Search

Exploitable or potentially exploitable deposits of critical metals, such as rare-earth (REE) and high-field-strength elements (HFSE), are commonly associated with alkaline or peralkaline igneous rocks. However, the origin, transport and concentration of these metals in peralkaline systems remains poorly understood. This study presents the results of a mineralogical and geochemical investigation of the Na-metasomatism of alkali amphiboles and clinopyroxenes from a barren peralkaline granite pluton in NE China, to assess the remobilization and redistribution of REE and HFSE during magmatic-hydrothermal evolution. Alkali amphiboles and aegirine-augites from the peralkaline granites show evolutionary trends from sodic-calcic to sodic compositions, with increasing REE and HFSE concentrations as a function of increasing Na-index [Na#, defined as molar Na/(Na+Ca) ratios]. The Na-amphiboles (i.e., arfvedsonite) and aegirine-augites can be subsequently altered, or breakdown, to form hydrothermal aegirine during late- or post-magmatic alteration. Representative compositions analyzed by in-situ LA-ICPMS show that the primary aegirine-augites have high and variable REE (2194–3627 ppm) and HFSE (4194–16,862 ppm) contents, suggesting that these critical metals can be scavenged by alkali amphiboles and aegirine-augites. Compared to the primary aegirine-augites, the presentative early replacement aegirine (Aeg-I, Na# = 0.91–0.94) has notably lower REE (1484–1972) and HFSE (4351–5621) contents. In contrast, the late hydrothermal aegirine (Aeg-II, Na# = 0.92–0.96) has significantly lower REE (317–456 ppm) and HFSE (6.44–72.2 ppm) contents. Given that the increasing Na# from aegirine-augites to hydrothermal aegirines likely resulted from Na-metasomatism, a scavenging-release model can explain the remobilization of REE and HFSE in peralkaline granitic systems. The scavenging and release of REE and HFSE by Na-metasomatism provides key insights into the genesis of globally significant REE and HFSE deposits. The high Na-index of the hydrothermal aegirine might be useful as a geochemical indicator in the exploration for these critical-metals.

Abstract Organisms must regulate their behavior flexibly in the face of environmental challenges. Failure can lead to a host of maladaptive behavioral traits associated with a range of neuropsychiatric disorders, including attention deficit hyperactivity disorder, autism, and substance use disorders. This maladaptive dysregulation of behavior is influenced by genetic and environmental factors. For example, environmental enrichment produces beneficial neurobehavioral effects in animal models of such disorders. The present study determined the effects of environmental enrichment on a range of measures related to behavioral regulation using a large cohort of male, outbred heterogeneous stock (HS) rats as subjects. Subjects were reared from late adolescence onwards either in pairs in standard housing with minimal enrichment (n = 200) or in groups of 16 in a highly enriched environment consisting of a large multi-level cage filled with toys, running wheels, and shelters (n = 64). Rats were subjected to a battery of tests, including: (i) locomotor response to novelty, (ii) light reinforcement, (iii) social reinforcement, (iv) reaction time, (v) a patch-depletion foraging test, (vi) Pavlovian conditioned approach, (vii) conditioned reinforcement, and (viii) cocaine conditioned cue preference. Results indicated that rats housed in the enriched environment were able to filter out irrelevant stimuli more effectively and thereby regulate their behavior more efficiently than standard-housing rats. The dramatic impact of environmental enrichment suggests that behavioral studies using standard housing conditions may not generalize to more complex environments that may be more ethologically relevant.

BackgroundType I interferon (IFN-I) and IFN autoantibodies play a crucial role in controlling SARS-CoV-2 infection. The levels of these mediators have only rarely been studied in the alveolar compartment in patients with COVID-19 acute respiratory distress syndrome (CARDS) but have not been compared across different ARDS etiologies, and the potential effect of dexamethasone (DXM) on these mediators is not known.MethodsWe assessed the integrity of the alveolo-capillary membrane, interleukins, type I, II, and III IFNs, and IFN autoantibodies by studying the epithelial lining fluid (ELF) volumes, alveolar concentration of protein, and ELF-corrected concentrations of cytokines in two patient subgroups and controls.ResultsA total of 16 patients with CARDS (four without and 12 with DXM treatment), eight with non-CARDS, and 15 healthy controls were included. The highest ELF volumes and protein levels were observed in CARDS. Systemic and ELF-corrected alveolar concentrations of interleukin (IL)-6 appeared to be particularly low in patients with CARDS receiving DXM, whereas alveolar levels of IL-8 were high regardless of DXM treatment. Alveolar levels of IFNs were similar between CARDS and non-CARDS patients, and IFNα and IFNω autoantibody levels were higher in patients with CARDS and non-CARDS than in healthy controls.ConclusionsPatients with CARDS exhibited greater alveolo-capillary barrier disruption with compartmentalization of IL-8, regardless of DXM treatment, whereas systemic and alveolar levels of IL-6 were lower in the DXM-treated subgroup. IFN-I autoantibodies were higher in the BALF of CARDS patients, independent of DXM, whereas IFN autoantibodies in plasma were similar to those in controls.

