Search

Background: This study sought to estimate the overall cumulative incidence and odds of Hospital-acquired venous thromboembolism (VTE) among critically ill children with and without exposure to invasive ventilation. In doing so, we also aimed to describe the temporal relationship between invasive ventilation and hospital-acquired VTE development., Methods: We performed a retrospective cohort study using Virtual Pediatric Systems (VPS) data from 142 North American pediatric ICUs among children < 18 y of age from January 1, 2016-December 31, 2022. After exclusion criteria were applied, cohorts were identified by presence of invasive ventilation exposure. The primary outcome was cumulative incidence of hospital-acquired VTE, defined as limb/neck deep venous thrombosis or pulmonary embolism. Multivariate logistic regression was used to determine whether invasive ventilation was an independent risk factor for hospital-acquired VTE development., Results: Of 691,118 children studied, 86,922 (12.4%) underwent invasive ventilation. The cumulative incidence of hospital-acquired VTE for those who received invasive ventilation was 1.9% and 0.12% for those who did not ( P < .001). The median time to hospital-acquired VTE after endotracheal intubation was 6 (interquartile range 3-14) d. In multivariate models, invasive ventilation exposure and duration were each independently associated with development of hospital-acquired VTE (adjusted odds ratio 1.64 [95% CI 1.42-1.86], P < .001; and adjusted odds ratio 1.03 [95% CI 1.02-1.03], P < .001, respectively)., Conclusions: In this multi-center retrospective review from the VPS registry, invasive ventilation exposure and duration were independent risk factors for hospital-acquired VTE among critically ill children. Children undergoing invasive ventilation represent an important target population for risk-stratified thromboprophylaxis trials., Competing Interests: The authors have disclosed no conflicts of interest., (Copyright © 2024 by Daedalus Enterprises.)

Watermelon ( Citrullus lanatus ) and melon ( Cucumis melo ) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies ( Bemisia tabaci ) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus ( Opuntia auberi ) from Sonora, Mexico, and from one cactus ( O. cochenillifera ), lamb's ears ( Stachys byzantine ), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Background: Alzheimer's disease (AD) is a progressive, multifactorial, neurodegenerative disorder affecting >6 million Americans. Chronic, low-grade neuroinflammation, and insulin resistance may drive AD pathogenesis. We explored the neurophysiological and neuropsychological effects of NE3107, an oral, anti-inflammatory, insulin-sensitizing molecule, in AD., Methods: In this phase 2, open-label study, 23 patients with mild cognitive impairment or mild dementia received 20-mg oral NE3107 twice daily for 3 months. Primary endpoints assessed changes from baseline in neurophysiological health and oxidative stress (glutathione level) using advanced neuroimaging analyses. Secondary endpoints evaluated changes from baseline in neuropsychological health using cognitive assessments, including the 11-item Alzheimer's Disease Assessment Scale-Cognitive Subscale (ADAS-Cog11), Mini-Mental State Examination (MMSE), Montreal Cognitive Assessment, Clinical Dementia Rating, Quick Dementia Rating Scale, Alzheimer's Disease Composite Score, and Global Rating of Change (GRC). Exploratory endpoints assessed changes from baseline in neuroinflammation biomarkers (tumor necrosis factor alpha, TNF-α) and AD (amyloid beta and phosphorylated tau [P-tau])., Results: NE3107 was associated with clinician-rated improvements in cerebral blood flow and functional connectivity within the brain. In patients with MMSE ≥ 20 (mild cognitive impairment to mild AD; n = 17), NE3107 was associated with directional, but statistically nonsignificant, changes in brain glutathione levels, along with statistically significant improvements in ADAS-Cog11 (P = .017), Clinical Dementia Rating (P = .042), Quick Dementia Rating Scale (P = .002), Alzheimer's Disease Composite Score (P = .0094), and clinician-rated GRC (P < .001), as well as in cerebrospinal fluid P-tau levels (P = .034) and P-tau:amyloid beta 42 ratio (P = .04). Biomarker analyses also demonstrated directional, but statistically non-significant, changes in plasma TNF-α, consistent with the expected mechanism of NE3107. Importantly, we observed a statistically significant correlation (r = 0.59) between improvements in TNF-α levels and ADAS-Cog11 scores (P = .026) in patients with baseline MMSE ≥ 20., Conclusion: Our results indicate that in this study NE3107 was associated with what appear to be positive neurophysiological and neuropsychological findings, as well as evidence of improvement in biomarkers associated with neuroinflammation and AD in patients diagnosed with dementia. Our findings are consistent with previous preclinical and clinical observations and highlight a central role of neuroinflammation in AD pathogenesis., (Copyright © 2024 the Author(s). Published by Wolters Kluwer Health, Inc.)