Search

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and blackskinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different redskinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of longterm interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish. [ABSTRACT FROM AUTHOR]

Single‐cell RNA sequencing and spatial transcriptomics enable unprecedented insight into cellular and molecular pathways implicated in human skin aging and regeneration. Senescent cells are individual cells that are irreversibly cell cycle arrested and can accumulate across the human lifespan due to cell‐intrinsic and ‐extrinsic stressors. With an atlas of single‐cell RNA‐sequencing and spatial transcriptomics, epidermal and dermal senescence and its effects were investigated, with a focus on melanocytes and fibroblasts. Photoaging due to ultraviolet light exposure was associated with higher burdens of senescent cells, a sign of biological aging, compared to chronological aging. A skin‐specific cellular senescence gene set, termed SenSkin™, was curated and confirmed to be elevated in the context of photoaging, chronological aging, and non‐replicating CDKN1A+ (p21) cells. In the epidermis, senescent melanocytes were associated with elevated melanin synthesis, suggesting haphazard pigmentation, while in the dermis, senescent reticular dermal fibroblasts were associated with decreased collagen and elastic fiber synthesis. Spatial analysis revealed the tendency for senescent cells to cluster, particularly in photoaged skin. This work proposes a strategy for characterizing age‐related skin dysfunction through the lens of cellular senescence and suggests a role for senescent epidermal cells (i.e., melanocytes) and senescent dermal cells (i.e., reticular dermal fibroblasts) in age‐related skin sequelae. [ABSTRACT FROM AUTHOR]

Acromelanism is a form of albinism observed in several vertebrate species. In mammals, acromelanism is known to be caused by mutations in the tyrosinase gene (TYR) that induce a temperature‐sensitive behavior of melanin synthesis, resulting in a characteristic hair color gradient. In birds, several phenotypes consistent with acromelanism have been reported, but their genetic basis remains unknown. This study aimed to identify the genetic basis of an acromelanistic phenotype in domesticated canaries known as pearl and test whether it is caused by the same molecular mechanism described for mammals. To do this, we compared the genomes of pearl and non‐pearl canaries and searched for potentially causative genetic mutations. Our results suggest that the pearl phenotype is caused by a mutation in the TYR gene encoding a TYR‐P45H missense substitution. Our findings further suggest that reports of acromelanism in other bird species might be explained by TYR mutations. [ABSTRACT FROM AUTHOR]

Melanogenesis, a natural responsive mechanism of human skin to harmful radiation, is a self-triggered defensive neural activity safeguarding the body from radiation exposure in advance. With the increasing significance of radiation shielding in diverse medical health care and wearable applications, a biomimetic neuromorphic optoelectronic system with adaptive radiation shielding capability is often needed. Here, we demonstrate a transparent and flexible metal oxide-based photovoltaic neuromorphic defensive system. By using a monolithically integrated ultraflexible optoelectronic circuitry and electrochromic device, seamless neural processing for ultraviolet (UV) radiation shielding including history-based sensing, memorizing, risk recognition, and blocking can be realized with piling the entire signal chain into the flexible devices. The UV shielding capability of the system can be evaluated as autonomous blocking up to 97% of UV radiation from 5 to 90 watts per square meter in less than 16.9 seconds, demonstrating autonomously modulated sensitivity and response time corresponding to UV environmental conditions and supplied bias. [ABSTRACT FROM AUTHOR]

