Search

Substituting slow oxygen evolution reaction (OER) with thermodynamically favorable urea oxidation reaction (UOR) is considered as one of the feasible strategies for achieving energy-saving hydrogen production. Herein, a uniform layer of NiMoO4 nanorods was grown on nickel foam by a hydrothermal method. Then, a series of Ni-MoOx/NF-X nanorod catalysts comprising Ni/NiO and MoOx (MoO2/MoO3) were prepared through regulating annealing atmosphere and reduction temperature. The optimized Ni-MoOx/NF-3 with a large accessible specific area can act as a bifunctional catalyst for electrocatalytic anodic UOR and cathodic hydrogen evolution reaction (HER). At a current density of 100 mA cm−2, the introduction of urea can significantly reduce the overpotential of Ni-MoOx/NF-3 by 210 mV compared to OER. In addition, Ni-MoOx/NF-3 has a higher intrinsic activity than other catalysts. It only requires −0.21 and 1.38 V to reach 100 mA cm−2 in HER and UOR, respectively. Such an excellent performance can be attributed to the synergistic function between Ni and MoOx. The presence of metallic Ni and reduced MoOx in pairs is beneficial for improving the electrical conductivity and modulating the electronic structure, resulting in enhancing the electrocatalytic performance. When assembling Ni-MoOx/NF-3 into an overall urea–water splitting system, it can achieve energy-saving hydrogen production and effective removal of urea-rich wastewater. [ABSTRACT FROM AUTHOR]

The investigation on the temporal dynamics of graphene-wrapped core–shell nanoparticles under the illumination of a Gaussian impulse have been carried out. By altering the graphene layers and the aspect ratio of the core–shell structure, we can adjust the resonant modes into typical cases in regime of terahertz. Accordingly, different scenarios for the temporal evolution are detected, which include two kinds of ultrafast oscillation with exponential decay tendency, pure exponential decay, and Gaussian shape, when the pulse duration of the incident pulse is much shorter than, similar to, and much longer than the localized surface plasmon lifetime. To one's interest, when the coupling between two resonant modes exists, one predicts the long-periodic oscillation, whose period is just the difference between the frequencies of the resonant modes. Hence, the intrinsic properties of the ultrafast oscillation can be hardly influenced by the input signals. Further quantitative calculation demonstrate that the periods of the ultrafast oscillations can be tuned by different physical mechanisms, which are, respectively, based on the self-interacting correction of a single resonance and the strong coupling between the resonant modes in frequency domain. Our results may be applicable in the fields of optical sensors, optical information processing, and other nanophotonic devices. [ABSTRACT FROM AUTHOR]

In this paper, a promising method for growing large-sized and high-quality Mg2SiO4 single crystals was explored, and a transparent Mg2SiO4 single crystal, 30 mm in diameter and 80 mm in length, was successfully grown by the Czochralski method. The morphology of dislocation was studied by chemical etching and explained by surface energy based on the density functional theory (DFT) method. And the anisotropy of its thermodynamic and optical properties was studied. The experimental results showed a maximum Mohs hardness of 6.84 and the highest thermal conductivity of 11.73 W m−1 K−1, indicating that Mg2SiO4 has higher hardness and better thermal properties. Furthermore, the refractive index curves along the three principal axes in the range of 200–1700 nm and transmittance curves in the range of 200–2500 nm were obtained. The maximum phonon energy of the Mg2SiO4 crystal was determined. Finally, the band structure and density of states (DOS) were calculated based on the DFT method. These results provide an important reference for the application of Mg2SiO4 as a near-infrared tunable laser crystal host. [ABSTRACT FROM AUTHOR]