Abstract Objectives Extreme heat events (EHEs) are associated with excess healthcare utilization but specific impacts on emergency department (ED) operations and throughput are unknown. In 2021, the Pacific Northwest experienced an unprecedented heat dome that resulted in substantial regional morbidity and mortality. The aim of this study was to examine its impact on ED utilization, unplanned hospitalization, and hospital operations in a large academic healthcare system. Methods Retrospective electronic medical records from three Seattle‐area hospitals were used to compare healthcare utilization during the EHE compared to a pre‐event reference period within the same month. Interrupted time series analysis was used to evaluate the association between EHE exposure and ED visits and hospitalizations. Metrics of ED crowding for the EHE were compared to the reference period using Student's t‐tests and chi‐squared tests. Additionally, multivariable Poisson regression was used to identify risk factors for heat‐related illness and hospital admission. Results Interrupted time series analysis showed an increase of 21.7 ED visits per day (95% confidence interval [CI] = 14.7, 28.6) and 9.9 unplanned hospitalizations per day (95% CI = 8.3, 11.5) during the EHE, as compared to the reference period. ED crowding and process measures also displayed significant increases, becoming the most pronounced by day 3 of the EHE; the EHE was associated with delays in ED length of stay of 1.0 h (95% CI = 0.4, 1.6) compared to the reference period. Higher incidence rate ratios for heat‐related illness were observed for patients who were older (incidence rate ratio [IRR] = 1.02; 95% CI = 1.01,1.03), female (IRR = 1.47; 95% CI = 1.06, 2.04), or who had pre‐existing diabetes (IRR = 3.19; 95% CI = 1.47, 6.94). Conclusions The 2021 heat dome was associated with a significant increase in healthcare utilization including ED visits and unplanned hospitalizations. Substantial impacts on ED and hospital throughput were also noted. These findings contribute to the understanding of the role extreme heat events play on impacting patient outcomes and healthcare system function.

Background and Purpose: We aimed to determine the reliability and validity of the Stellenbosch Endometriosis Quality of Life (SEQOL) among patients with endometriosis in the United Kingdom. Methods: We used a cross-sectional research design that featured online data collection. We administered several measures to 596 participants. Data analysis included confirmatory factor analysis, exploratory factor analysis, reliability analysis, and correlations. Results: The data did not fit the original eight-factor structure, but rather a six-factor structure. Six items were removed. The measure produced strong internal consistency reliabilities. The SEQOL also demonstrated promising validity, producing strong correlations with another health-related quality of life (HRQOL) measure. Conclusion: In summary, we conclude that the United Kingdom version of the SEQOL is a viable measure of HRQOL., (© Copyright 2024 Springer Publishing Company, LLC.)

The purpose of this study was to better understand barriers and enabling conditions for HPV vaccination in school-based vaccination programs in Canada. Semi-structured interviews were conducted by telephone or in person with parents, nurses, and school staff (n = 50) in three Canadian provinces. Interviews explored views on HPV and HPV vaccination, strengths and weaknesses of the school-based HPV vaccination programs and proposed interventions to increase uptake. Interview transcripts were coded and analyzed thematically using the socio-ecological model. Participants had positive views towards HPV vaccination and school-based offer. They identified barriers and enabling conditions at the individual and interpersonal level (e.g., knowledge, attitudes, behaviours of - and relationships between - parents, nurses, and school personnel), at the organizational level (e.g., allocated resources, information provision, process to ensure informed consent, vaccination setting and environment) and at the community and policy level (e.g., social group values and norms, media coverage around the HPV vaccine). Participants also suggested strategies to reduce identified barriers (e.g., communication interventions, simpler inform consent process). Different layers of barriers and enabling conditions of HPV vaccination in school settings were identified. Tailored interventions remain key to enhance vaccine acceptance and uptake., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Author(s). Published by Elsevier Ltd.. All rights reserved.)

