Search

Over 900 event-based precipitation samples were collected in 2019–2021 in the Tien Shan and its foothills and analysed using cavity ring-down spectroscopy. δD and δ18O values were highest in summer and lowest in winter, and annual cycles of deuterium excess (d-excess) varied between sites, reflecting local conditions. The δ18O and δD values increased from north to south in all seasons except autumn, and latitude was a statistically significant predictor of δ18O and δD in the overall data set, along with elevation in winter and elevation and longitude in autumn. Elevation was a significant predictor of d-excess in all seasons, and local air temperature was a more important control over δ18O and δD than precipitation depth. Local meteoric water lines were derived using seven regression methods applied to non-weighted and weighted precipitation. Non-weighted ordinary least squares regression and reduced major axis regression methods are recommended overall, except for summer when the precipitation-weighted least squares regression should be used, particularly in the south. Atmospheric back-trajectory and mixing-model analyses were applied in combination to identify air mass source regions and their relative contribution to precipitation. Recycled moisture from irrigated land in the Amu Darya and Syr Darya basins and from the study catchments accounted for 29 %–71 % of precipitation, depending on the site and season. In the Chon Kyzyl-Suu catchment, local re-evaporation from Issyk-Kul accounted for up to 85 % of precipitation. These findings highlight the importance of moisture from terrestrial sources, especially irrigated land, for the formation of precipitation in the Tien Shan.

Wildfires and agricultural burning generate seemingly increasing smoke aerosol emissions, impacting societal and natural ecosystems. To understand smoke's effects on climate and public health, we analyzed the spatiotemporal distribution of smoke aerosols, focusing on two major light-absorbing components, namely black carbon (BC) and brown carbon (BrC) aerosols. Using NASA's Earth Polychromatic Imaging Camera (EPIC) instrument aboard NOAA's Deep Space Climate Observatory (DSCOVR) spacecraft, we inferred BC and BrC volume fractions and particle mass concentrations based on spectral absorption provided by the Multi-Angle Implementation of Atmospheric Correction (MAIAC) algorithm with 1–2 h temporal resolution and ∼ 10 km spatial resolution over North America and central Africa. Our analyses of regional smoke properties reveal distinct characteristics for aerosol optical depth (AOD) at 443 nm, spectral single-scattering albedo (SSA), aerosol layer height (ALH), and BC and BrC amounts. Smoke aerosols in North America showed extremely high AOD up to 6, with elevated ALH (6–7 km) and significant BrC components up to 250 mg m−2 along the transport paths, whereas the smoke aerosols in central Africa exhibited stronger light absorption (i.e., lower SSA) and lower AOD, resulting in higher-BC mass concentrations and similar BrC mass concentrations than the cases in North America. Seasonal burning source locations in central Africa, following the seasonal shift in the Intertropical Convergence Zone and diurnal variations in smoke amounts, were also captured. A comparison of retrieved AOD443, SSA443, SSA680, and ALH with collocated AERONET and CALIOP measurements shows agreement with RMSE values of 0.2, 0.03–0.04, 0.02–0.04, and 0.8–1.3 km, respectively. An analysis of the spatiotemporal average reveals distinct geographical characteristics in smoke properties closely linked to burning types and meteorological conditions. Forest wildfires over western North America generated smoke with a small-BC volume fraction of 0.011 and a high ALH with large variability (2.2 ± 1.2 km), whereas smoke from wildfires and agricultural burning over Mexico region shows more absorption and low ALH. Smoke from savanna fires over central Africa had the most absorption, with a high-BC volume fraction (0.015) and low ALH with a small variation (1.8 ± 0.6 km) among the analyzed regions. Tropical forest smoke was less absorbing and had a high variance in ALH. We also quantify the estimation uncertainties related to the assumptions of BC and BrC refractive indices. The MAIAC EPIC smoke properties with BC and BrC volume and mass fractions and assessment of the layer height provide observational constraints for radiative forcing modeling and air quality and health studies.

Cloud condensation nuclei (CCN) are mediators of aerosol–cloud interactions (ACIs), contributing to the largest uncertainties in the understandings of global climate change. We present a novel remote-sensing-based algorithm that quantifies the vertically resolved CCN number concentrations (NCCN) using aerosol optical properties measured by a multiwavelength lidar. The algorithm considers five distinct aerosol subtypes with bimodal size distributions. The inversion used the lookup tables developed in this study, based on the observations from the Aerosol Robotic Network, to efficiently retrieve optimal particle size distributions from lidar measurements. The method derives dry aerosol optical properties by implementing hygroscopic enhancement factors in lidar measurements. The retrieved optically equivalent particle size distributions and aerosol-type-dependent particle composition are utilized to calculate critical diameters using κ-Köhler theory and NCCN at six supersaturations ranging from 0.07 % to 1.0 %. Sensitivity analyses indicate that uncertainties in extinction coefficients and relative humidity greatly influence the retrieval error in NCCN. The potential of this algorithm is further evaluated by retrieving NCCN using airborne lidar from the NASA ObseRvations of Aerosols above CLouds and their intEractionS (ORACLES) campaign and is validated against simultaneous measurements from the CCN counter. The independent validation with robust correlation demonstrates promising results. Furthermore, the NCCN has been retrieved for the first time using a proposed algorithm from spaceborne lidar – Cloud-Aerosol Lidar with Orthogonal Polarization (CALIOP) – measurements. The application of this new capability demonstrates the potential for constructing a 3D CCN climatology at a global scale, which helps to better quantify ACI effects and thus reduce the uncertainty in aerosol climate forcing.