The genus Lentzea is a prolific source of bioactive and structurally diverse secondary metabolites. We isolated a novel strain, Lentzea sp. JNUCC 0626, from Hwasun Gotjawal on Jeju Island, Korea. Based on 16S rRNA partial gene sequence analysis, strain JNUCC 0626 is closely related to Lentzea isolaginshaensis NX62 (99.41% similarity), Lentzea pudingi DHS C021 (99.31%), and Lentzea cavernae SYSU K10001 (99.26%). From the fermentation broth of JNUCC 0626, we isolated 1-acetyl-β-carboline, whose structure was established using IR, HR-ESI-MS, and 1D- and 2D-NMR techniques. 1-acetyl-β-carboline was found to activate melanogenesis in mouse B16F10 cells without cytotoxicity at concentrations up to 50 μM. At this concentration, the compound increased melanin content by 27.44% and tyrosinase activity by 240.64% compared to the control, by upregulating key melanogenic enzymes, including tyrosinase, TRP-1, TRP-2, and microphthalmia-associated transcription factor (MITF), a central regulator of melanogenesis. In addition, 1-acetyl-β-carboline significantly inhibited ERK phosphorylation, reducing it by 20.79% at a concentration of 12.5 μM and by 25.63% at 25 μM. This inhibition supports the hypothesis that 1-acetyl-β-carboline enhances melanin synthesis by upregulating MITF and melanogenic enzymes via the ERK signaling pathway. This study aimed to isolate and identify 1-acetyl-β-carboline from a novel strain of Lentzea sp. JNUCC 0626, discovered in Gotjawal, Jeju Island, and to evaluate its effect on melanin production in B16F10 melanoma cells. Skin irritation tests on 32 subjects confirmed its safety for topical use, and the findings suggest that 1-acetyl-β-carboline, which enhances melanogenesis without cytotoxicity, holds promise as a therapeutic agent for hypopigmentation-related conditions or as a cosmetic ingredient. [ABSTRACT FROM AUTHOR]

Objective: Tyrosinase inhibitors suppress melanogenesis in melanocytes. During a screening for tyrosinase inhibitors, however, we noticed some discrepancies in inhibitory efficacies between melanocytes and in vitro assays. The compound (S)‐N‐{3‐[4‐(dimethylamino)phenyl]propyl}‐N‐methyl‐indan‐1‐amine (GIF‐2115) exerts antioxidative stress activity upon accumulation in late endosomes and lysosomes. GIF‐2115 was also identified as a potent antimelanogenic reagent in B16F10 mouse melanoma cells. GIF‐2115 inhibited the activity of mushroom tyrosinase and the lysates of B16F10 cells. However, structure–activity relationship studies indicated that GIF‐2238, which lacks the benzene ring in the aminoindan structure of GIF‐2115, inhibited tyrosinase activity in vitro but did not inhibit melanogenesis in B16F10 cells. The aim of the present study is to show the importance of the intracellular distribution of tyrosinase inhibitors in exerting their antimelanogenic activity in melanocytes. Methods: The intracellular distribution of compounds was monitored by linking with the fluorescent group of 7‐nitro‐2,1,3‐benzoxadiazole (NBD). To mislocalize GIF‐2115 to mitochondria, the mitochondria‐preferring fluoroprobe ATTO565 was used. Results: We reconfirmed the localization of GIF‐2250 (GIF‐2115‐NBD) not only to matured but also to early‐stage melanosomes. Although GIF‐2286 (GIF‐2238‐NBD) maintained tyrosinase inhibitory activity, it did not show specific intracellular localization. Moreover, when GIF‐2115 was linked with ATTO565, the resultant compound GIF‐2265 did not inhibit melanogenesis in B16F10 cells, despite its strong tyrosinase inhibitory activity. Conclusion: These results suggest that melanosomal localization is essential for the antimelanogenic activity of GIF‐2115, and GIF‐2115 derivatives may be new guides for drugs to endosomes and lysosomes as well as melanosomes. [ABSTRACT FROM AUTHOR]

[Display omitted] • In case of fire break glass. • Must be provided as a word document select "Highlights" from the drop-down list when uploading files. • Only required for full research artic. Natural hair curvature and colour are genetically determined human traits, that we intentionally change by applying thermal and chemical treatments to the fibre. Presently, those cosmetic methodologies act externally and their recurrent use is quite detrimental to hair fibre quality and even to our health. This work represents a disruptive concept to modify natural hair colour and curvature. We aim to model the fibre phenotype as it is actively produced in the follicle through the topical delivery of specific bioactive molecules to the scalp. Transcriptome differences between curly and straight hairs were identified by microarray. In scalp samples, the most variable transcripts were mapped by in situ hybridization. Then, by using appropriate cellular models, we screened a chemical library of 1200 generic drugs, searching for molecules that could lead to changes in either fibre colour or curvature. A pilot-scale, single-centre, investigator-initiated, prospective, blind, bilateral (split-scalp) placebo-controlled clinical study with the intervention of cosmetics was conducted to obtain a proof of concept (RNEC n.92938). We found 85 genes transcribed significantly different between curly and straight hair, not previously associated with this human trait. Next, we mapped some of the most variable genes to the inner root sheath of follicles, reinforcing the role of this cell layer in fibre shape moulding. From the drug library screening, we selected 3 and 4 hits as modulators of melanin synthesis and gene transcription, respectively, to be further tested in 33 volunteers. The intentional specific hair change occurred: 8 of 14 volunteers exhibited colour changes, and 16 of 19 volunteers presented curvature modifications, by the end of the study. The promising results obtained are the first step towards future cosmetics, complementary or alternative to current methodologies, taking hair styling to a new level: changing hair from the inside out. [ABSTRACT FROM AUTHOR]

