Search

Explains the mechanism of intragenic recombination. Examination of marker effects in fission yeast and in Ascobulus where two alleles were virtually at the same site of the sample under tetrad analyses; Theory on the distortion of the maps of genetic fine structure of a specific marker; Repair of heteroduplexes and the general marker effects.

This review is addressed to the biochemical events that underlie the early phases of the meiotic cycle. Late activities such as chromosomes disjunction and special processes involved in gametogenesis are excluded from this article. Of primary concern are the prophase stages of meiosis during which homologous chromosomes pair and presumably undergo crossing-over. These two events are fundamental to genetic recombination and constitute a major and universal feature of meiosis. In reviewing the field from the standpoint of biochemical mechanisms we have one general concern which is best to state at the outset. The sources of evidence on biochemical activities during meiosis are few. Biochemical analyses of meiosis in yeast are just beginning and will not be reviewed here. The bulk of our information comes from analyses of liliaceous plants, but their study has been pursued in very few laboratories. The credibility of the conclusions drawn from biochemical studies depends to a large extent upon the degree to which they are consistent with the information provided by genetics and cytology. Genetic approaches to intragenic recombination in yeast were surveyed two years ago. The cytology and fine structure of meiotic cells from various sources have been fully reviewed in the previous volume and genetic aspects of meiosis will be discussed in the succeeding one. No incontrovertible evidence yet exists for the occurrence of crossing-over during the pachytene stage and no demonstration is yet available that zygotene synapsis is an essential condition for crossing-over. The controversies surrounding the relationship of synapsis to crossing-over and/or disjunction are rather lively and have been competently presented elsewhere. No attempt will be made in this review directly to challenge the substance of these controversies. Instead, the reader will be put in company with appreciable circumstantial evidence which supports the simple tie between synapsies and crossing-over. In writing this artile, we have favored the view that crossing-over between homologous chromosomes follows and is dependent upon chromosome synapsis. The data presented may indeed have considerable bearing on the correctness of the underlying proposition. [ABSTRACT FROM AUTHOR]

Presents a review of literature describing studies on the biochemical aspects of Drosophila, compiled as of January 1967. Nutrition; Composition; Metabolism; Nucleic acids; Chromosome functions; Enzymes; Tissue culture; Phenocopies.

The specificity of yeast hexokinase for ATP was examined with the aid of a number of synthetic and natural analogs. The main features observed are: 1. The presence of a 2-amino group either alone or in combination with a 6-amino or 6-hydroxyl group inhibits catalysis. 2. The replacement of one or both hydrogen atoms of the 6-amino group with methyl groups does not have a large effect on either binding or catalysis. 3. The replacement of the nitrogen at position 7 with a carbon atom has virtually no effect. 4. The movement of the glycosidic bond from the N9 to the N³ position has only a moderate effect on both Km and V. 5. The presence of both of the 2'- and 3'-cis hydroxyls in the ribose is important for catalysis. 6. The replacement of ribose with arabinose or glucose produces a large decrease in catalysis. experiments were carried out with the ATP analog containing glucose instead of ribose. It was found to be competitive for ATP and uncompetitive for glucose under the conditions used. These results are consistent with an ordered reaction mechanism. [ABSTRACT FROM AUTHOR]

1. The enzyme composition of human pancreatic juice has been studied by immunological techniques, using non-activated and activated juice. 2. Antisera were prepared with activated and non-activated pancreatic juice. Same samples of antisera were adsorbed with human serum. Immunoelectrophoresis was carried out, at pH 8.6 and disc immunoelectrophoresis at pH 8.9 and 5.0. Gel-diffusion media contained benzamidine, to prevent zymogen activation. Precipitation lines were characterized by activating the zymogens on the plates with trypsin, and identifying the enzymes produced using specific synthetic substrates. 3. Immunoelectrophoresis showed 15-20 antigenic constituents. Although disc immunoelectrophoresis gave slightly different results, those were consistent with the results of immunoelectrophoresis. 4. The following active enzymes were identified and localized: α-amylase, lipase and carboxylester hydrolase, which is a lipolytic enzyme structurally and catalytically different from lipase. 5. Several zymogens were identified: two immunologically distinct trypsinogens, one procarboxypeptidase B, two forms of procarboxypeptidase A, which are immunologically identical, and two proelastases with some common antigenic determinants. After activation, both proelastases showed a weak but different degree of chymotryptic activity. Chymotrypsinogen was localized in two major anionic lines, and one, minor, cationic line. The possibility that one anionic immune precipitate represents a polymer is discussed. No chymotryptic activity was associated with procarboxypeptidase A. 6. Immunoelectrophoresis of activated pancreatic juice demonstrates electrophoretic and antigenic changes. Activation of one anionic trypsinogen gave rise to cationic trypsin, whereas after activation chymotrypsinogens and procarboxypeptidases A showed no important change. [ABSTRACT FROM AUTHOR]