Non-contact optical temperature sensing technology, particularly based on the fluorescence intensity ratio principle of the thermally coupled energy levels of Er3+, has emerged as a prominent area of research for upconversion luminescent materials in temperature detection. To advance the development of novel upconversion luminescent materials for optical temperature sensing, an upconversion phosphor, GdScO3:Yb3+/Er3+, with low phonon energy, was synthesized using a high-temperature solid-state method. The crystal structure, maximum phonon energy, and elemental distribution of the sample were characterized through powder X-ray diffraction, scanning electron microscopy, Raman spectroscopy, and Fourier transform infrared spectroscopy. The upconversion emission spectrum of the sample under 980 nm excitation and the excited state absorption process under different power density excitations were thoroughly investigated. The findings demonstrate the commendable performance of the GdScO3:Yb3+/Er3+ phosphor, which exhibits a suitable thermally coupled energy levels energy difference (ΔE) of 630 cm− 1, an exceptional relative sensitivity of 1.007% K− 1 at 300 K, and a minimal temperature resolution of 0.49 K at 300 K. The remarkable consistency and robust thermal stability of the GdScO3:Yb3+/Er3+ phosphors underscore their potential in highly sensitive optical thermometry applications. [ABSTRACT FROM AUTHOR]

Background: Sports records hold valuable insights into human physiological limits. However, presently, there is a lack of integration and evolutionary patterns in the recorded information across various sports. Methods: We selected sports records from 1992 to 2018, covering 24 events in men's track, field, and swimming. The Gembris prediction model calculated performance randomness, and Pearson correlation analysis assessed network relevance between projects. Quantitative study of model parameters revealed the impact of various world records' change range, predicted value, and network correlation on evolutionary patterns. Results: 1) The evolution range indicates that swimming events generally have a larger annual world record variation than track and field events; 2) Gembris's predictions show that sprint, marathon, and swimming records outperform their predicted values annually; 3) Network relevance analysis reveals highly significant correlations between all swimming events and sprints, as well as significant correlations between marathon and all swimming events. Conclusion: Sports record evolution is closely linked not only to specific sports technology but also to energy expenditure. Strengthening basic physical training is recommended to enhance sports performance. [ABSTRACT FROM AUTHOR]

The establishment of symbiotic interactions between leguminous plants and rhizobia requires complex cellular programming activated by Rhizobium Nod factors (NFs) as well as type III effector (T3E)-mediated symbiotic signaling. However, the mechanisms by which different signals jointly affect symbiosis are still unclear. Here we describe the mechanisms mediating the cross-talk between the broad host range rhizobia Sinorhizobium fredii HH103 T3E Nodulation Outer Protein L (NopL) effector and NF signaling in soybean. NopL physically interacts with the Glycine max Remorin 1a (GmREM1a) and the NFs receptor NFR5 (GmNFR5) and promotes GmNFR5 recruitment by GmREM1a. Furthermore, NopL and NF influence the expression of GmRINRK1, a receptor-like kinase (LRR-RLK) ortholog of the Lotus RINRK1, that mediates NF signaling. Taken together, our work indicates that S. fredii NopL can interact with the NF signaling cascade components to promote the symbiotic interaction in soybean. This study showed that the type III effector NopL can interact with the Nod factor receptor GmNFR5, and the existence of NopL can promote GmREM1 interacts with GmNFR5, which demonstrates a signaling pathway underlying the symbiosis establishment in soybean. [ABSTRACT FROM AUTHOR]

Soybean is the major global source of edible oils and vegetable proteins. Seed size and weight are crucial traits determining the soybean yield. Understanding the molecular regulatory mechanism underlying the seed weight and size is helpful for improving soybean genetic breeding. The molecular regulatory pathways controlling the seed weight and size were investigated in this study. The 100-seed weight, seed length, seed width, and seed weight per plant of a chromosome segment substitution line (CSSL) R217 increased compared with those of its recurrent parent 'Suinong14' (SN14). Transcriptomic and proteomic analyses of R217 and SN14 were performed at the seed developmental stages S15 and S20. In total, 2643 differentially expressed genes (DEGs) and 208 differentially accumulated proteins (DAPs) were detected at S15, and 1943 DEGs and 1248 DAPs were detected at S20. Furthermore, integrated transcriptomic and proteomic analyses revealed that mitogen-activated protein kinase signaling and cell wall biosynthesis and modification were potential pathways associated with seed weight and size control. Finally, 59 candidate genes that might control seed weight and size were identified. Among them, 25 genes were located on the substituted segments of R217. Two critical pathways controlling seed weight were uncovered in our work. These findings provided new insights into the seed weight-related regulatory network in soybean. [ABSTRACT FROM AUTHOR]