Excessive activity of the tyrosinase enzyme during melanogenesis results in hyperpigmentation in the skin. To address this issue, there is a need to develop effective tyrosinase inhibitors as a treatment for hyperpigmentation. In this study, we synthesized some novel 4H-chromene-3-carbonitrile compounds (6a-o) and assessed their inhibitory activities against tyrosinase, comparing them with kojic acid, which is known as a positive control. Compound 6f emerged as the most effective inhibitor, with an IC50 of 35.38 ± 2.12 µM. Kinetic studies of 6f exhibited competitive inhibition, with Ki = 16.15 µM. Molecular docking studies highlighted the importance of π-π stacking and hydrogen bonding interactions within the binding site. Molecular dynamics simulations showed that the R-enantiomer 6f exhibited superior binding stability compared to the S-enantiomer, with a lower standard deviation of RMSD and more persistent interactions with the key active site residues. These findings underscore the potential of the R-enantiomer of compound 6f as a potent tyrosinase inhibitor and provide insights for developing effective treatments for hyperpigmentation and related skin conditions. [ABSTRACT FROM AUTHOR]

Tyrosinase is a key enzyme in melanin synthesis, and its natural inhibitors are receiving increasing attention. Rosa × damascena Herrm. essential oil (RDEO), as important functional metabolites, was widely known due to its biological activities. But its tyrosinase inhibitory activity has not been detailed investigated. Therefore, in this paper, RDEO was comprehensively investigated the tyrosinase inhibitory, followed by the phytochemical composition analysis. Activity screening results showed that RDEO exhibited effective anti-tyrosinase activity and was a reversible and mixed-type inhibitor. CD assay results revealed that RDEO could affect the conformation of tyrosinase to reduce the activity. In B16F10 cells, RDEO (25-100 µg/mL) could inhibit intracellular tyrosinase activity and decrease melanin content. Finally, GC-MS analysis of RDEO found that citronellol (21.22%), geraniol (14.1%), eicosane (11.03%), heneicosane (6.65%) and 1-nonadecene (5.16%) were its main phytochemical compositions. This study provided data support for Rosa × damascena Herrm. essential oil as one potential natural tyrosinase inhibitor and its applications in cosmetics and medicine. [ABSTRACT FROM AUTHOR]

ABSTRACT Background Aims Methods Results Conclusion Hyperpigmentation disorders are caused by the excess production and irregular accumulation of melanin. Existing treatments often have limited efficacy and adverse effects, necessitating the development of new skin‐brightening agents. Lotus sprout extract (LSE) was identified as a potential pigment‐correcting agent. However, the active compounds responsible for driving mechanisms related to this activity remain unknown.This study aimed to investigate the effects of LSE and its active components, neferine and liensinine, on melanin accumulation and to understand how LSE reduces skin pigmentation.Melanin accumulation was analyzed in MNT‐1 human melanoma cells and MelanoDerm human skin equivalents following neferine, liensinine, or LSE treatment. The effects of the compounds on different pathways regulating melanin levels were evaluated by gene expression, biochemical assays, and western blotting. Melanosome ultrastructure was monitored using transmission electron microscopy (TEM).Neferine and liensinine reduced melanin accumulation in MNT‐1 cells without downregulating melanogenesis‐related genes or inhibiting tyrosinase activity. Instead, these compounds increased autophagic flux, suggesting that the reduction in pigmentation was due to increased melanin degradation. LSE also reduced melanin accumulation and activated autophagy in normal human melanocytes and MelanoDerm tissue. Autophagosomes induced by LSE treatment contained only melanosomes, and structural changes in melanosomes suggested that LSE may disrupt melanosome maturation.This study revealed a novel mechanism for LSE, neferine, and liensinine in reducing pigmentation, potentially through the induction of autophagy and subsequent melanosome degradation. These findings suggest that LSE and its enriched bioactive compounds could be promising agents for treating hyperpigmentation. [ABSTRACT FROM AUTHOR]