Cytoplasmic messenger-like RNA not associated with ribosomes has been investigated in immature duck erythrocytes and compared with polyribosome-bound messenger RNA. It is shown that 9-S RNA of the same electrophoretic mobility as the polyribosomal 9-S globin messenger is present free in the cytoplasm. Its rate of synthesis and decay is consistent with a role as a precursor of polyribosomal 9-S globin messenger. mRNA species different from 9-S RNA, among them a predominant 12-S species, are found associated with polyribosomes as well as in the free cytoplasmic pool. The free cytoplasmic mlRNA pool is more heterogeneous compared to the polyribosomal mRNAs, suggesting a translational control qualitativeiy and quantitatively selecting among the free cytoplasmic mlRNAs for those to be translated. [ABSTRACT FROM AUTHOR]

The binding of reduced cofactor (NADH) to glutamate dehydrogenase has been studied by gel filtration, equilibrimn dialysis and fluorescence enhancement. The number of binding sites significantly exceeds 1 per polypeptide chain (1.3 per chain of molecular weight 56 000), the saturation curve gives indications of slight positive interactions. The presence of GTP, glutamate and ADP, apart from increasing the affinity of NADH for glutamate dehydrogenase, appears to affect both the number of binding sites and the cooperativity of the binding. [ABSTRACT FROM AUTHOR]

Ion-exchange chromatography of the total cytochrome c extracted from a wild-type laboratory strain of Saccharomyces cerevisiae shows the presence of two minor cytochrome c peaks, besides the already known iso-1 and iso-2 cytochromes c. Their amino acid composition is very similar to that of iso-1, but one of them lacks the ε-N-trimethylated lysine residue characteristic of yeast cytochromes c, thus excluding, at least for this peak, an artifactual origin. [ABSTRACT FROM AUTHOR]

The lysosomal acid α-glucosidase has been purified more than 10000-fold from rat and mice liver and from human placenta. The kinetic properties of the human enzyme are similar to those previously described for the rodent enzyme, with the main exception of the absence of inhibition by an excess of maltose. Antibodies were obtained by injection of the pure rat liver, mouse liver or human placental α-glucosidase to rabbits. The property of the enzyme of hydrolysing glycogen or to catalyse transglucosylation from maltose to glycogen could be nearly completely inhibited by the antibodies whereas the hydrolysis of small molecular substrates was much less inhibited. Within the same species, the same amount of enzyme was inhibited by a given amount of antibodies, whatever the tissue used as a source of enzyme. A partial cross-reactivity was observed from species to species. The presence of an immunologically reacting protein in tissues from patients with type-II-glycogenosis could not be demonstrated either by double-diffusion test or by antibodies consumption. Similar negative results were also obtained with normal human liver in which acid α-glucosidase has been inactivated at alkaline pH. [ABSTRACT FROM AUTHOR]

