); L = 2-(1H-benzimidazol-2-yl)phenolato (L1), 2-(1,3-benzothiazol-2-yl)phenolato (L2); X = Cl - , BF 4 - , OTf - , BPh 4 - ). X-ray diffraction studies on selected complexes revealed relatively strong anion-cation interactions in the solid state mainly based on N-H···X (X = Cl, F, O) and C-H···π interactions, also observed in the DFT-modeled complexes in the gas phase. Moreover, NMR studies showed that they exist as intimate ion pairs in solution and, remarkably, as head-to-tail quadruples in the particular case of the cation [( p -cym)Ru(MeIm)(κ 2 - O^N-L1)] + ([ 1 ] + ) with Cl - and BPh 4 - as counteranions. Furthermore, a value of Δ G = -2.9 kcal mol -1 at 299 K has been estimated for the equilibrium {[ 1 ]BPh 4 ···[ 1 ]BPh 4 } ⇆ 2{[ 1 ] + ···BPh 4 - } in concentrated CDCl 3 solutions. In addition, preliminary studies concerning the cytotoxic properties against HeLa cell lines of the derivatives suggested a positive effect derived from the presence of the lipophilic BPh 4 - anion and also from the NH group of the benzimidazolyl fragment.

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.