The silicon carbide (SiC) inverter brings great advantages to the motor drive systems of new energy vehicles; however, severe challenges to the bearings also happen. The high dc bus voltage and switching frequency of SiC inverter can increase the discharge frequency and energy when the bearing grease film collapses. As a result, the bearing suffers severe electric corrosion, and the service life of the motor drive system can be shortened. In this paper, the characteristics of common-mode voltage and bearing voltage are analyzed, firstly under space vector pulse width modulation (SVPWM). After that, the common-mode equivalent circuit model of the motor drive system is established. The frequency characteristics of bearing voltage are revealed, and the safe working area is determined. Then, the frequency characteristics of bearing voltage and current are verified based on IGBT and SiC inverters in experiments. After that, by designing a common-mode filter, the bearing voltage and current are significantly attenuated. Furthermore, the active zero state PWM (AZSPWM) is adopted to reduce the common-mode voltage from the inverter. At the same time, combined with the common-mode filter, the bearing voltage and current are further reduced. The experimental results show that the switching frequency has a decisive effect on the amplitude of bearing voltage and current. The bearing voltage can be attenuated to around half of the reference bearing voltage by using the common-mode filter and AZSPWM strategy, respectively. The combination of the common-mode filter and AZSPWM strategy can reduce the bearing voltage to around one-fourth of the reference bearing voltage, which can effectively reduce the breakdown time and discharge energy of the grease oil film. [ABSTRACT FROM AUTHOR]

Summary: Soybean is one of the most economically important crops worldwide and an important source of unsaturated fatty acids and protein for the human diet. Consumer demand for healthy fats and oils is increasing, and the global demand for vegetable oil is expected to double by 2050. Identification of key genes that regulate seed fatty acid content can facilitate molecular breeding of high‐quality soybean varieties with enhanced fatty acid profiles. Here, we analysed the genetic architecture underlying variations in soybean seed fatty acid content using 547 accessions, including mainly landraces and cultivars from northeastern China. Through fatty acid profiling, genome re‐sequencing, population genomics analyses, and GWAS, we identified a SEIPIN homologue at the FA9 locus as an important contributor to seed fatty acid content. Transgenic and multiomics analyses confirmed that FA9 was a key regulator of seed fatty acid content with pleiotropic effects on seed protein and seed size. We identified two major FA9 haplotypes in 1295 resequenced soybean accessions and assessed their phenotypic effects in a field planting of 424 accessions. Soybean accessions carrying FA9H2 had significantly higher total fatty acid contents and lower protein contents than those carrying FA9H1. FA9H2 was absent in wild soybeans but present in 13% of landraces and 26% of cultivars, suggesting that it may have been selected during soybean post‐domestication improvement. FA9 therefore represents a useful genetic resource for molecular breeding of high‐quality soybean varieties with specific seed storage profiles. [ABSTRACT FROM AUTHOR]