It has been found that purified phenylalanyl- and valyl-tRNA synthetases from yeast catalyse the mischarging of numerous heterologous Escherichia coli and even of homologous yeast tRNAs when special aminoacylation conditions are used. For instance E. coli tRNAAla, tRNAVal, tRNALys and yeast tRNAAla, tRNAVal can be incorrectly aminoacylated by yeast phenylalanyl-tRNA synthetase, whereas E. coli tRNAAla, tRNAMet, tRNAIle, tRNAThr and yeast tRNAAla, tRNAPhe can be mischarged by yeast valyl-tRNA synthetase. The production of errors is highly dependant on the experimental conditions used, as their number and their level is increased when the Mg2+/ATP ratio or the enzyme concentration in the medium is increased or when the reactions are performed in the presence of dimethylsulfoxide. In the ease of phenylalanyl-tRNA synthetase, conditions can be found where practically all E. coli tRNAs are wrongly aminoacylated, although at different levels. On the other hand, in the case of homologous systems some errors can only be detected when purified tRNAs are used, thus suggesting, when total tRNA is used, a competition between the cognate and non-cognate tRNAs which minimises the mischarging. The comparison of the sequences of the cognate and non cognate tRNAs which are aminoacylated either by the yeast phenylalanyl- or valyl-tRNA synthetase led us to ascribe some importance to several regions inside of these tRNAs, for instance (a) the dihydrouracil arm, (b) the terminal part of the amino-acid acceptor stem and (c) the extra-loop. These regions should be essentially necessary for the establishment of the correct tri-dimensional conformation necessary for the recognition by the aminoacyl-tRNA synthetases. [ABSTRACT FROM AUTHOR]

The study undertaken shows the existence of water-soluble complexes of sterols, sterol esters and their precursors (triterpenes and 4α-methylsterols) in a higher plant, Zea mays L. The leaves, roots and culture medium were treated separately in order to investigate the role and nature of these complexes. The sterols found in the water-soluble form represent 0.1-1% by weight of the total sterols in the plant. The composition of the hydrosoluble fraction of the sterols and their precursors is different from that of the lipid-soluble fraction, cholesterol, sitosterol and isofucosterol being preferentially complexed compared to campesterol and stigmasterol. This complex was found in the microsomal supernatant after homogenisation and also in the culture medium. The sterols are released from the complex by a treatment with pyrogallol under basic conditions or after repeated extraction with petroleum ether. The complex is precipitated with ethanol but not with trichloroacetic acid. The behaviour of several sterols on treatment with a solution of starch was investigated. Starch was able to complex with a large number of phytosterols unspecifically. The implication of this complex for the transport of sterols, for the biosynthesis of steroids and the ecological impact is discussed. [ABSTRACT FROM AUTHOR]

Rat liver polysomes, single ribosomes, EDTA-produced subparticles and free ribosomal RNA were treated with formaldehyde and their properties were studied. The following results were obtained. 1. RNA can be isolated from fixed polysomes or subparticles by exhaustive digestion with pronase. Such RNA shows a normal electrophoretic behaviour in agar gel. 2. In free RNA treated with formaldehyde the mobility of 18-S and 28-S RNA fractions is reduced; latent breaks are not revealed by heating; sensitivity towards ribonuclease is increased. No such effects are observed with RNA treated with formaldehyde while in the particles. 3. In fixed polysomes or single ribosomes the two subparticles appear to be covalently bound through their proteins. No intermolecular bonding occurs between 18-S and 28-S RNA either fixed polysomes or in free RNA. The fixed ribosomes and subparticles can be fractionated by agar gel electrophoresis and give profiles similar to those of untreated particles. These resets may prove useful in combining CsCl density gradient fractionation with gel electrophoretic methods. [ABSTRACT FROM AUTHOR]

1. Cytoplasmic aspartate aminotransferase from pig heart catalyses β-elimination of L-serine-o-sulphate and β-chloro-L-alanine. The rates of these reactions have been compared with the rates of the same reactions catalysed by free pyridoxal 5'-phosphate and CuCl2. 2. The effect of formate on the two enzyme-catalysed reactions has been studied and it has been shown that this anion competitively inhibits the serine sulphate reaction and activates the chloroalanine reaction by increasing kcat considerably. 3. The β-elimination of both these compounds is accompanied by progressive inactivation of the enzyme but whereas formate decreases the rate of inactivation by serine sulphate it increases the rate of inactivation by chloroalanine, 4. It is proposed that formate binds to the active site of the enzyme in a position normally occupied by the β-carboxyl group of aspartate, the carboxyl group of glutamate or the sulphate group of serine sulphate and that binding of the appropriate anion induces a change in the active site which accounts simultaneously for increased catalytic activity and increased inactivation. [ABSTRACT FROM AUTHOR]