Curated online interaction databases and gene ontology tools have streamlined the analysis of highly complex gene/protein networks. However, understanding of disease pathogenesis has gradually shifted from a protein-based core to complex interactive networks where non-coding RNA (ncRNA) is thought to play an essential role. As current gene ontology is based predominantly on protein-level information, there is a growing need to analyze networks with ncRNA. In this study, we propose a gene ontology workflow integrating ncRNA using the NPInter V5.0 database. To validate the proposed workflow, we analyzed our previously published curated biomarker datasets for hidden disease susceptibility processes and pharmacogenomics. Our results show a novel involvement of melanogenesis in psoriasis response to biological drugs in general. Hyperpigmentation has been previously observed in psoriasis following treatment with currently indicated biological drugs, thus calling attention to melanogenesis research as a response biomarker in psoriasis. Moreover, our proposed workflow highlights the need to critically evaluate computed ncRNA interactions within databases and a demand for gene ontology analysis of large miRNA blocks. [ABSTRACT FROM AUTHOR]

Basella alba has been used in Thai remedies to treat skin disorders, but scientific evidence supporting its efficacy is currently limited. In this study, we investigated the inhibitory effects of B. alba extracts on melanin production using melanoma cells, as well as their impact on oxidative stress and inflammation in keratinocytes. The results demonstrate that B. alba extracts inhibited melanin content and cellular tyrosinase activity in 3-isobutyl-1-methylxanthine (IBMX)-induced melanoma cells by downregulating MITF and the pigmentary genes TYR, TRP-1, and DCT. Interestingly, the MITF regulator gene was inhibited by both the 50% and 95% ethanolic extracts of B. alba with levels of 0.97 ± 0.19 and 0.92 ± 0.09 of the control, respectively, which are comparable to those observed in the arbutin treatment group at 0.84 ± 0.05 of the control. Moreover, after hydrogen peroxide (H2O2) exposure, pretreatment with B. alba reduced lipid peroxidation byproducts and increased the levels of antioxidant-related genes, including SOD-1, GPX-1, and NRF2. Notably, the suppression of the POMC promoter gene in keratinocytes was observed, which may disrupt melanogenesis in melanocytes involving the MC1R signaling pathway. MC1R mRNA expression decreased in the treatments with 50% and 95% ethanolic extracts of B. alba, with relative levels of 0.97 ± 0.18 and 0.90 ± 0.10 of the control, respectively, similar to the arbutin-treated group (0.88 ± 0.25 of control). A significant reduction in nitric oxide was also observed in the B. alba-treated groups, along with a decrease in genes associated with pro-inflammatory cytokines, including IL-1β, IL-6, and COX-2. These findings suggest that B. alba has potential in the prevention of skin-related problems. [ABSTRACT FROM AUTHOR]

The mechanism and function of the expression of Schwann characteristics by nevus cells in the mature zone of the dermis are unknown. Early growth response 3 (EGR3) induces Schwann cell‐like differentiation of melanoma cells by simulating the process of nevus maturation, which leads to a strong phenotypic transformation of the cells, including the formation of long protrusions and a decrease in cell motility, proliferation, and melanin production. Meanwhile, EGR3 regulates the levels of myelin protein zero (MPZ) and collagen type I alpha 1 chain (COL1A1) through SRY‐box transcription factor 10 (SOX10)‐dependent and independent mechanisms, by binding to non‐strictly conserved motifs, respectively. Schwann cell‐like differentiation demonstrates significant benefits in both in vivo and clinical studies. Finally, a CD86‐P2A‐EGR3 recombinant mRNA vaccine is developed which leads to tumor control through forced cell differentiation and enhanced immune infiltration. Together, these data support further development of the recombinant mRNA as a treatment for cancer. [ABSTRACT FROM AUTHOR]