Introduction: Febrile infants under 3 months of age are at risk of invasive bacterial infection (IBI). It is currently unclear if testing for respiratory viruses may have a role in IBI risk stratification. If found to be associated with the likelihood of IBI, respiratory viral point-of-care testing may improve patient and caregiver experience, reduce costs and enhance antimicrobial stewardship., Methods and Analysis: This is a study protocol for a systematic review and meta-analysis that aims to answer the following question: In young febrile infants presenting to emergency care settings does a positive respiratory viral test for RSV, Influenza or SARS-CoV2 (relative to a negative test) add value to current risk stratification pathways for the exclusion of invasive bacterial infection, subsequently enabling safe de-escalation of investigation and treatment ?A search strategy will include MEDLINE, EMBASE, Web of Science, The Cochrane Library and grey literature. Abstracts and then full texts will be independently screened for selection. Data extraction and quality assessment will be completed by two independent authors.The primary objective is to analyse the ability of a positive respiratory viral test to identify the overall risk of IBI. The secondary objective is to perform a subgroup analysis to investigate how the risk stratification alters based on other variables including virus type, patient characteristics and the presence of an identified source of fever.Bivariate random-effects meta-analysis will be undertaken. Diagnostic odds ratios (OR), sensitivity, specificity and positive and negative likelihood ratios will be calculated. The degree of heterogeneity and publication bias will be investigated and presented., Ethics and Dissemination: Ethical approval is not required. We will follow the Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines to disseminate the study results through publication and conference presentations., Prospero Registration Number: This protocol is registered in PROSPERO-ID number: CRD42023433716., Competing Interests: Competing interests: None declared., (© Author(s) (or their employer(s)) 2024. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.)

The COVID-19 pandemic brought unplanned service disruption for breast cancer diagnostic, treatment and support services. This scoping review describes these changes and their impact in the UK and the Republic of Ireland based on studies published between January 2020 and August 2023. Thirty-four of 569 papers were included. Data were extracted and results thematically organized. Findings include fewer new cases; stage shift (fewer early- and more late-stage disease); and changes to healthcare organization, breast screening and treatment. Examples are accepting fewer referrals, applying stricter referral criteria and relying more on virtual consultations and multi-disciplinary meetings. Screening service programs paused during the pandemic before enacting risk-based phased restarts with longer appointment times to accommodate reduced staffing numbers and enhanced infection-control regimes. Treatments shifted from predominantly conventional to hypofractionated radiotherapy, fewer surgical procedures and increased use of bridging endocrine therapy. The long-term impact of such changes are unknown so definitive guidelines for future emergencies are not yet available. Cancer registries, with their large sample sizes and population coverage, are well placed to monitor changes to stage and survival despite difficulties obtaining definitive staging during diagnosis because surgery and pathological assessments are delayed. Multisite longitudinal studies can also provide guidance for future disaster preparedness., (© 2024. The Author(s).)

The SP/KLF family of transcription factors harbour three C-terminal C2H2 zinc fingers interspersed by two linkers which confers DNA-binding to a 9-10 bp motif. Mutations in KLF1, the founding member of the family, are common. Missense mutations in linker two result in a mild phenotype. However, when co-inherited with loss-of-function mutations, they result in severe non-spherocytic hemolytic anemia. We generate a mouse model of this disease by crossing Klf1 +/- mice with Klf1 H350R/+ mice that harbour a missense mutation in linker-2. Klf1 H350R/- mice exhibit severe hemolysis without thalassemia. RNA-seq demonstrate loss of expression of genes encoding transmembrane and cytoskeletal proteins, but not globins. ChIP-seq show no change in DNA-binding specificity, but a global reduction in affinity, which is confirmed using recombinant proteins and in vitro binding assays. This study provides new insights into how linker mutations in zinc finger transcription factors result in different phenotypes to those caused by loss-of-function mutations., (© 2024. The Author(s).)