1. Three pure species of bacterial tRNA have been crystallized by several different methods for X-ray diffraction studies. 2. Extensive studies of tRNAfMet produced many crystal forms, seven of which are noted here. Crystallization conditions for both tRNATyr and tRNAPhe have been systematically investigated for a limited number of solvents. Several forms of tRNATyr can be produced in a controlled fashion. 3. The most favourable unit cells are P4122, a = 7.1 nm, c = 17.4 nm for tRNATyr and P3112, a - 9.3 nm, c = 7.8 nm, for tRNAPhe. Initial X-ray still photographs of tRNATyr and tRNAPhe show some reflections out to 0.4 nm but precession photographs show a rapid fall off in intensity beyond 0.7 nm. [ABSTRACT FROM AUTHOR]

A method is described for the preparation of DNA polymerase purified about 800-fold from rat liver nuclei. The yield of enzyme is about 140-200 µg from 200 g liver. Sodium dodecylsulphate-polyacrylamide gel electrophoresis of the enzyme in the final step, shows a main band corresponding to a polypeptide of molecular weight of 29 000 ± 3%. Sephadex G-100 column chromatography indicates the enzyme to have an apparent molecular weight of approximately 60 000 ± 2% at an ionic strength of 0.15, suggesting that the enzyme is a dimer as isolated. In 2 M NaCl, the apparent molecular weight is 42 000. The enzyme prefers double-stranded DNA templates but utilises most efficiently those activated by deoxyribonuclease I. It has the ability to carry out limited synthesis using only one deoxynucleoside-5'-triphosphate in the assay. The final preparation of DNA polymerase has nucleoside diphosphate kinase associated with it. [ABSTRACT FROM AUTHOR]

With the help of an automatic protein sequenator, we have verified a prediction made by us in a recent paper, namely that residue 16 in Candida krusei cytochrome c is a glutamine and not a glutamic acid. Neurospora crassa cytochrome c now remains the only mitochondrial cytochrome c which apparently does not have a glutamine at this position. In the course of this investigation, from two strains of Candida krusei we isolated two cytochromes which differ in amino acid composition. One of them seems to correspond to that described in the literature. Two of the differences have been located. [ABSTRACT FROM AUTHOR]

A method is presented to measure the alkylation of phosphates in DNA after a treatment with an alkylating agent. Using this method, we have shown that phosphate alkylation represents 15% of total alkylation when DNA is alkylated with ethyl methanesulfonate and only 1% of total alkylation when DNA is alkylated with methyl methanesulfonate. Experiments are also presented which show that phosphate triesters resulting from the alkylation of DNA by ethyl methanesulfonate are very stable, most of them remaining intact after heating at 100 °C for 90 min at pH 7.0. [ABSTRACT FROM AUTHOR]

The binding of saccharide inhibitors to lysozyme has been studied using a microcalorimetric method. Measurements have been performed with N-acetyl-D-glucosamine (pH 5 and 25 and 40 °C), tri[N-acetyl-D-glucosamine] (pH 2, 5 and 7.6 at 25 °C and pH 5 at 40 °C) and with tetra[N-acetyl-D-glucosamine] (pH 2, 5 and 7.6 at 25 °C). From the results of the calorimetric measurements values for ΔG0, ΔH0, ΔS0 and ΔCp0 were derived for the binding processes. In addition to the saccharide-binding reactions, some model experiments were performed. [ABSTRACT FROM AUTHOR]

1. The action of insulin on [14C]glucosamine uptake and metabolism is analyzed in the isolated rat diaphragm. Various metabolites accumulating in the course of incubation are extracted, characterized and estimated by chromatographic, electrophoretic and colorimetric procedures. 2. Insulin greatly stimulates (up to three-fold) the uptake and time-dependent accumulation of metabolites derived from glucosamine. It is demonstrated that glycogen accounts but for a small part (less than 20%) of the accumulated material; the major part consists of glucosamine 6-phosphate, the level of which is increased up to six times by insulin in the cell. Hence the hormone affects glucosamine metabolism already at the level of its first steps: transport and phosphorylation. 3. The use of D-glucose and 3-O-methyl-D-glucose as competitive inhibitors of glucosamine metabolism shows that the mechanisms by which all three substrates are transported and by which two of them (glucose and glucosamine) are phosphorylated are essentially identical, both in the absence and in the presence of insulin. 4. The action of phlorizin as an inhibitor of sugar transport confirms this interpretation. 5. The results obtained are consistent with the hypothesis of an insulin-stimulated, facilitated diffusion step of glucosamine and of a bottle-neck reaction, which limits the deamination of glucosamine 6-phosphate and leads to its accumulation in the tissue. [ABSTRACT FROM AUTHOR]