BACKGROUND There are 7 known serotypes of botulinum neurotoxins (A through G). Currently, commercially available toxins are those in serotypes A and B. This paper will discuss new toxins on the horizon, developments in prolonging and shortening the duration of outcomes, and novel therapeutic indications on the horizon. OBJECTIVE To provide insight into new toxins and new therapeutic modalities surrounding toxins on the horizon. METHODS The authors have reviewed the relevant literature and shared their insights and opinions as to future developments in toxin research and potential clinical applications. CONCLUSION Botulinum neurotoxin type E's faster onset and shorter duration of effect represent true clinical differentiators. Future development of botulinum neurotoxin type E for aesthetic and therapeutic uses will be in areas where fast onset and short duration of effect are desirable. Current challenges with neuromodulators include the need for frequent treatments and lack of reversal agents. Agents to address both challenges and novel indications, including inhibition of melanogenesis, are being developed. [ABSTRACT FROM AUTHOR]

In our previous study, we documented the anti-melanogenic efficacy of calebin-A (CBA), which is a curcuminoid analog. The effects of its newly synthesized analogs, i.e., bisdemethoxy calebin (BD), demethoxycalebin-1 (DA1), demethoxycalebin-2 (DA2), and tetrahydrocalebin-A (THCBA), on melanogenesis have not been examined yet. Herein, we evaluated these four CBA analogs to determine their impacts on the enzymatic activity of mushroom tyrosinase. Additionally, we examined their effects on melanogenesis and the tyrosinase activity in B16F10 mouse and MNT-1 human melanoma cells. The antioxidant activity of the analogs was also assessed. Our results revealed that BD was ineffective, while DA1 and DA2 showed similar antioxidant activities, with THCBA exhibiting the greatest antioxidant activity. Next, the diphenolase activity assay results revealed that DA1 showed the most excellent inhibitory efficacy, DA2 and BD showed similar inhibition profiles, and THCBA was ineffective. In addition, the results of the monophenolase activity showed a similar pattern, except that THCBA suppressed the activity. The four analogs were evaluated for any cytotoxicity over a 48 h duration in B16F10 and HaCaT keratinocytes, where DA1 exerted cytotoxicity at the concentration of 50 µM. Based on this, the analogs were evaluated over a 10–50 µM concentration range, while DA1 was evaluated over 10–35 µM. BD showed the greatest efficacy at multiple concentrations in significantly diminishing melanogenesis in hormone-stimulated B16F10 cells, while DA1 and DA2 suppressed melanin at 35 and 50 µM, respectively, and THCBA stimulated melanogenesis at 50 µM. In addition, BD and DA1 suppressed tyrosinase activity in B16F10 cells, with no effect in the case of DA2 and THCBA analogs. However, in MNT-1 cells, only DA1 showed efficacy in suppressing melanin production while the other three analogs were ineffective. Interestingly, BD and DA1 suppressed MNT-1 cell tyrosinase activity. Collectively, our results indicate that of the four analogs, DA1 merits further investigation as a potential compound for hyperpigmentation skin disorders. Additional research is necessary to delineate the molecular mechanisms underlying the melanogenesis-inhibitory effect of CBA analogs and examine their efficacy in diminishing melanogenesis in normal human melanocytes. [ABSTRACT FROM AUTHOR]

Background: Vitiligo is a complex disorder characterized by skin depigmentation; the canonical Wnt signaling pathway that involves β-catenin plays a crucial role in promoting the melanin production in melanocytes. Targeted inhibition of the Janus kinase JAK-STAT pathway can effectively diminish the secretion of the chemokine C-X-C motif ligand CXCL10, thereby safeguarding melanocytes. Ferula has been applied as a treatment regimen for a long period; however, its use for the treatment of vitiligo has not been previously documented. Methods: CCK-8 assay, Intracellular melanin content assay, Tyrosinase activity assay, Western blotting, qRT-PCR, and ELISA methods were employed. Using molecular docking verified the inhibitory effects of feshurin on the JAK1. Results: The sesquiterpene coumarin feshurin was separated from Ferula samarcandica. Feshurin was shown to induce GSK-3β phosphorylation, resulting in the translocation of β-catenin into the nucleus. This translocation subsequently upregulated the transcription of microphthalmia-associated transcription factor (MITF), leading to increased tyrosinase activity and melanin production. In addition, feshurin inhibited the production of chemokine CXCL10 via the JAK-STAT signaling pathway, which was verified by molecular docking. Conclusions: Based on these findings, it can be concluded that feshurin exhibits significant potential for the development of novel anti-vitiligo therapeutics. [ABSTRACT FROM AUTHOR]