The iron-oxide content of dust in the atmosphere and most notably its apportionment between hematite (α-Fe2O3) and goethite (α-FeOOH) are key determinants in quantifying dust's light absorption, its top of atmosphere ultraviolet (UV) radiances used for dust monitoring, and ultimately shortwave dust direct radiative effects (DREs). Hematite and goethite column mass concentrations and iron-oxide mass fractions of total dust mass concentration were retrieved from the Deep Space Climate Observatory (DSCOVR) Earth Polychromatic Imaging Camera (EPIC) measurements in the ultraviolet–visible (UV–Vis) channels. The retrievals were performed for dust-identified aerosol plumes over land using aerosol optical depth (AOD) and the spectral imaginary refractive index provided by the Multi-Angle Implementation of Atmospheric Correction (MAIAC) algorithm over six continental regions (North America, North Africa, West Asia, Central Asia, East Asia, and Australia). The dust particles are represented as an internal mixture of non-absorbing host and absorbing hematite and goethite. We use the Maxwell Garnett effective medium approximation with carefully selected complex refractive indices of hematite and goethite that produce mass fractions of iron-oxide species consistent with in situ values found in the literature to derive the hematite and goethite volumetric/mass concentrations from MAIAC EPIC products. We compared the retrieved hematite and goethite concentrations with in situ dust aerosol mineralogical content measurements, as well as with published data. Our data display variations within the published range of hematite, goethite, and iron-oxide mass fractions for pure-mineral-dust cases. A specific analysis is presented for 15 sites over the main dust-source regions. Sites in the central Sahara, Sahel, and Middle East exhibit a greater temporal variability of iron oxides relative to other sites. The Niger site (13.52∘ N, 2.63∘ E) is dominated by goethite over the Harmattan season with a median of ∼ 2 weight percentage (wt %) of iron oxide. The Saudi Arabia site (27.49∘ N, 41.98∘ E) over the Middle East also exhibited a surge of goethite content with the beginning of the shamal season. The Sahel dust is richer in iron oxide than Saharan and northern China dust except in summer. The Bodélé Depression area shows a distinctively lower iron-oxide concentration (∼ 1 wt %) throughout the year. Finally, we show that EPIC data allow the constraining of the hematite refractive index. Specifically, we select 5 out of 13 different hematite refractive indices that are widely variable in published laboratory studies by constraining the iron-oxide mass ratio to the known measured values. The provided climatology of hematite and goethite mass fractions across the main dust regions of Earth will be useful for dust shortwave DRE studies and climate modeling.

Since early 2000, NASA's Multi-angle Imaging SpectroRadiometer (MISR) instrument has been performing remote sensing retrievals of aerosol optical properties from the polar-orbiting Terra spacecraft. A noteworthy aspect of MISR observations over the ocean is that, for much of the Earth, some of the multi-angle views have contributions from solar reflection by the ocean surface (glint, or glitter), while others do not. Aerosol retrieval algorithms often discard these glint-influenced observations because they can overwhelm the signal and are difficult to predict without knowledge of the (wind-speed-driven) ocean surface roughness. However, theoretical studies have shown that multi-angle observations of a location at geometries with and without reflected sun glint can be a rich source of information, sufficient to support simultaneous retrieval of both the aerosol state and the wind speed at the ocean surface. We are in the early stages of creating such an algorithm. In this paper, we describe our assessment of the appropriate level of parameterization for simultaneous aerosol and ocean surface property retrievals using sun glint. For this purpose, we use generalized nonlinear retrieval analysis (GENRA), an information content assessment (ICA) technique employing Bayesian inference, and simulations from the Ahmad–Fraser iterative radiative transfer code. We find that four parameters are suitable: aerosol optical depth (τ), particle size distribution (expressed as the fine mode fraction f of small particles in a bimodal size distribution), surface wind speed (w), and relative humidity (r, to define the aerosol water content and complex refractive index). None of these parameters define ocean optical properties, as we found that the aerosol state could be retrieved with the nine MISR near-infrared views alone, where the ocean body is strongly absorbing in the open ocean. We also found that retrieval capability varies with observation geometry and that as τ increases so does the ability to determine aerosol intensive optical properties (r and f, while it decreases for w). Increases in w decrease the ability to determine the true value of that parameter but have minimal impact on retrieval of aerosol properties. We explored the benefit of excluding the two most extreme MISR view angles for which radiative transfer with the plane-parallel approximation is less certain, but we found no advantage in doing so. Finally, the impact of treating wind speed as a scalar parameter, rather than as a two-parameter directional wind, was tested. While the simpler scalar model does contribute to overall aerosol uncertainty, it is not sufficiently large to justify the addition of another dimension to parameter space. An algorithm designed upon these principles is in development. It will be used to perform an atmospheric correction with MISR for coincident ocean color (OC) observations by the Moderate Resolution Imaging Spectroradiometer (MODIS) instrument, also on the NASA Terra spacecraft. Unlike MISR, MODIS is a single-view-angle instrument, but it has a more complete set of spectral channels ideal for determination of optical ocean properties. The atmospheric correction of MODIS OC data can therefore benefit from MISR aerosol retrievals. Furthermore, higher-spatial-resolution data from coincident MISR observations may also improve glint screening.