In the context of autonomous driving, sensing systems play a crucial role, and their accuracy and reliability can significantly impact the overall safety of autonomous vehicles. Despite this, fault diagnosis for sensing systems has not received widespread attention, and existing research has limitations. This paper focuses on the unique characteristics of autonomous driving sensing systems and proposes a fault diagnosis method that combines hardware redundancy and analytical redundancy. Firstly, to ensure the authenticity of the study, we define 12 common real-world faults and inject them into the nuScenes dataset, creating an extended dataset. Then, employing heterogeneous hardware redundancy, we fuse MMW radar, LiDAR, and camera data, projecting them into pixel space. We utilize the "ground truth" obtained from the MMW radar to detect faults on the LiDAR and camera data. Finally, we use multidimensional temporal entropy to assess the information complexity fluctuations of LiDAR and the camera during faults. Simultaneously, we construct a CNN-based time-series data multi-classification model to identify fault types. Through experiments, our proposed method achieves 95.33% accuracy in detecting faults and 82.89% accuracy in fault diagnosis on real vehicles. The average response times for fault detection and diagnosis are 0.87 s and 1.36 s, respectively. The results demonstrate that the proposed method can effectively detect and diagnose faults in sensing systems and respond rapidly, providing enhanced reliability for autonomous driving systems. [ABSTRACT FROM AUTHOR]

ABSTRACT Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP‐type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid‐maturity stage. Co‐analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL‐like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular‐assisted breeding efforts aimed at establishing high‐protein soybean varieties. [ABSTRACT FROM AUTHOR]

Traumatic spinal cord injury (tSCI) is a severe injury to the central nervous system that is categorized into primary and secondary injuries. Among them, the local microenvironmental imbalance in the spinal cord caused by secondary spinal cord injury includes accumulation of cytokines and chemokines, reduced angiogenesis, dysregulation of cellular energy metabolism, and dysfunction of immune cells at the site of injury, which severely impedes neurological recovery from spinal cord injury (SCI). In recent years, single-cell techniques have revealed the heterogeneity of multiple immune cells at the genomic, transcriptomic, proteomic, and metabolomic levels after tSCI, further deepening our understanding of the mechanisms underlying tSCI. However, spatial information about the tSCI microenvironment, such as cell location and cell-cell interactions, is lost in these approaches. The application of spatial multi-omics technology can solve this problem by combining the data obtained from immunohistochemistry and multiparametric analysis to reveal the changes in the microenvironment at different times of secondary injury after SCI. In this review, we systematically review the progress of spatial multi-omics techniques in the study of the microenvironment after SCI, including changes in the immune microenvironment and discuss potential future therapeutic strategies., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Peng, Zhang, Xie, Guo, Cao and Yang.)

Mitigating pre-harvest sprouting (PHS) and post-harvest food loss (PHFL) is essential for enhancing food securrity. To reduce food loss, the use of plant derived specialized metabolites can represent a good approach to develop a more eco-friendly agriculture. Here, we have discovered that soybean seeds hidden underground during winter by Tscherskia triton and Apodemus agrarius during winter possess a higher concentration of volatile organic compounds (VOCs) compared to those remaining exposed in fields. This selection by rodents suggests that among the identified volatiles, 3-FurAldehyde (Fur) and (E)-2-Heptenal (eHep) effectively inhibit the growth of plant pathogens such as Aspergillus flavus, Alternaria alternata, Fusarium solani and Pseudomonas syringae. Additionally, compounds such as Camphene (Cam), 3-FurAldehyde, and (E)-2-Heptenal, suppress the germination of seeds in crops including soybean, rice, maize, and wheat. Importantly, some of these VOCs also prevent rice seeds from pre-harvest sprouting. Consequently, our findings offer straightforward and practical approaches to seed protection and the reduction of PHS and PHFL, indicating potential new pathways for breeding, and reducing both PHS and pesticide usage in agriculture., (© 2024. The Author(s).)