Melanogenesis, essential for skin photoprotection and pigmentation, can lead to disorders like melasma and hyperpigmentation, which are challenging to treat and affect quality of life. Docosatrienoic acid (DTA), a polyunsaturated omega-3 fatty acid, has been identified as a potential regulator of skin aging. This study investigates DTA's effects on melanogenesis and its underlying molecular mechanisms using in silico and in vitro analyses. SwissSimilarity analysis revealed that DTA shares close structural similarities with known anti-melanogenic lipids, suggesting it may inhibit melanogenesis in similar manners. Our results demonstrated that DTA reduces melanin content and intracellular tyrosinase activity in B16F10 cells, significantly downregulating the mRNA expression of tyrosinase, TRP-1, and TRP-2 by inhibiting MITF translocation to the nucleus. While DTA exhibited mild inhibitory effects on mushroom tyrosinase activity and antioxidant properties at higher concentrations, direct inhibition of tyrosinase is likely not the primary mechanism, as the observed anti-melanogenic effects occurred at much lower concentrations compared to those required for direct tyrosinase inhibition. Together, DTA-mediated modulation of MITF and tyrosinase mRNA expression offers a novel approach to treating hyperpigmentation. DTA's potential extends into the cosmetic industry, enhancing product stability, functionality, and aesthetics. Further research is needed to explore DTA's broader applications in skincare and cosmetic formulations. [ABSTRACT FROM AUTHOR]

Tyrosinase, a key enzyme in melanin synthesis, represents a crucial therapeutic target for hyperpigmentation disorders due to excessive melanin production. This study aimed to design and evaluate a series of indole–thiourea derivatives by conjugating thiosemicarbazones with strong tyrosinase inhibitory activity to indole. Among these derivatives, compound 4b demonstrated tyrosinase inhibitory activity with an IC50 of 5.9 ± 2.47 μM, outperforming kojic acid (IC50 = 16.4 ± 3.53 μM). Kinetic studies using Lineweaver–Burk plots confirmed competitive inhibition by compound 4b. Its favorable ADMET and drug-likeness properties make compound 4b a promising therapeutic candidate with a reduced risk of toxicity. Molecular docking revealed that the compounds bind strongly to mushroom tyrosinase (mTYR) and human tyrosinase-related protein 1 (TYRP1), with compound 4b showing superior binding energies of −7.0 kcal/mol (mTYR) and −6.5 kcal/mol (TYRP1), surpassing both kojic acid and tropolone. Molecular dynamics simulations demonstrated the stability of the mTYR−4b complex with low RMSD and RMSF and consistent Rg and SASA values. Persistent strong hydrogen bonds with mTYR, along with favorable Gibbs free energy and MM/PBSA calculations (−19.37 kcal/mol), further support stable protein–ligand interactions. Overall, compound 4b demonstrated strong tyrosinase inhibition and favorable pharmacokinetics, highlighting its potential for treating pigmentary disorders. [ABSTRACT FROM AUTHOR]

Coreopsis tinctoria Nutt. is an important medicinal plant in traditional Uyghur medicine. The skin-lightening potential of the flower has been recognized recently; however, the active compounds responsible for that are not clear. In this work, tyrosinase, a target protein for regulating melanin synthesis, was immobilized on the Whatman paper for the first time to screen skin-lightening compounds present in the flower. Quercetagetin-7-O-glucoside (1), marein (2), and okanin (3) were found to be the enzyme inhibitors. The IC50 values of quercetagetin-7-O-glucoside (1) and okanin (3) were 79.06 ± 1.08 μM and 30.25 ± 1.11 μM, respectively, which is smaller than 100.21 ± 0.11 μM of the positive control kojic acid. Enzyme kinetic analysis and molecular docking were carried out to investigate their inhibition mechanism. Although marein (2) showed a weak inhibition effect in vitro, it inhibited the intracellular tyrosinase activity and diminished melanin production in melanoma B16 cells as did the other two inhibitors. The paper-based ligand fishing method developed in this work makes it effective to quickly screen tyrosinase inhibitors from natural products. This is the first report on the tyrosinase inhibitory effect of those three compounds, showing the promising potential of Coreopsis tinctoria for the development of herbal skin-lightening products. [ABSTRACT FROM AUTHOR]