Objectives: To assess the (i) predictors of and associated rates of success and; (ii) maternal and perinatal outcomes of women undergoing trial of labour after two previous caesarean sections (TOLA2C)., Study Design: This retrospective cohort study collected data from two regional obstetric centres with 12,000 deliveries per annum collectively. The population included singleton pregnancies undergoing (i) TOLA2C, (ii) elective repeat caesarean section following two caesarean sections (ERCS) and (iii) trial of labour after one caesarean section (TOLA1C). Data was collected electronically from 2013 to 2021. Statistical analysis included Fisher exact and Kruskal-Wallis test to compare unpaired samples alongside univariate and multivariable logistic regression. The primary outcome measure was maternal and perinatal outcome., Results: The three groups included; n = 146 TOLA2C, n = 206 ERCS and n = 99 TOLA1C. TOLA2C had a success rate of 65 % compared to 74 % for TOLA1C (p = 0.16). The optimal predictor of successful TOLA2C was previous successful TOLA1C OR 8.65 (95 % CI 2.75-38.41). TOLA2C was associated with greater risk of endometritis and/or sepsis postnatally compared to the other two groups [10.3 % (n = 15) versus 0.5 % (n = 1) and 3 % (n = 3) for ERCS and TOLA1C respectively p < 0.01]. It was also associated with longer maternal hospital stay [2.4 days (+/-1.8) versus 1.8 (+/-0.8) and 1.8 (+/-1.7) p < 0.01], a greater proportion of neonates with Apgar scores less than 7 (p=<0.01) and higher rates of neonatal unit admission [14 % (n = 20) versus 5 % (n = 11) versus 4 % (n = 4) (p=<0.01)]., Conclusion: Women considering trial of labour following two caesarean sections should be counselled regarding the potential increased risk of endometritis, sepsis and adverse neonatal outcome., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Authors. Published by Elsevier B.V. All rights reserved.)

Objective: Youth who display elevated callous-unemotional (CU) traits are at risk for negative developmental outcomes. Previous studies demonstrate that environmental conditions contribute to elevated levels of CU traits, but the majority of this work focuses on a single source of environmental influence. To better understand how environmental conditions contribute to changes in CU traits during adolescence, the current study examined the time-varying relation between CU traits, parent, peer, and community conditions., Method: Using data from the longitudinal Pathways to Desistance study (N = 1,026 males, M age   = 15.98, SD  = 1.16; 40.94% Black, 34.11% Latino, 20.66% White, 4.29% Other), full-factorial fixed effect regression models were implemented to examine how parental hostility, antisocial peers, community violence, and neighborhood disorder are individually and interactively associated with within-person changes in CU traits during adolescence (15-21 years)., Results: Results indicated that proximal conditions (i.e., negative parenting, antisocial peers) had more consistent associations with CU traits than distal conditions (i.e., neighborhood disorder, community violence). Affiliation with antisocial peers was not significantly related to CU traits when youth were simultaneously exposed to high community violence and low neighborhood disorder. Further, the association between CU traits and impact of living in high disordered, high violence neighborhoods was stronger for younger youth., Conclusion: Results indicate that the association among parents, peers, and CU trait development is more nuanced than previously suggested, such that the risk that each environmental condition poses is moderated by a youth's age and their exposure to distal conditions.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter., (© 2024 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.)

L1 elements are retrotransposons currently active in mammals. Although L1s are typically silenced in most normal tissues, elevated L1 expression is associated with a variety of conditions, including cancer, aging, infertility and neurological disease. These associations have raised interest in the mapping of human endogenous de novo L1 insertions, and a variety of methods have been developed for this purpose. Adapting these methods to mouse genomes would allow us to monitor endogenous in vivo L1 activity in controlled, experimental conditions using mouse disease models. Here, we use a modified version of transposon insertion profiling, called nanoTIPseq, to selectively enrich young mouse L1s. By linking this amplification step with nanopore sequencing, we identified >95% annotated L1s from C57BL/6 genomic DNA using only 200 000 sequencing reads. In the process, we discovered 82 unannotated L1 insertions from a single C57BL/6 genome. Most of these unannotated L1s were near repetitive sequence and were not found with short-read TIPseq. We used nanoTIPseq on individual mouse breast cancer cells and were able to identify the annotated and unannotated L1s, as well as new insertions specific to individual cells, providing proof of principle for using nanoTIPseq to interrogate retrotransposition activity at the single-cell level in vivo., (© The Author(s) 2024. Published by Oxford University Press on behalf of Nucleic Acids Research.)