1. The regulation of the pathway responsible for L-lysine degradation in Pseudomonas putida has been studied. It has been shown that L-lysine is the actual inducer of the two first enzymes of the pathway, lysine oxygenase and 5-aminovaleramidase. 2. No important repression of lysine oxygenase by various carbon sources and by intermediates of the lysine degradation pathway has been found. 3. Activation of lysine oxygenase by its substrate, lysine, has been observed. A physiological function for this phenomenom is proposed. 4. Sodium and potassium ions are activators whereas magnesium ion, phosphate and phosphorylated compounds are inhibitors of lysine oxygenase. Citrate also is inhibitory. [ABSTRACT FROM AUTHOR]

We have isolated a form of Qβ replicase lacking subunit α and shown that it is deficient in the utilization of Qβ-plus strand RNA as template but competent to utilize Qβ-minus strands, poly(C) and "6-S" RNA. The functional identity of subunit α and protein-synthesis-inhibition factor i was proven by their equivalent capacity to restore full Qβ RNA-directed activity of α-less replicase. [ABSTRACT FROM AUTHOR]

Gonads of the male Holothuria tubulosa contain two families of lysine-rich histones. One of these families resembles the lysine-rich histones found in somatic tissues of higher organisms (e.g. calf and rabbit). The other family, which may be restricted to the male gonad, is recognizably related to the first family and yet is quite distinct. About 35% of the tryptic peptides differ between these families. These findings support the notion that a broad spectrum of structural variation may exist in lysine-rich histones, perhaps even merging into structures of the slightly lysine-rich class. [ABSTRACT FROM AUTHOR]

The specific activities expressed as µmol×g wet wt-1min-1 of D-triokinase and NADlinked glycerol dehydrogenase, with D-glyceraldehyde as substrate, were determined in the 27 500 × g supernatant fraction of livers from rats subjected to various dietary and hormonal programs. The specific activity of triokinase varied over a three-fold to four-fold range, being lowest in livers of diabetic rats fed a Purina Chow arid highest in livers of intact rats fed 72% fructose diets containing casein; total triokinase activity per liver was five-fold to six-fold greater in the latter group than in the former group. The specific activity of triokinase also increased in livers of rats fed diets of 72% glucose or 72% dextrin plus 18% casein. Fructose feeding caused a decrease in specific activity of glycerol dehydrogenase. Glucagon had no effect on the specific activity of either enzyme in livers of fasted rats. Cortisone tended to increase the specific activity of triokinase as well as its total activity in livers of rats fed the Purina Chow. After only 48 h of a 72% fructose-18% casein diet, liver weight was increased 50% relative to livers of rats fed the Purina Chow. Triokinase is subject to regulation in livers of adult male rats. The data indicate that the NAD-linked glycerol dehydrogenase is also subject to regulation but to a lesser extent. If glucagon does stimulate the flux of carbon in the triokinase or the NAD-linked glycerol dehydrogenase reactions, it is not as the result of increases iii enzyme concentrations as determined by assayable activity measurements. [ABSTRACT FROM AUTHOR]

A procedure for preparation of native globin from Ohironomus hemoglobin has been developed and functional properties of native and reconstituted (proton, meso- and deutero-) hemoglobins have been studied. Globin differs from the corresponding hemoglobin in a number of properties, but the differences are reversible and vanish on addition of protoheme. The oxygen affinity of protohemoglobin (p½ = 0.7 mm Hg at 20 °C) is lower than that of meso- and deutero-hemoglobins, respectively, the shape of oxygenation curve of all three hemoproteins being consistent with a simple mass-law formulation. While protohemoglobin shows a small but definite Bohr effect, the oxygen affinity of the deuteroderivative is pH independent. Kinetic results show that binding of oxygen, carbon monoxide and ethylisocyanide to native and reconstituted Chironomus hemoglobins is a simple process, since the association process follows bimolecular behaviour and the dissociation reaction conforms to first-order kinetics. [ABSTRACT FROM AUTHOR]