The large uncertainty in the mineral dust direct radiative effect (DRE) hinders projections of future climate change due to anthropogenic activity. Resolving modeled dust mineral speciation allows for spatially and temporally varying refractive indices consistent with dust aerosol composition. Here, for the first time, we quantify the range in dust DRE at the top of the atmosphere (TOA) due to current uncertainties in the surface soil mineralogical content using a dust mineral-resolving climate model. We propagate observed uncertainties in soil mineral abundances from two soil mineralogy atlases along with the optical properties of each mineral into the DRE and compare the resultant range with other sources of uncertainty across six climate models. The shortwave DRE responds region-specifically to the dust burden depending on the mineral speciation and underlying shortwave surface albedo: positively when the regionally averaged annual surface albedo is larger than 0.28 and negatively otherwise. Among all minerals examined, the shortwave TOA DRE and single scattering albedo at the 0.44–0.63 µm band are most sensitive to the fractional contribution of iron oxides to the total dust composition. The global net (shortwave plus longwave) TOA DRE is estimated to be within −0.23 to +0.35 W m−2. Approximately 97 % of this range relates to uncertainty in the soil abundance of iron oxides. Representing iron oxide with solely hematite optical properties leads to an overestimation of shortwave DRE by +0.10 W m−2 at the TOA, as goethite is not as absorbing as hematite in the shortwave spectrum range. Our study highlights the importance of iron oxides to the shortwave DRE: they have a disproportionally large impact on climate considering their small atmospheric mineral mass fractional burden (∼2 %). An improved description of iron oxides, such as those planned in the Earth Surface Mineral Dust Source Investigation (EMIT), is thus essential for more accurate estimates of the dust DRE.

In the fall of 2017, an airborne field campaign was conducted from the NASA Armstrong Flight Research Center in Palmdale, California, to advance the remote sensing of aerosols and clouds with multi-angle polarimeters (MAP) and lidars. The Aerosol Characterization from Polarimeter and Lidar (ACEPOL) campaign was jointly sponsored by NASA and the Netherlands Institute for Space Research (SRON). Six instruments were deployed on the ER-2 high-altitude aircraft. Four were MAPs: the Airborne Hyper Angular Rainbow Polarimeter (AirHARP), the Airborne Multiangle SpectroPolarimetric Imager (AirMSPI), the Airborne Spectrometer for Planetary EXploration (SPEX airborne), and the Research Scanning Polarimeter (RSP). The remainder were lidars, including the Cloud Physics Lidar (CPL) and the High Spectral Resolution Lidar 2 (HSRL-2). The southern California base of ACEPOL enabled observation of a wide variety of scene types, including urban, desert, forest, coastal ocean, and agricultural areas, with clear, cloudy, polluted, and pristine atmospheric conditions. Flights were performed in coordination with satellite overpasses and ground-based observations, including the Ground-based Multiangle SpectroPolarimetric Imager (GroundMSPI), sun photometers, and a surface reflectance spectrometer. ACEPOL is a resource for remote sensing communities as they prepare for the next generation of spaceborne MAP and lidar missions. Data are appropriate for algorithm development and testing, instrument intercomparison, and investigations of active and passive instrument data fusion. They are freely available to the public. The DOI for the primary database is https://doi.org/10.5067/SUBORBITAL/ACEPOL2017/DATA001 (ACEPOL Science Team, 2017), while for AirMSPI it is https://doi.org/10.5067/AIRCRAFT/AIRMSPI/ACEPOL/RADIANCE/ELLIPSOID_V006 and https://doi.org/10.5067/AIRCRAFT/AIRMSPI/ACEPOL/RADIANCE/TERRAIN_V006 (ACEPOL AirMSPI 75 Science Team, 2017a, b). GroundMSPI data are at https://doi.org/10.5067/GROUND/GROUNDMSPI/ACEPOL/RADIANCE_v009 (GroundMSPI Science Team, 2017). Table 3 lists further details of these archives. This paper describes ACEPOL for potential data users and also provides an outline of requirements for future field missions with similar objectives.

Tracer data have been successfully used for hydrograph separation in glacierized basins. However, in these basins uncertainties of the hydrograph separation are large and are caused by the spatiotemporal variability in the tracer signatures of water sources, the uncertainty of water sampling, and the mixing model uncertainty. In this study, we used electrical conductivity (EC) measurements and two isotope signatures (δ18O and δ2H) to label the runoff components, including groundwater, snow and glacier meltwater, and rainfall, in a Central Asian glacierized basin. The contributions of runoff components (CRCs) to the total runoff and the corresponding uncertainty were quantified by two mixing approaches, namely a traditional end-member mixing approach (abbreviated as EMMA) and a Bayesian end-member mixing approach. The performance of the two mixing approaches was compared in three seasons that are distinguished as the cold season, snowmelt season, and glacier melt season. The results show the following points. (1) The Bayesian approach generally estimated smaller uncertainty ranges for the CRC when compared to the EMMA. (2) The Bayesian approach tended to be less sensitive to the sampling uncertainties of meltwater than the EMMA. (3) Ignoring the model uncertainty caused by the isotope fractionation likely led to an overestimated rainfall contribution and an underestimated meltwater share in the melt seasons. Our study provides the first comparison of the two end-member mixing approaches for hydrograph separation in glacierized basins and gives insight into the application of tracer-based mixing approaches in similar basins.

We conceptualize aerosol radiative transfer processes arising from the hypothetical coupling of a global aerosol transport model and a global numerical weather prediction model by applying the US Naval Research Laboratory Navy Aerosol Analysis and Prediction System (NAAPS) and the Navy Global Environmental Model (NAVGEM) meteorological and surface reflectance fields. A unique experimental design during the 2013 NASA Studies of Emissions and Atmospheric Composition, Clouds and Climate Coupling by Regional Surveys (SEAC4RS) field mission allowed for collocated airborne sampling by the high spectral resolution Lidar (HSRL), the Airborne Multi-angle SpectroPolarimetric Imager (AirMSPI), up/down shortwave (SW) and infrared (IR) broadband radiometers, as well as NASA A-Train support from the Moderate Resolution Imaging Spectroradiometer (MODIS), to attempt direct aerosol forcing closure. The results demonstrate the sensitivity of modeled fields to aerosol radiative fluxes and heating rates, specifically in the SW, as induced in this event from transported smoke and regional urban aerosols. Limitations are identified with respect to aerosol attribution, vertical distribution, and the choice of optical and surface polarimetric properties, which are discussed within the context of their influence on numerical weather prediction output that is particularly important as the community propels forward towards inline aerosol modeling within global forecast systems.