The COVID-19 pandemic had a major impact on cancer patients and services but has been difficult to quantify. We examined how the entire cancer pathway-from incidence, presentation, diagnosis, stage, treatment and survival-was affected in Northern Ireland during April-December 2020 compared to equivalent 2018-2019 periods using retrospective, observational cancer registry data from the Northern Ireland Cancer Registry (NICR). There were 6748 cancer cases in April-December 2020 and an average 7724 patients in April-December 2018-2019. Incident cases decreased by 13% (almost 1000). Significant differences were found across age cohorts and deprivation quintiles, with reductions greatest for younger people (<55 years; 19% decrease) and less deprived (22% decrease). A higher proportion had emergency admission (16%-to-20%) with lower proportions diagnosed pathologically (85%-to-83%). There was a significant stage shift, with lower proportions of early stage (29%-to-25%) and higher late-stage (21%-to-23%). Lower proportions received surgery (41%-to-38%) and radiotherapy (24%-to-22%) with a higher proportion not receiving treatment (29%-to-33%). One-year observed-survival decreased from 73.7% to 69.8% and 1-year net-survival decreased from 76.1% to 72.9%, with differences driven by five tumours; Lung (40.3%-to-35.0%), Head-and-Neck (77.4%-to-68.4%), Oesophageal (53.5%-to-42.3%), Lymphoma (81.1%-to-75.2%) and Uterine cancer (87.4%-to-80.4%). Our study reveals profound adverse impact of COVID-19 on the entire cancer patient pathway, with 13% fewer cases, greater emergency admissions and significant stage-shift from early to more advanced-stage disease. There was major treatment impact with lower rates of surgery and radiotherapy and higher proportions receiving no treatment. There were significant reductions in 1-year survival. Our study will support service recovery and protect cancer services in future pandemics or disruptions., (© 2024 The Authors. International Journal of Cancer published by John Wiley & Sons Ltd on behalf of UICC.)

Background: Patients with cirrhosis have a 30-day readmission rate of over 30%. Novel care delivery models are needed to reduce healthcare costs and utilization associated with cirrhosis care. One such model is Home Hospital (HH), which provides inpatient-level care at home. Limited evidence currently exists supporting HH for cirrhosis patients., Aims: The aims of this study were to characterize patients with cirrhosis who received hospital-level care at home in a two-site clinical trial and to describe the care they received. Secondary aims included describing their outcomes, including adverse events, readmissions and mortality., Methods: We identified all patients with cirrhosis who enrolled in HH as part of a two-site clinical trial between 2017 and 2022. HH services include daily clinician visits, intravenous and oral medications, continuous vital sign monitoring, and telehealth specialist consultation. We collected sociodemographic data and analyzed HH stays, including interventions, outcomes, adverse events, and follow-up., Results: 22 patients with cirrhosis (45% Hispanic; 50% limited English proficiency, median MELD-Na 12) enrolled in HH during the study period. Interventions included lab chemistries (82%), intravenous medications (77%), specialist consultation (23%), and advanced diagnostics/procedures (23%). The median length of stay was 7 days (IQR 4-12); 186 bed-days were saved. Two patients (9%) experienced adverse events (AKI). No patients required escalation of care; 9% were readmitted within 30 days., Conclusions: In this two-site study, HH was feasible for patients with cirrhosis, holding promise as a hepatology delivery model. Future randomized trials are needed to further evaluate the efficacy of HH for patients with cirrhosis., (© 2024. The Author(s), under exclusive licence to Springer Science+Business Media, LLC, part of Springer Nature.)