Simple Summary: We performed a genome-wide selection sweep analysis on 50 domesticated yaks to investigate the genetic basis of coat color phenotypes. We identified numerous candidate genes (e.g., PLCB1, LEF1, and DTNBP1) that play key roles in melanin synthesis. Unique candidate genes for different coat color groups may explain the variations in coat color. Additionally, a range of selected genes associated with melanin and pigment deposition were identified within the ROH islands. This study provides a solid theoretical basis for understanding yak coat color. Although coat color is an important economic phenotype in domesticated yaks (Bos grunniens), its genetic basis is not yet fully understood. In this study, a genome-wide selective sweep and high-frequency runs of homozygosity (ROH) identification were performed on 50 yaks with different coat colors to investigate candidate genes (CDGs) related to coat color. The results suggested that 2263 CDGs were identified from the 5% interaction windows of the FST and θπ ratio, along with 2801 and 2834 CDGs from black and brown yaks with iHS, respectively. Furthermore, 648 and 691 CDGs from black and brown yaks, which were widely enriched in pathways related to melanogenesis, melanocyte differentiation, and melanosome organization via GO and KEGG functional enrichment, respectively, were confirmed on the basis of the intersection of three parameters. Additionally, the genome of brown yaks presented more ROH, longer ROH fragments, and higher inbreeding levels than those of black yaks. Specifically, a large number of genes related to melanin synthesis and regulation (e.g., UST, TCF25, and AHRR) from the ROH islands were confirmed to be under strong selection. In summary, the results of this study enhance the understanding of the genetic basis for determining yak coat color. [ABSTRACT FROM AUTHOR]

Background: Microencapsulation of hydroxypinacolone retinoate (HPR) can improve its application in cosmetics. Objective: To investigate the safety and efficacy of Spherulites Paeony Superior Retinol, a HPR microcapsule containing 5%–10% peony seed oil, 0.01%–1% epigallocatechin gallatyl glucoside (ECGG), and 0.1%–1% HPR. Methods: The safety of Spherulites Paenoy Superior Retinol was evaluated with zebrafish embryo self‐rotation irritation test and developmental toxicity test. SymRenew™ HPR was used as a reference. The skin care efficacies of Spherulites Paenoy Superior Retinol were evaluated using zebrafish embryos covering antioxidation, anti‐inflammation, blood circulation, whitening, wound healing, skin barrier protection, Type I collagen, elastin, and 5α‐reductase genes expression activities. Results: The irritation test revealed that 250 μg/mL Spherulites Paenoy Superior Retinol did not, while 20 μg/mL SymRenew™ HPR significantly (p < 0.05) increased zebrafish embryo self‐rotation frequency. The developmental toxicity test found the teratogenicity index (half lethal concentration/half toxicity concentration) of Spherulites Paenoy Superior Retinol and SymRenew™ HPR were 1.9 and 3.1, respectively. The efficacy analysis results showed that 5 μg/mL Spherulites Paenoy Superior Retinol significantly (p < 0.05) exerted 7.1% anti‐ROS, 20% anti‐inflammation, 14% enhanced blood circulation, 10% suppressed melanin synthesis, 9% enhanced tail fin regeneration, 72% elicited skin barrier protection activity, enhanced the expression of Type I collagen genes col1a1, col1a2, and col1a2 by 34%, 51%, and 42%, respectively, and elastin gene elna by 46%, and suppressed the expression of 5α‐reductase genes srd5a1, srd5a2a, and srd5a2b by 52%, 15%, and 30%, respectively. Conclusion: This study demonstrated that Spherulites Paenoy Superior Retinol is a safe cosmetic ingredient with multi‐skin care efficacies. [ABSTRACT FROM AUTHOR]