The semi-arid regions of Central Asia crucially depend on the water resources supplied by the mountainous areas of the Tien Shan and Pamir and Altai mountains. During the summer months the snow-melt- and glacier-melt-dominated river discharge originating in the mountains provides the main water resource available for agricultural production, but also for storage in reservoirs for energy generation during the winter months. Thus a reliable seasonal forecast of the water resources is crucial for sustainable management and planning of water resources. In fact, seasonal forecasts are mandatory tasks of all national hydro-meteorological services in the region. In order to support the operational seasonal forecast procedures of hydro-meteorological services, this study aims to develop a generic tool for deriving statistical forecast models of seasonal river discharge based solely on observational records. The generic model structure is kept as simple as possible in order to be driven by meteorological and hydrological data readily available at the hydro-meteorological services, and to be applicable for all catchments in the region. As snow melt dominates summer runoff, the main meteorological predictors for the forecast models are monthly values of winter precipitation and temperature, satellite-based snow cover data, and antecedent discharge. This basic predictor set was further extended by multi-monthly means of the individual predictors, as well as composites of the predictors. Forecast models are derived based on these predictors as linear combinations of up to four predictors. A user-selectable number of the best models is extracted automatically by the developed model fitting algorithm, which includes a test for robustness by a leave-one-out cross-validation. Based on the cross-validation the predictive uncertainty was quantified for every prediction model. Forecasts of the mean seasonal discharge of the period April to September are derived every month from January until June. The application of the model for several catchments in Central Asia – ranging from small to the largest rivers (240 to 290 000 km2 catchment area) – for the period 2000–2015 provided skilful forecasts for most catchments already in January, with adjusted R2 values of the best model in the range of 0.6–0.8 for most of the catchments. The skill of the prediction increased every following month, i.e. with reduced lead time, with adjusted R2 values usually in the range 0.8–0.9 for the best and 0.7–0.8 on average for the set of models in April just before the prediction period. The later forecasts in May and June improve further due to the high predictive power of the discharge in the first 2 months of the snow melt period. The improved skill of the set of forecast models with decreasing lead time resulted in narrow predictive uncertainty bands at the beginning of the snow melt period. In summary, the proposed generic automatic forecast model development tool provides robust predictions for seasonal water availability in Central Asia, which will be tested against the official forecasts in the upcoming years, with the vision of operational implementation.

An initial comparison of aerosol optical thickness over North Africa for year 2007 was performed between the Deep Blue (DB) and Multi-Angle Implementation of Atmospheric Correction (MAIAC) algorithms complimeted with MISR and OMI data. The dust retrievals are performed using the model of spheroids. The new MAIAC algorithm has a better sensitivity to the small dust storms than the DB algorithm, but it also has biases in the brightest desert regions indicating the need for improvement. The quarterly averaged AOT values in the Bodele depression and western downwind transport region show a good agreement among MAIAC, MISR and OMI data, while the DB algorithm shows a somewhat different seasonality.

The production of electrolytic nickel includes the stage of leaching of captured firing nickel matte dust. The solutions formed during this process contain considerable amounts of Pb, which is difficult to extraction due to its low concentration upon the high-salt background. The sorption of lead from model solutions with various compositions by synthetic and natural titanosilicate sorbents (synthetic ivanyukite-Na-T (SIV), ivanyukite-Na-T, and AM-4) have been investigated. The maximal sorption capacity of Pb is up to 400 mg/g and was demonstrated by synthetic ivanyukite In solutions with the high content of Cl− (20 g/L), extraction was observed only with a high amount of Na (150 g/L). Molecular mechanisms and kinetics of lead incorporation into ivanyukite were studied by the combination of single-crystal and powder X-ray diffraction, microprobe analysis, and Raman spectroscopy. Incorporation of lead into natural ivanyukite-Na-T with the R3m symmetry by the substitution 2Na+ + 2O2− ↔ Pb2+ + □ + 2OH− leds to its transformation into the cubic P−43m Pb-exchanged form with the empirical formulae Pb1.26[Ti4O2.52(OH)1.48(SiO4)3]·3.32(H2O).

This paper presents the results of the study of sigma-delta analog-to-digital converters` main spectral parameters` dependence on the total ionizing dose (TID). Within the framework of this study the main parameters of analog-to-digital converters (ADC) (dynamic, static and electrical) were controlled. The main dynamic characteristics of sigma-delta ADC are signal-to-noise ratio (SNR), spurious-free dynamic range (SFDR), signal-to-noise and distortion ratio (SINAD) and total harmonic distortion (THD). Those have been determined from the spectrum of digitized sine signal using the fast Fourier transform (FFT). Static parameters (integrated nonlinearity (INL), offset and gain errors) were determined using a straight line that linearizes the transfer function, according to the method which is described in the IEEE Standard for Terminology and Test Methods for Analog-to-Digital Converters. National Instruments modular measuring equipment was used for testing ADC`s parameters. Comparative data on the dose dependence of static and dynamic parameters of two sigma-delta ADC and one sigma-delta modulator are obtained. Based on the results, it was concluded that the most sensitive parameters of sigma-delta ADC to TID are its dynamic parameters. Therefore, when assessing the sigma-delta ADC`s radiation hardness, the spectral characteristics of absorbed dose should be kept under control.

Titanosilicates comprise a broad class of materials with promising technological applications. The typical obstacle that restricts their industrial applicability is the high manufacturing cost due to the use of specific organotitanium precursors. We herein report a new approach to the synthesis of titanosilicates using an inexpensive inorganic precursor, ammonium titanyl sulfate (ATS or STA), (NH4)2TiO(SO4)2∙H2O. The latter is an intermediate in the processing of titanium-bearing concentrates produced from apatite-nepheline ores. In this paper, the new synthetic approach is exemplified by the microwave-assisted synthesis of IONSIVE-911, one of the most effective Cs-ion scavengers. The method can be modified to synthesize various titanosilicate compounds.