The effects of parathyroid hormone, adenosine 3':5'-monophosphate (Ado-3':5'-P) and oleate on renal metabolism have been studied in isolated kidney-cortex tubules from starved rats. Substrate uptake and glucose formation have been determined with L-lactate, pyruvate, glutamate, and glycerol as substrates. The results indicate that parathyroid hormone and Ado-3':5'-P increase renal gluconeogenesis by the same mechanism, which however, differs from the effects brough about by free fatty acids: 1. Parathyroid hormone and Ado-3':5'-P increased glucose formation from L-lactate, pyruvate and glutamate. The stimulatory effect of parathyroid hormone was always smaller compared with that of Ado-3':5'-P. Glucose formation from L-lactate was shown to be stimulated with hormone doses as low as 1-10 nM. 01cate had an increasing effect on glucose formation from L-lactate and glycerol but no effect on glucose formation from 10 mM pyruvate and inhibited gluconeogenesis from glutamate. 2. The stimulatory action of parathyroid hormone and Ado-3':5'-P was accompanied by an increase in substrate uptake, whereas oleate decreased substrate uptake. 3. The effects of parathyroid hormone and Ado-3':5'-P on kidney-tubule metabolism were not additive, when both substances were added together. 4. All effects of oleate were found to be unchanged in the presence of parathyroid hormone and Ado-3':5'-P or both. The results suggest two different mechanisms which may regulate renal gluconeogenesis additively. [ABSTRACT FROM AUTHOR]

Mouse reticulocyte messenger (9-S) RNA has been prepared by treatment of polysomes with sodium dodecylsulphate. On 6% polyacrylamide gels, two sharp and one more diffuse component can be resolved in the 9-S region, Messenger RNA prepared from 14-S mRNA. protein from EDTA-treated polysomes contains only the diffuse component. This component has priming activity for both α- and β-globin chains, and evidence is presented that it can be partially resolved into separate messengers for each chain. The two sharp components, which migrate more slowly than the globin mRNA, are associated with the 30-S ribosomal subunit after EDTA treatment, have no translational activity in a duck reticulocyte cell-free protein-synthesis system, and (unlike the diffuse component) are not destroyed by gentle sonication of polysomes to monosomes. The non-coding components comprise approximately one-third of the RNA in the 9-S region of most RNA preparations from mouse reticulocytes. The diffuse (coding) 9-S component from 14-S mRNA · protein runs as a sharp symmetrical peak in formamide-acrylamide gel electrophoresis, suggesting that there may be variation in secondary structure in aqueous solution rather than in molecular weight. [ABSTRACT FROM AUTHOR]

Guanylyl-3'-5'-uridine (GpU) and seventeen GpU analogues modified mostly on the uridine moiety have been investigated by circular dichroism (CD). The following conclusions can be drawn from this investigation. 1. At room temperature and neutral pH GpU is very little, if at all stacked. A perpendicular structure with guanosine in syn and uridine with ψCN ≈ +75° ± 15 °C stabilized by a hydrogen bond between the amino group of guanosine and the C-4 keto group of uridine is proposed. In this structure C-5 and C-6 would be hidden by the guanosine base. 2. At low temperature or low pH stacking occurs. The structure is possibly the same under these conditions and may involve guanosine in syn and uridine in anti. 3. Substitution at C-5 of uridine inhibits the formation of the neutral perpendicular structure. Seven C-5 substituted GpU analogues all show CD spectra close to those of GpU at low temperature or low pH. 4. Substitution on C-6 of uridine destabilizes the formation of all these structures. [ABSTRACT FROM AUTHOR]

The theory of alternative substrates has been thoroughly investigated. The reciprocal rate equations, for ordered and random kinetic mechanisms, in the presence of an alternative substrafe, have been developed. The conditions in which those equations give rise to either hyperbolic or linear reciprocal plots have been established. Degeneracy and constraint conditions of the various kinetic models have also been derived. Definite conclusions concerning the relevant mechanism can be obtained only if the Dalziel coefficients pertaining to the substrate are different from those corresponding to the alternative substrate. It follows from this, that the method termed "isotope competition", cannot be used to make a choice among various two-substrate mechanisms, and appears to be unfounded. The theory of alternative substrates has been applied to the study of yeast hexokinase. The results obtained are at variance with a random mechanism. They do agree, on the other hand, with a compulsory order of substrate binding on the enzyme, glucose being bound first. [ABSTRACT FROM AUTHOR]