Soybean quality and production are determined by seed viability. A seed's capacity to sustain germination via dry storage is known as its seed life. Thus, one of the main objectives for breeders is to preserve genetic variety and gather germplasm resources. However, seed quality and germplasm preservation have become significant obstacles. In this study, four artificially simulated aging treatment groups were set for 0, 24, 72, and 120 hours. Following an aging stress treatment, the transcriptome and metabolome data were compared in two soybean lines with notable differences in seed vigor-R31 (aging sensitive) and R80 (aging tolerant). The results showed that 83 (38 upregulated and 45 downregulated), 30 (19 upregulated and 11 downregulated), 90 (52 upregulated and 38 downregulated), and 54 (25 upregulated and 29 downregulated) DEGs were differentially expressed, respectively. A total of 62 (29 upregulated and 33 downregulated), 94 (49 upregulated and 45 downregulated), 91 (53 upregulated and 38 downregulated), and 135 (111 upregulated and 24 downregulated) differential metabolites accumulated. Combining the results of transcriptome and metabolome investigations demonstrated that the difference between R31 and R80 responses to aging stress was caused by genes related to phenylpropanoid metabolism pathway, which is linked to the seed metabolite caffeic acid. According to this study's preliminary findings, the aging-resistant line accumulated more caffeic acid than the aging-sensitive line, which improved its capacity to block lipoxygenase (LOX) activity. An enzyme activity inhibition test was used to demonstrate the effect of caffeic acid. After soaking seeds in 1 mM caffeic acid (a LOX inhibitor) for 6 hours and artificially aging them for 24 hours, the germination rates of the R31 and R80 seeds were enhanced. In conclusion, caffeic acid has been shown to partially mitigate the negative effects of soybean seed aging stress and to improve seed vitality. This finding should serve as a theoretical foundation for future research on the aging mechanism of soybean seeds., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2024 Li, Xie, Zhang, Meng, Yang, Fan, Sun, Zheng, Zhang, Wang, Chen, Wang and Jiang.)

Sports records play a crucial role in understanding the limits of human achievement in sports. However, a thorough exploration of a comprehensive analysis of various sports records utilizing the existing statistical model has been lacking. This study introduces a framework for analyzing the integrated features and evolutionary trends of 23 sports records for men and women. It includes world records and intercontinental records from six continents, covering 6440 athletes from 2001 to 2020. Our findings indicate that human beings have not yet reached sports limits in athletic performance, suggesting a continuous improvement over time. Furthermore, we have investigated the contributions of our model's parameters to the integrated features, emphasizing their robustness and convergence in handling data flow and information entropy. Additionally, our model underscores the significance of integrating various sports for ongoing advancement, in line with the Olympic motto "Together," thereby promoting coordinated development., (© 2024. The Author(s).)

Substituting slow oxygen evolution reaction (OER) with thermodynamically favorable urea oxidation reaction (UOR) is considered as one of the feasible strategies for achieving energy-saving hydrogen production. Herein, a uniform layer of NiMoO4 nanorods was grown on nickel foam by a hydrothermal method. Then, a series of Ni-MoOx/NF-X nanorod catalysts comprising Ni/NiO and MoOx (MoO2/MoO3) were prepared through regulating annealing atmosphere and reduction temperature. The optimized Ni-MoOx/NF-3 with a large accessible specific area can act as a bifunctional catalyst for electrocatalytic anodic UOR and cathodic hydrogen evolution reaction (HER). At a current density of 100 mA cm-2, the introduction of urea can significantly reduce the overpotential of Ni-MoOx/NF-3 by 210 mV compared to OER. In addition, Ni-MoOx/NF-3 has a higher intrinsic activity than other catalysts. It only requires -0.21 and 1.38 V to reach 100 mA cm-2 in HER and UOR, respectively. Such an excellent performance can be attributed to the synergistic function between Ni and MoOx. The presence of metallic Ni and reduced MoOx in pairs is beneficial for improving the electrical conductivity and modulating the electronic structure, resulting in enhancing the electrocatalytic performance. When assembling Ni-MoOx/NF-3 into an overall urea-water splitting system, it can achieve energy-saving hydrogen production and effective removal of urea-rich wastewater., (© 2024 Author(s). Published under an exclusive license by AIP Publishing.)