Background: Febrile infants presenting in the first 90 days of life are at higher risk of invasive and serious bacterial infections than older children. Modern clinical practice guidelines, mostly using procalcitonin as a diagnostic biomarker, can identify infants who are at low risk and therefore suitable for tailored management. C-reactive protein, by comparison, is widely available, but whether C-reactive protein and procalcitonin have similar diagnostic accuracy is unclear. We aimed to compare the test accuracy of procalcitonin and C-reactive protein in the prediction of invasive or serious bacterial infections in febrile infants., Methods: For this systematic review and meta-analysis, we searched MEDLINE, EMBASE, Web of Science, and The Cochrane Library for diagnostic test accuracy studies up to June 19, 2023, using MeSH terms "procalcitonin", and "bacterial infection" or "fever" and keywords "invasive bacterial infection*" and "serious bacterial infection*", without language or date restrictions. Studies were selected by independent authors against eligibility criteria. Eligible studies included participants aged 90 days or younger presenting to hospital with a fever (≥38°C) or history of fever within the preceding 48 h. The primary index test was procalcitonin, and the secondary index test was C-reactive protein. Test kits had to be commercially available, and test samples had to be collected upon presentation to hospital. Invasive bacterial infection was defined as the presence of a bacterial pathogen in blood or cerebrospinal fluid, as detected by culture or quantitative PCR; authors' definitions of serious bacterial infection were used. Data were extracted from selected studies, and the detection of invasive or serious bacterial infections was analysed with two models for each biomarker. Diagnostic accuracy was determined against internationally recognised cutoff values (0·5 ng/mL for procalcitonin, 20 mg/L for C-reactive protein) and pooled to calculate partial area under the curve (pAUC) values for each biomarker. Optimum cutoff values were identified for each biomarker. This study is registered with PROSPERO, CRD42022293284., Findings: Of 734 studies derived from the literature search, 14 studies (n=7755) were included in the meta-analysis. For the detection of invasive bacterial infections, pAUC values were greater for procalcitonin (0·72, 95% CI 0·56-0·79) than C-reactive protein (0·28, 0·17-0·61; p=0·016). Optimal cutoffs for detecting invasive bacterial infections were 0·49 ng/mL for procalcitonin and 13·12 mg/L for C-reactive protein. For the detection of serious bacterial infections, procalcitonin and C-reactive protein had similar pAUC values (0·55, 0·44-0·69 vs 0·54, 0·40-0·61; p=0·92). For serious bacterial infections, the optimal cutoffs for procalcitonin and C-reactive protein were 0·17 ng/mL and 16·18 mg/L, respectively. Heterogeneity was low for studies investigating the test accuracy of procalcitonin in detecting invasive bacterial infection (I 2 =23·5%), high for studies investigating procalcitonin for serious bacterial infection (I 2 =75·5%), and moderate for studies investigating C-reactive protein for invasive bacterial infection (I 2 =49·5%) and serious bacterial infection (I 2 =28·3%). The absence of a single definition of serious bacterial infection across studies was the greatest source of interstudy variability and potential bias., Interpretation: Within a large cohort of febrile infants, a procalcitonin cutoff of 0·5 ng/mL had a superior pAUC value to a C-reactive protein cutoff of 20 mg/L for identifying invasive bacterial infections. In settings without access to procalcitonin, C-reactive protein should therefore be used cautiously for the identification of invasive bacterial infections, and a cutoff value below 20 mg/L should be considered. C-reactive protein and procalcitonin showed similar test accuracy for the identification of serious bacterial infection with internationally recognised cutoff values. This might reflect the challenges involved in confirming serious bacterial infection and the absence of a universally accepted definition of serious bacterial infection., Funding: None., Competing Interests: Declaration of interests We declare no competing interests., (Copyright © 2024 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY-NC-ND 4.0 license. Published by Elsevier Ltd.. All rights reserved.)

Objective: Successful clinical conversations about vaccination in pregnancy (pertussis, COVID-19, and influenza) are key to improving low uptake rates of both vaccination in pregnancy and infancy. The purpose of this study was to understand Canadian perinatal care providers' knowledge, attitudes, and practices around vaccination in pregnancy., Methods: Qualitative interviews with 49 perinatal care providers (nurse practitioner, general practitioner, registered nurse, registered midwife, obstetrician-gynecologist, and family physicians) in 6 of 13 provinces and territories were deductively coded using directed content analysis [1] and analyzed according to key themes., Results: Participants detailed their professional training and experiences, patient community demographics, knowledge of vaccines, views and beliefs about vaccination in pregnancy, and attitudes about vaccine counselling. Providers generally described having a good range of information sources to keep vaccine knowledge up to date. Some providers lacked the necessary logistical setups to administer vaccines within their practice. Responses suggest diverging approaches to vaccine counselling. With merely hesitant patients, some opted to dig in and have more in-depth discussions, while others felt the likelihood of persuading an outright vaccine-refusing patient to vaccinate was too low to be worthwhile., Conclusion: Provider knowledge, attitudes, and practices around vaccination varied by professional background. To support perinatal providers' knowledge and practices, clinical guidelines should detail the importance of vaccination relative to other care priorities, emphasize the positive impact of engaging hesitant patients in vaccine counselling., Competing Interests: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (© 2024 The Authors. Published by Elsevier Ltd.)