The ionic strength, concentration, and temperature effects on the association-dissociation properties of lysozyme in aqueous solution have been studied by gel chromatography. The following results were obtained: 1. Increasing ionic strength leads to an increase m inter-conversion rate between the monomeric and associated forms. Between distilled water and 0.01 ionic strength, lysozyme shows a low velocity of interconversion, whereas between 0.01 and 0.2 rates are observed which are rapid as compared with the column fractionation time. 2. Analysis of concentration dependence indicates the formation of more highly associated forms than the darner. The data can be fitted within experimental error by an indefinite association with the same equilibrium constant for the addition of each successive monomer. 3. The equilibrium ratio for the slow polymerization process measured at temperatures between 15 ° and 40 °C yields the apparent thermodynamic quantities, ΔG°, ΔH0, and ΔS0 for the association reaction. This data is consistent with a hydrophobic interaction between lysozyme monomers and Sephadex gel matrix. It is suggested that the adsorption involves the tryptophan residues of the active centre. The enthalpy of the polymerization process is interpreted in terms of a conformational change of the same order of magnitude as on the bonding of N-acetylglucosamine to the enzyme. [ABSTRACT FROM AUTHOR]

The protein per cell decreases during a 96-hour growth of Chang's and HeLa cells cultivated in suspension. This decrease is very high for the cytoplasmic proteins, while the nuclear proteins appear to be more stable. The content of cell proteins is reestablished during a phase of intensive enrichment which occurs during the first 30-60 min of the newly inoculated culture. The rate of protein labeling in this phase appears to be greater in the nuclei than in the cytoplasm. Both the level of rapid accumulation and the decrease of the protein content with time appear to be a function of cell density. The rapid protein accumulation occurs when this density in the culture is lowest. With time and increase of the cell density in the culture the protein content per cell goes down. In non-synchronized cells this decrease is steady. In "naturally" synchronized cell it shows itself in an oscillatory fashion. The artificial thymidine synchronization of HeLa suggests that the fluctuating protein production in the "naturally" synchronized cultures of these cells is linked with the periodical doubling of the cell number during the growth cycle which includes, for HeLa, at least three cell cycles. [ABSTRACT FROM AUTHOR]

Lipase from different tissues was extracted in potassium phosphate buffer containing sodium deoxycholate and purified by column chromatography on Sephadex and Sepharose gels. A 500fold purification was achieved by this procedure. This purified enzyme has an estimated molecular weight greater than 3 × 106, and it runs as a single protein band in polyacrylamide preparative disc gel electrophoresis. After acetone — ether treatment of the etude rat pancreactic lipase extract. the resulting enzyme has an estimated molecular weight less than 3 × 104, similar to those reported in the literature. The purified enzyme catalyzes the hydrolysis of long and short chain fatty acid glycerol esters. Phenoxybenzamine and phentolamine were found to inhibit the hydrolysis of the long chain fatty acid glycerol esters by the high molecular weight lipase, while that by the low molecular weight lipase was not inhibited. When administered to rats in vivo, phenoxybenzaamine and phentolamine inhibited the hydrolysis of tripalmitin by the epididymal fat lipase: but the pancreatic or intestinal lipase activity was not affected. [ABSTRACT FROM AUTHOR]

The species of methionine tRNA which places methionine into internal positions of growing polypeptide chains, methionine tRNAM, was purified from Escherichia coli strain CA265 labelled with 32>P by column chromatography on DEAE-Sephadex and benzolylated DEAE-cellulose. Sequence analysis of the products of complete and partial digestion of tRNAM by ribonucleic T1 and by pancreatic ribonuclease permitted the derivation of the total primary structure of this molecule. The sequence of methionine tRNAM is PGGCUACGU*AGCUCAGUD2'OMeGGDDAGAGCACAUCAACUCAUA*AΨGAUGGG7MeGXCACAGGtΨCGAAAUCCCGUCGUACCACCAOH, where U* is probable 4-thio-uridine, and C, A* X are unknown nucleotides. [ABSTRACT FROM AUTHOR]