This work helps address recent calls for systematic water quality assessment in Central Asia and considers how nutrient and salinity sources, and transport, affect water quality along the continuum from the cryosphere to the lowland plains. Spatial and, for the first time, temporal variations in stream water pH, temperature, electrical conductivity, and nitrate and phosphate concentrations are presented for four catchments (485-13,500 km 2 ), all with glaciers and major urban areas. The catchments studied were: Kaskelen (Kazakhstan), Ala-Archa (Kyrgyzstan), Chirchik (Uzbekistan) and the Kofarnihon (Tajikistan). Measurements were made in cryosphere, stream water, groundwater, reservoir and lake samples over a 22-month period at fortnightly intervals from 35 sites. The results highlight that glacier, permafrost and rock glacier outflows were primary and secondary nitrate sources (>1 mg N L -1 ) to the headwaters, and there were major increases in salinity and nitrate concentrations where rivers receive inputs from agriculture and settlements. Overall, the water quality complied with national and World Health Organization standards, however there were pollution hot-spots with shallow urban groundwaters contaminated with nitrate (>11 mg N L -1 ) and stream electrical conductivity above 800 μS cm -1 in some agricultural areas indicative of high salinity. Phosphate concentrations were generally low (<0.06 mg P L -1 ) throughout the catchments, though elevated (>0.2 mg P L -1 ) in urban areas due to effluent contamination. A melt water dilution effect along the main river channels was discernible, in the electrical conductivity and nitrate concentration seasonal dynamics, 100 s of km from the headwaters. Thus, the input of relatively clean water from the cryosphere is an important regulator of main channel water quality in the urban and farmed lowland plains adjacent to the Tien Shan and Pamir. Improved sewage treatment is needed in urban areas., Competing Interests: Declaration of competing interest The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Andrew J Wade reports financial support and article publishing charges were provided by UK Research and Innovation. Maria Shahgedanova reports financial support and article publishing charges were provided by UK Research and Innovation. Andrew J Wade reports a relationship with UK Research and Innovation that includes: funding grants. Maria Shahgedanova reports a relationship with UK Research and Innovation that includes: funding grants. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024. Published by Elsevier B.V.)

Background: Pulmonary involvement in systemic juvenile idiopathic arthritis (SJIA) is a rare but dangerous complication. The main risk factors are already known, such as macrophage activation syndrome, a refractory course of systemic juvenile arthritis, infusion reaction to interleukin 1 and/or interleukin 6 blockers, trisomy 21, and eosinophilia. However, information about respiratory system involvement (RSI) at the onset of SJIA is scarce. Our study aimed to evaluate the specific features of children with SJIA with RSI and their outcomes. Methods: In a single-center retrospective cohort study, we compared the information from the medical records of 200 children with SJIA according to ILAR criteria or SJIA-like disease (probable/possible SJIA) with and without signs of RSI (dyspnea, shortness of breath, pleurisy, acute respiratory distress syndrome, and interstitial lung disease (ILD)) at the disease onset and evaluated their outcomes (remission, development of chronic ILD, clubbing, and pulmonary arterial hypertension). Results: A quarter (25%) of the SJIA patients had signs of the RSI at onset and they more often had rash; hepato- and splenomegaly; heart (pericarditis, myocarditis), central nervous system, and kidney involvement; hemorrhagic syndrome; macrophage activation syndrome (MAS, 44.4% vs. 9.0%, p = 0.0000001); and, rarely, arthritis with fewer active joints, compared to patients without RSI. Five patients (10% from the group having RSI at the onset of SJIA and 2.5% from the whole SJIA cohort) developed fibrosing ILD. All of them had a severe relapsed/chronic course of MAS; 80% of them had a tocilizumab infusion reaction and further switched to canakinumab. Unfortunately, one patient with Down's syndrome had gone. Conclusion: Patients with any signs of RSI at the onset of the SJIA are required to be closely monitored due to the high risk of the following fibrosing ILD development. They required prompt control of MAS, monitoring eosinophilia, and routine checks of night oxygen saturation for the prevention/early detection of chronic ILD.

Background: Systemic lupus erythematosus (SLE) is the most frequent and serious systemic connective tissue disease. Nowadays there is no clear guidance on its treatment in childhood. There are a lot of negative effects of standard-of-care treatment (SOCT), including steroid toxicity. Rituximab (RTX) is the biological B-lymphocyte-depleting agent suggested as a basic therapy in pediatric SLE., Aim: To compare the benefits of RTX above SOCT., Methods: The data from case histories of 79 children from the Saint-Petersburg State Pediatric Medical University from 2012 to 2022 years, were analyzed. The diagnosis of SLE was established with SLICC criteria. We compared the outcomes of treatment of SLE in children treated with and without RTX. Laboratory data, doses of glucocorticosteroids, disease activity measured with SELENA-SLEDAI, and organ damage were assessed at the time of initiation of therapy and one year later., Results: Patients, treated with RTX initially had a higher degree of disease activity with prevalence of central nervous system and kidney involvement, compared to patients with SOCT. One year later the disease characteristics became similar between groups with a more marked reduction of disease activity (SELENA-SLEDAI activity index) in the children who received RTX [-19 points (17; 23) since baseline] compared to children with SOCT [-10 (5; 15.5) points since baseline, P = 0.001], the number of patients with active lupus nephritis, and daily proteinuria. During RTX therapy, infectious diseases had three patients; one patient developed a bi-cytopenia., Conclusion: RTX can be considered as the option in the treatment of severe forms of SLE, due to its ability to arrest disease activity compared to SOCT., Competing Interests: Conflict-of-interest statement: All the authors declare that they have no conflict of interest., (©The Author(s) 2022. Published by Baishideng Publishing Group Inc. All rights reserved.)