Objectives: HIV pre-exposure prophylaxis (PrEP) is highly effective in preventing HIV acquisition. In England, NHS availability was limited to participants of the PrEP Impact Trial until late 2020. Some key populations at greater risk of HIV were under-represented in the trial suggesting inequities in trial PrEP access. We used the PrEP-to-need ratio (PnR; number of PrEP users divided by new HIV diagnoses) to investigate whether PrEP access improved following routine commissioning in October 2020 and identify populations most underserved by PrEP., Methods: Aggregated numbers of people receiving ≥1 PrEP prescription and non-late new HIV diagnoses (epidemiological proxy for PrEP need) were taken from national surveillance data sets. We calculated the PnR across socio-demographics during Impact (October 2017 to February 2020; pre-COVID-19 pandemic) and post-commissioning PrEP era (2021) in England., Results: PnR increased >11 fold, from 4.2 precommissioning to 48.9 in 2021, due to a fourfold reduction in non-late new HIV diagnoses and near threefold increase in PrEP users. PnR increased across genders, however, the men's PnR increased 12-fold (from 5.4 precommissioning to 63.9 postcommissioning) while the women's increased sevenfold (0.5 to 3.5). This increasing gender-based inequity was observed across age, ethnicity and region of residence: white men had the highest PnR, increasing >13 fold (7.1 to 96.0), while Black African women consistently had the lowest PnR, only increasing slightly (0.1 to 0.3) postcommissioning, suggesting they were the most underserved group. Precommissioning, the PnR was 78-fold higher among white men than Black women, increasing to 278-fold postcommissioning., Conclusions: Despite the overall increase in PrEP use, substantial PrEP Impact trial inequities widened postcommissioning in England, particularly across gender, ethnicity and region of residence. This study emphasises the need to guide HIV combination prevention based on equity metrics relative to the HIV epidemic. The PnR could support the optimisation of combination prevention to achieve zero new HIV infections in England by 2030., Competing Interests: Competing interests: Flavien Coukan has received funding from the BHIVA/ViiV Implementation Science Scholarship to investigate the barriers and facilitators to PrEP access faced by Black women., (© Author(s) (or their employer(s)) 2024. Re-use permitted under CC BY. Published by BMJ.)

Background: In England, over 80 % of those with hepatitis C virus (HCV) infection have injected drugs. We quantified the HCV cascade of care (CoC) among people who inject drugs (PWID) in England and determined whether this improved after direct-acting antivirals (DAAs) were introduced., Methods: We analysed data from nine rounds of national annual cross-sectional surveys of PWID recruited from drug services (2011-2019; N = 12,320). Study rounds were grouped as: 'Pre-DAAs' (2011-2014), 'Prioritised DAAs' (2015-2016) and 'Unrestricted DAAs' (2017-2019). Participants were anonymously tested for HCV antibodies and RNA and completed a short survey. We assessed the proportion of PWID recently (current/previous year) tested for HCV. For participants ever HCV treatment eligible (past chronic infection with history of treatment or current chronic infection), we assessed the CoC as: HCV testing (ever), received a positive test result, seen a specialist nurse/doctor, and ever treated. We used logistic regression to determine if individuals progressed through the CoC differently depending on time-period, whether time-period was associated with recent testing (all participants) and lifetime HCV treatment (ever eligible participants), and predictors of HCV testing and treatment in the Unrestricted DAAs period., Results: The proportion of ever HCV treatment eligible PWID reporting lifetime HCV treatment increased from 12.5 % in the Pre-DAAs period to 25.6 % in the Unrestricted DAAs period (aOR:2.40, 95 %CI:1.95-2.96). There were also increases in seeing a specialist nurse/doctor. The largest loss in the CoC was at treatment for all time periods. During the Unrestricted DAAs period, recent (past year) homelessness (vs never, aOR:0.66, 95 %CI:0.45-0.97), duration of injecting (≤3 years vs >3 years; aOR:0.26, 95 %CI:0.12-0.60), never (vs current, aOR:0.31, 95 %CI:0.13-0.75) or previously being prescribed OAT (vs current, aOR:0.67, 95 %CI:0.47-0.95), and never using a NSP (vs past year, aOR:0.27, 95 %CI:0.08-0.89) were negatively associated with lifetime HCV treatment. The proportion of PWID reporting recent HCV testing was higher during Unrestricted DAAs (56 %) compared to Pre-DAAs (48 %; aOR:1.28, 95 %CI:1.06-1.54)., Conclusion: COC stages from seeing a specialist onwards improved after DAAs became widely available. Further improvements in HCV testing are needed to eliminate HCV in England., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 The Author(s). Published by Elsevier B.V. All rights reserved.)