1. Porcine proelastase was purified from frozen pancreases by extraction at pH 4.5, precipitation with (NH4)2SO4, isolation of the pH 5.7 insoluble euglobulin fraction, selective (pH dependent) adsorption on elastin and chromatography on CM-cellulose at pH 4.5. The active fraction was dialyzed and freeze dried. All the steps of purification except the last one were performed in presence of trypsin and chymotrypsin inhibitor AA from soybeans. All the process was done at 4°.2. The proelastase thus obtained was found to be pure by acrylamide gel electrophoresis and ultracentrifugation. The extinction coefficient of the freeze-dried material, E1 cm1% at 280 nm was 17.0. The pure preparation was free of α-N-benzoyl-L-benzoyl-L-arginine [ABSTRACT FROM AUTHOR]

A new method is proposed to measure relatedness amongst bacteria, based on renaturation rate deteminants of DNA types and their mixture. The equations, relating the degree of binding with renaturation rates, are calculated for several cases. The optimal conditions for measurements are given. The method was checked in several ways. The advantages are summarized. [ABSTRACT FROM AUTHOR]

An X-ray diffraction study has been performed by the powder technique on two crystalline forms of yeast cytochrome b2. Type II (DNA-free) cytochrome b2 crystallizes in the trigonal system, the parameters of the unit cell being a = 168.2 Å and c = 112.0 Å, whereas type I (DNA-containing) cytochrome b2 crystallizes in the tetragonal system with a = 99.1 Å and c = 87.0 Å. Measurement of the crystal density and of the partial specific volume of the protein (found to be 0.754 cm³ g at 25°) enables a precise determination of the molecular weight of cytochrome b2 to be obtained. In this respect, the values 234 6000 - 8000 and 235000 - 10000 were found for type II and type I crystals respectively. These results, although in complete concordance, are quite different from the previously accepted value (approx. 180000 from sedimentation studies based on v = 0.71 cm³ /g). Space-groups and protein contents of the crystals show that this protein is composed of at least two, or even four, identical protomers. [ABSTRACT FROM AUTHOR]

A new method is described for the determination of the total molecular weight of haploid genome DNA. It is based on initial optical renaturation rate measurements of precisely known concentrations of fragmented DNA. The theoretical basis of the measurement is presented. The actual state of replication of the genome has little effect. The exact conditions and the effects of DNA concentration, renaturation time, size of DNA fragments, buffer concentration, optimal temperature and % (G + C) have been determined. Several types of bacterial DNA of known genome size were included as a control. As an application, the DNA genome size have been determined of 40 different bacteria. The method appears to offer advantages by its simplicity, rapidity and reproducibility. [ABSTRACT FROM AUTHOR]

1. A new determination of the extinction coefficient of the Soret band of reduced cytochrome b2 provides a value of 183 mM-1cm-1 instead of the generally accepted figure of 232. Four methods were used: pyridine hemochromogen, dicyanide complex, spectrum in formic acid and iron titration. No significant differences are observed in the heme spectral properties of cytochrome b2 and its low molecular weight derivative "cytochrome b2 core". 2. Dry weight associated with iron and heme content determinations lead to a minimal molecular weight per heme of 58 600. This result combined with hydrodynamic and crystallographic studies by other authors allows one to propose a tetrameric structure for cytochrome b2. [ABSTRACT FROM AUTHOR]

Amino acid analyses of L-lactate dehydrogenase from baker's show that the minimum molecular weight (53 000 daltons) of the protein is much lower than found in the literature (80 000). This result, combined with those reported in the following papers, leads to a revision of the dimeric model generally accepted for cytochrome b2 [ABSTRACT FROM AUTHOR]

The Commission on the Nomenclature of Biological Chemistry decided in 1958 that an attempt should be made to standardize the abbreviations and symbols used for chemical names of special interest in biological chemistry. The original draft proposals were based on the notes given at the beginning of each number of the Journal of Biological Chemistry. The problems were discussed fully at the meeting of the commission in Munich in September 1959--and also in joint sessions with the Organic Nomenclature Commission and the Enzyme Commission of the International Union of Biochemistry. A third draft, incorporating the results of the Munich discussions, was widely circulated in December 1959, and many useful comments on this were received.