Background: Pediatric lupus nephritis (LN) is one of the most serious manifestations of systemic lupus erythematosus (SLE) in children, determining the outcomes of the disease. There are no standardized treatment protocols for pediatric LN, and the role of biologics has not yet been conclusively defined., Objectives: analyze the safety and efficacy of rituximab biosimilar BCD020 in pediatric patients with lupus nephritis., Methods: in a retrospective cohort study, the data from the case histories of 25 patients with LN (10 boys and 15 girls) with an onset age of 13 (9-16) years, who failed conventional non-biologic treatment or developed corticosteroid dependence/toxicity, were included. The diagnosis was made using Systemic Lupus International Collaborating Clinics (SLICC) classification criteria. Rituximab biosimilar BCD020 was prescribed in a dosage of 375 mg/m 2 every week (2-4 infusions) with repeated courses every 6-12 months (2-4 infusions) according to disease activity, B-cell depletion, and IgG levels. The dynamics of clinical and laboratory data, the activity of the disease by SLEDAI, and corticosteroid doses were assessed at the onset and during the rituximab trial., Results: The main patient's characteristics were: Pre-rituximab non-biologic conventional treatment included: cyclophosphamide 15 (60%), MMF 8 (32%), azathioprine 3 (12%), hydroxychloroquine 12 (48%), and pulse therapy of methylprednisolone followed by oral methylprednisolone 25 (100%). The time before rituximab was 7.0 (3.0-24.0) months, and the whole observation period was 7.0 (0; 24) months. The initial pre-rituximab treatment slightly reduced SLEDAI levels and the proportion of patients with LN. A significant reduction of SLEDAI, the anti-dsDNA level, proteinuria, hematuria, C4 complement, ESR, and the median corticosteroid dose by 80% from the initial value, as well as the proportion of patients without corticosteroids, was observed after rituximab administration. Two deaths were observed due to catastrophic SLE with macrophage activation syndrome, accompanied by a severe infection (invasive aspergillosis, n = 2). Three patients developed serious adverse events: pneumonia ( n = 2), transient agranulocytosis ( n = 1) after the third rituximab infusion, and meningitis, caused by Listeria monocytosis, after the first rituximab infusion. Eight patients received antibacterial treatment for different respiratory infections without hospital admissions., Conclusions: Rituximab biosimilar BCD020 showed effectiveness in LN, whereas previous non-biologic treatment was insufficiently effective. Randomized controlled trials are required to evaluate the efficacy and safety of rituximab and evaluate the benefits when compared with conventional SLE treatment.

The prevalence of diabetes mellitus is one of the major medical problems that the modern world is currently facing. Type 1 and Type 2 diabetes mellitus both result in early disability and death, as well as serious social and financial problems. In some cases, synthetic drugs can be quite effective in the treatment of diabetes, though they have side effects. Plant-derived pharmacological substances are of particular interest. This review aims to study the antidiabetic properties of secondary plant metabolites. Existing review and research articles on the investigation of the antidiabetic properties of secondary plant metabolites, the methods of their isolation, and their use in diabetes mellitus, as well as separate articles that confirm the relevance of the topic and expand the understanding of the properties and mechanisms of action of plant metabolites, were analyzed for this review. The structure and properties of plants used for the treatment of diabetes mellitus, including plant antioxidants, polysaccharides, alkaloids, and insulin-like plant substances, as well as their antidiabetic properties and mechanisms for lowering blood sugar, are presented. The main advantages and disadvantages of using phytocomponents to treat diabetes are outlined. The types of complications of diabetes mellitus and the effects of medicinal plants and their phytocomponents on them are described. The effects of phytopreparations used to treat diabetes mellitus on the human gut microbiota are discussed. Plants with a general tonic effect, plants containing insulin-like substances, plants-purifiers, and plants rich in vitamins, organic acids, etc. have been shown to play an important role in the treatment of type 2 diabetes mellitus and the prevention of its complications.

Introduction: Meaning is an important psychological resource both in situations of accomplishment and in situations of ongoing adversity and psychological crisis. Meaning in life underlies the reasons for staying alive both in everyday and in critical circumstances, fulfilling a buffering function with respect to life adversities., Aim: The aim of the present study was to reveal the role of both meaningfulness, including specific sources of meaning and reasons for living, and meaninglessness (alienation) in patients suffering from profound crisis situations with or without suicidal intentions and behavior., Methods: The sample included 148 patients (all Caucasian) who were referred to a crisis center in Moscow, Russia. Seventy-seven patients (54 females, mean age 32.00 ± 11.98 years) reported a current crisis situation in their life but denied suicidal thoughts or behavior. Twenty-nine patients (21 females, mean age 31.55 ± 13.76 years) reported suicidal ideations but denied suicidal attempts or self-harming behavior. Forty-two patients (31 females, mean age 30.64 ± 11.38 years) had episodes of suicidal attempts or self-harming behavior accompanied by suicidal intentions. There were no significant gender or age differences between groups.Participants completed a number of measures of different aspects of meaning and meaninglessness, well-being, ill-being and psychological resources. For some patients ( N  = 74), a clinical checklist was completed by their doctors assessing 28 various characteristics associated with the patient's clinical status., Results and Discussion: Meaningfulness and reasons for living were more helpful in distinguishing between reactions to profound crisis situations (suicidal intentions versus non-suicidal behavior) than were measures of well-being, ill-being, meaning crisis or personality resources. In both suicidal and non-suicidal crisis patients meaningfulness predicted more positive reasons for living. The relationship between meaningfulness and most reasons for living remained significant after controlling for clinically appraised suicidal "readiness," acute stress and lack of social support. Self-transcendence was the major specific source of meaning predicting higher reasons for living after adjusting for general meaningfulness., Conclusion: The data cast some light on the psychological meaning of suicide. It follows that prevention efforts are to be focused not on eliminating the factors "pushing" one to suicidal behavior, but rather on supporting inner strengths conducive of a positive decision, to be , through enhancing meaningfulness and reasons for living., Competing Interests: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest., (Copyright © 2022 Kalashnikova, Leontiev, Rasskazova and Taranenko.)