Adult maltreatment is a pervasive problem in the United States and has serious individual and societal consequences. Adult protective services (APS) agencies are the social services programs responsible for serving older adults and adults with disabilities who may be experiencing adult maltreatment. The adult maltreatment literature differentiates elder maltreatment from the maltreatment of adults with disabilities, yet APS agencies serve both groups. Understanding the etiology of adult maltreatment as well as the associated risk and protective factors is crucial for APS workers, clinical practitioners, researchers, and policymakers. To advance the evidence in this area, we undertook a scoping review to examine recent evidence on risk and protective factors associated with adult maltreatment. Searches of nine electronic databases were conducted in 2020 to identify studies published in peer-reviewed journals since 2010. A total of 29 studies were included in the final review. The findings identified several categories of risk factors associated with the individual: demographic traits, socioeconomic characteristics, physical and mental health, interpersonal issues, and historical events. Several studies identified caregiver and alleged perpetrator risk factors. However, the current body of research lacks community and contextual risk and protective factors. Therefore, we present several potential data sources that may be leveraged to examine the links between social-contextual characteristics and adult maltreatment. These data may be combined with APS data to advance the field's understanding of risk and protective factors through advanced analytic techniques., Competing Interests: Declaration of Conflicting InterestsThe author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Objectives: The objective of this study was to collect information on human chorionic gonadotrophin (hCG) laboratory testing and reporting in women with gestational trophoblastic disease (GTD), to assess the associated challenges, and to offer perspectives on hCG testing harmonisation., Design: Information was collected from laboratories by electronic survey (SurveyMonkey) using a questionnaire designed by members of the European Organisation for the Treatment of Trophoblastic Disease (EOTTD) hCG working party., Participants: The questionnaire was distributed by the EOTTD board to member laboratories and their associated scientists who work within the GTD field., Setting: The questionnaire was distributed and accessed via an online platform., Methods: The questionnaire consisted of 5 main sections. These included methods used for hCG testing, quality procedures, reporting of results, laboratory operational aspects, and non-GTD testing capability. In addition to reporting these survey results, examples of case scenarios which illustrate the difficulties faced by laboratories providing hCG measurement for GTD patient management were described. The benefits and challenges of using centralised versus non-centralised hCG testing were discussed alongside the utilisation of regression curves for management of GTD patients., Results: Information from the survey was collated and presented for each section and showed huge variability in responses across laboratories even for those using the same hCG testing platforms. An educational example was presented, highlighting the consequence of using inappropriate hCG assays on clinical patient management (Educational Example A), along with an example of biotin interference (Educational Example B) and an example of high-dose hook effect (Educational Example C), demonstrating the importance of knowing the limitations of hCG tests. The merits of centralised versus non-centralised hCG testing and use of hCG regression curves to aid patient management were discussed., Limitations: To ensure the survey was completed by laboratories providing hCG testing for GTD management, the questionnaire was distributed by the EOTTD board. It was assumed the EOTTD board held the correct laboratory contact, and that the questionnaire was completed by a scientist with in-depth knowledge of laboratory procedures., Conclusions: The hCG survey highlighted a lack of harmonisation of hCG testing across laboratories. Healthcare professionals involved in the management of women with GTD should be aware of this limitation. Further work is needed to ensure an appropriate, quality-assured laboratory service is available for hCG monitoring in women with GTD., (© 2023 The Author(s). Published by S. Karger AG, Basel.)