The beneficial properties of algae make them perfect functional ingredients for food products. Algae have a high energy value and are a source of biologically active substances, proteins, fats, carbohydrates, vitamins, and macro- and microelements. They are also rich in polyunsaturated fatty acids, proteins, mycosporine-like amino acids, polysaccharides, polyphenols, carotenoids, sterols, steroids, lectins, halogenated compounds, polyketides, alkaloids, and carrageenans. Different extraction parameters are used depending on the purpose and the substances to be isolated. In this study, the following parameters were used: hydromodule 1:10 and an extraction duration of 1-2 h at the extraction temperature of 25-40 °C. A 30-50% solution of ethanol in water was used as an extractant. Algae extracts can be considered as potential natural sources of biologically active compounds with antimicrobial activity and antiviral properties. The content of crude protein, crude fat, and carbohydrates in U. Prolifera , C. racemosa var. peltata ( Chlorophyta ), S. oligocystum and S. fusiforme (SF-1) was studied. It was found that C. muelleri ( Bacillariophyta ), I. galbana ( Haptophyta ), and T. weissflogii ( Bacillariophyta ) contain about 1.9 times more omega-3 than omega-6 fatty acids. N. gaditana ( Ochrophyta ), D. salina ( Chlorophyta ), P. tricornutum ( Bacillaryophyta ) and I. galbana ( Haptophyta ) extracts showed inhibitory activity of varying intensities against E. coli or P. aeruginosa . In addition, algae and algae-derived compounds have been proposed to offer attractive possibilities in the food industry, especially in the meat sector, to evolve functional foods with myriad functionalities. Algae can increase the biological activity of food products, while the further study of the structure of compounds found in algae can broaden their future application possibilities.

Chronic lymphocytic leukemia (CLL) is a disease of the elderly, characterized by immunodeficiency. Hence, patients with CLL might be considered more susceptible to severe complications from COVID-19. We undertook this retrospective international multicenter study to characterize the course of COVID-19 in patients with CLL and identify potential predictors of outcome. Of 190 patients with CLL and confirmed COVID-19 diagnosed between 28/03/2020 and 22/05/2020, 151 (79%) presented with severe COVID-19 (need of oxygen and/or intensive care admission). Severe COVID-19 was associated with more advanced age (≥65 years) (odds ratio 3.72 [95% CI 1.79-7.71]). Only 60 patients (39.7%) with severe COVID-19 were receiving or had recent (≤12 months) treatment for CLL at the time of COVID-19 versus 30/39 (76.9%) patients with mild disease. Hospitalization rate for severe COVID-19 was lower (p < 0.05) for patients on ibrutinib versus those on other regimens or off treatment. Of 151 patients with severe disease, 55 (36.4%) succumbed versus only 1/38 (2.6%) with mild disease; age and comorbidities did not impact on mortality. In CLL, (1) COVID-19 severity increases with age; (2) antileukemic treatment (particularly BTK inhibitors) appears to exert a protective effect; (3) age and comorbidities did not impact on mortality, alluding to a relevant role of CLL and immunodeficiency.

Deposition of mineral dust into ocean fertilizes ecosystems and influences biogeochemical cycles and climate. In-situ observations of dust deposition are scarce, and model simulations depend on the highly parameterized representations of dust processes with few constraints. By taking advantage of satellites' routine sampling on global and decadal scales, we estimate African dust deposition flux and loss frequency (LF, a ratio of deposition flux to mass loading) along the trans-Atlantic transit using the three-dimensional distributions of aerosol retrieved by spaceborne lidar (CALIOP) and radiometers (MODIS, MISR, and IASI). On the basis of a ten-year (2007-2016) and basin scale average, the amount of dust deposition into the tropical Atlantic Ocean is estimated at 136 - 222 Tg yr -1 . The 65-83% of satellite-based estimates agree with the in-situ climatology within a factor of 2. The magnitudes of dust deposition are highest in boreal summer and lowest in fall, whereas the interannual variability as measured by the normalized standard deviation with mean is largest in spring (28-41%) and smallest (7-15%) in summer. The dust deposition displays high spatial heterogeneity, revealing that the meridional shifts of major dust deposition belts are modulated by the seasonal migration of the intertropical convergence zone (ITCZ). On the basis of the annual and basin mean, the dust LF derived from the satellite observations ranges from 0.078 to 0.100 d -1 , which is lower than model simulations by up to factors of 2 to 5. The most efficient loss of dust occurs in winter, consistent with the higher possibility of low-altitude transported dust in southern trajectories being intercepted by rainfall associated with the ITCZ. The satellite-based estimates of dust deposition can be used to fill the geographical gaps and extend time span of in-situ measurements, study the dust-ocean interactions, and evaluate model simulations of dust processes.

We conceptualize aerosol radiative transfer processes arising from the hypothetical coupling of a global aerosol transport model and a global numerical weather prediction model by applying the US Naval Research Laboratory Navy Aerosol Analysis and Prediction System (NAAPS) and the Navy Global Environmental Model (NAVGEM) meteorological and surface reflectance fields. A unique experimental design during the 2013 NASA Studies of Emissions and Atmospheric Composition, Clouds and Climate Coupling by Regional Surveys (SEAC 4 RS) field mission allowed for collocated airborne sampling by the high spectral resolution Lidar (HSRL), the Airborne Multi-angle SpectroPolarimetric Imager (AirMSPI), up/down shortwave (SW) and infrared (IR) broadband radiometers, as well as NASA A-Train support from the Moderate Resolution Imaging Spectroradiometer (MODIS), to attempt direct aerosol forcing closure. The results demonstrate the sensitivity of modeled fields to aerosol radiative fluxes and heating rates, specifically in the SW, as induced in this event from transported smoke and regional urban aerosols. Limitations are identified with respect to aerosol attribution, vertical distribution, and the choice of optical and surface polarimetric properties, which are discussed within the context of their influence on numerical weather prediction output that is particularly important as the community propels forward towards inline aerosol modeling within global forecast systems., Competing Interests: Competing interests. The authors declare that they have no conflict of interest.

The Plankton, Aerosol, Cloud, ocean Ecosystem (PACE) mission will carry into space the Ocean Color Instrument (OCI), a spectrometer measuring at 5nm spectral resolution in the ultraviolet (UV) to near infrared (NIR) with additional spectral bands in the shortwave infrared (SWIR), and two multi-angle polarimeters that will overlap the OCI spectral range and spatial coverage, i. e., the Spectrometer for Planetary Exploration (SPEXone) and the Hyper-Angular Rainbow Polarimeter (HARP2). These instruments, especially when used in synergy, have great potential for improving estimates of water reflectance in the post Earth Observing System (EOS) era. Extending the top-of-atmosphere (TOA) observations to the UV, where aerosol absorption is effective, adding spectral bands in the SWIR, where even the most turbid waters are black and sensitivity to the aerosol coarse mode is higher than at shorter wavelengths, and measuring in the oxygen A-band to estimate aerosol altitude will enable greater accuracy in atmospheric correction for ocean color science. The multi-angular and polarized measurements, sensitive to aerosol properties (e.g., size distribution, index of refraction), can further help to identify or constrain the aerosol model, or to retrieve directly water reflectance. Algorithms that exploit the new capabilities are presented, and their ability to improve accuracy is discussed. They embrace a modern, adapted heritage two-step algorithm and alternative schemes (deterministic, statistical) that aim at inverting the TOA signal in a single step. These schemes, by the nature of their construction, their robustness, their generalization properties, and their ability to associate uncertainties, are expected to become the new standard in the future. A strategy for atmospheric correction is presented that ensures continuity and consistency with past and present ocean-color missions while enabling full exploitation of the new dimensions and possibilities. Despite the major improvements anticipated with the PACE instruments, gaps/issues remain to be filled/tackled. They include dealing properly with whitecaps, taking into account Earth-curvature effects, correcting for adjacency effects, accounting for the coupling between scattering and absorption, modeling accurately water reflectance, and acquiring a sufficiently representative dataset of water reflectance in the UV to SWIR. Dedicated efforts, experimental and theoretical, are in order to gather the necessary information and rectify inadequacies. Ideas and solutions are put forward to address the unresolved issues. Thanks to its design and characteristics, the PACE mission will mark the beginning of a new era of unprecedented accuracy in ocean-color radiometry from space., Competing Interests: Conflict of Interest Statement: LG is employed by company Pixstart, and DR and FS are employed by company HYGEOS. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Background/purpose: The CCR5 protein is a chemokine receptor, and is known to be expressed on T cells, macrophages, dendritic and microglia cells. It is believed that different prevalence of HLA and CCR5- delta32-a 32 base pair deletion in the coding region-in various ethnic groups is associated with the severity and prevalence of chemokine-mediated autoimmune diseases, systemic-onset Juvenile Idiopathic Arthritis (soJIA) being among them (Del Rincon et al., 2003). Since the end of the last century the protective role of the CCR5-delta32 mutation against JIA is discussed (Hinks et al., 2010), though it seems the role of this mutation is less simple than was hitherto thought. The purposes of the study was to compare the prevalence of the CCR5-delta32 mutation in children with and without soJIA, to assess the association of this mutation with the severity of the disease and thus to evaluate its protective role., Methods: 234 children (193 of European origin, 25-Hispanic or Latino, 14-Afro-Americans, 3-of Asian origin) with soJIA living in the USA and in the Northwestern part of Russia were enrolled in the study. Genomic DNA was isolated from blood samples using QIAamp Mini Kit and amplified by PCR. The following oligonucleotide primers were used to detect CCR5 d32: CCR5- Δ32-F: 5'CTTCATTACACCTGCAGTC3', CCR5-Δ32-R: 5'TGAAGATAAGCCTCACAGCC3' by following condition: 95°-5'×1; 95°-15″→55°-15″→72°-60″×40; 72°-10'×3→4°-∞; the resulting PCR products were separated on 2% agarose gel by electrophoresis and visualized by Gel Doc XR Plus., Results: Mutation was revealed only in children of European origin. Though the prevalence of the heterozygous CCR5-delta32 mutation being 16% and 21% in the USA and in Russia correspondingly didn't excel from its prevalence in populations in total (10-18% for Northwestern Russia, Kofiady, 2008; 11,8%- for white American group, Downer et al, 2002), some laboratory and clinical signs of soJIA proved to be related to the mutation (see ). Heterozygous CCR5-delta32 genotype was associated with milder so-JIA course and predominance of the articular features over systemic. [Table: see text], Conclusion: The results of the study may be considered rather not supporting the idea of the protective role of the CCR5-delta32 mutation against soJIA, though the revealed associations-most of them related to the signs of the Macrophage Associated Syndrome-can be the basis for a more sophisticated research., (Copyright © 2014 by the American College of Rheumatology.)