In felines, ocular and nonocular melanomas are uncommon tumors that represent a diagnostic challenge for pathologists, especially when amelanotic. To date, the immunohistochemical diagnostic panel in cats is based on specific melanocytic markers (Melan-A and PNL2) and a nonspecific but sensitive marker (S100). In human medicine, SOX-10 is reported to be a sensitive antibody for the detection of melanoma micrometastasis in the lymph node. TRP-1, an enzyme involved in melanogenesis, has recently been used in humans and dogs as a specific melanocyte marker. The aim of this study was to evaluate the cross-reactivity and the expression of SOX-10 and TRP-1 antibodies in feline normal tissue and melanocytic tumors. Thirty-one cases of ocular, cutaneous, and oral melanomas were retrospectively evaluated and confirmed by histopathological examination and by immunolabeling with Melan-A and/or PNL2. SOX-10 nuclear expression in normal tissues was localized in epidermal, subepidermal, hair bulb, and iridal stromal melanocytes and dermal nerves. In melanomas, nuclear expression of SOX-10 was detected in ocular (11/12; 92%), oral (6/7; 86%), and cutaneous sites (12/12; 100%). TRP-1 cytoplasmic immunolabeling in normal tissue was observed in epidermal and bulbar melanocytes and in the lining pigmented epithelium of the iris and in its stroma. Its expression was positively correlated to the degree of pigmentation in the tumor and was observed in 75% of ocular (9/12), 43% of oral (3/7), and 33% of cutaneous melanomas (4/12). This study demonstrated the cross-reactivity of SOX-10 and TRP-1 antibodies in feline non-neoplastic melanocytes and their expression in ocular and nonocular melanomas. [ABSTRACT FROM AUTHOR]

The primary function of the skin is to form a mechanical, permeability, antimicrobial, and ultraviolet radiation barrier, which is essential for maintaining physiological homeostasis. Our previous studies demonstrated that cutaneous pigmentation could promote skin barrier function in addition to providing anti‐ultraviolet irradiation defense. The present study aimed to develop a new regimen that enhances skin barrier function by regulating skin pigmentation using low‐concentration imiquimod. Results showed that topical application of low‐concentration imiquimod effectively induced skin hyperpigmentation in the dorsal skin and external ear of mice without inducing inflammatory cell infiltration. An in vitro study also revealed that low‐concentration imiquimod did not induce any cytotoxic effects on melanoma cells but triggered excessive melanin synthesis. In coculture systems, low‐concentration imiquimod was noted to increase tyrosinase activity in a broader cellular context, revealing the potential role of neighboring cells in melanin production. The next‐generation sequencing result indicated that PKCη and Dnm3 might regulate melanin synthesis and release during imiquimod treatment. Overall, our study presents new insights into the regulation of melanin production by low‐concentration imiquimod, both in a mice model and cultured cells. Furthermore, our study highlights the potential benefits of imiquimod in promoting melanin synthesis without causing skin disruptions or inducing inflammation, validating its potential to serve as a method for enhancing skin barrier functions by regulating the epidermal melanization reaction. [ABSTRACT FROM AUTHOR]

Abnormal melanin synthesis causes hyperpigmentation disorders, such as chloasma, freckles, and melanoma, which are highly multiple and prevalent. There were few reports on the anti-melanogenic effect of Curcuma wenyujin Y.H. Chen et C. Ling, and the bioactive compound has not been elucidated as well. The study aims to investigate the anti-melanogenic effect of C. wenyujin, and identify the bioactive compound, and further explore its underlying mechanism. Our results showed that the Petroleum ether fraction extracted from C. wenyujin rhizome had a significant anti-melanogenic effect, and germacrone isolated from it was confirmed as the major bioactive compound. To our data, germacrone significantly inhibited tyrosinase (TYR) activity, reduced melanosome synthesis, reduced dendrites formation of B16F10 cells, and melanosome transport to keratinocytes. Moreover, germacrone effectively decreased the hyperpigmentation in zebrafish and the skin of guinea pigs in vivo. Western-blot analysis showed that germacrone down-regulated the expression of TYR, TRP-1, TRP-2, Rab27a, Cdc42, and MITF proteins via the activation of the MAPK signaling pathway. Taken together, germacrone is an effective bioactive compound for melanogenesis inhibition. Our studies suggest that germacrone may be considered a potential candidate for skin whitening. [ABSTRACT FROM AUTHOR]

The article discusses the multifaceted aspects of oxidative stress in various tissues, particularly focusing on the skin. The skin is vulnerable to external triggers that increase the production of reactive oxygen species (ROS), leading to inflammatory and apoptotic pathways that can cause skin disorders. Impaired skin barriers, such as in atopic dermatitis, result in increased penetration of pathogens and allergens, activating the immune system. The article also explores the role of oxidative stress in wound healing, vitiligo, melasma, lupus nephritis, and liver diseases, highlighting the potential therapeutic use of antioxidants in these conditions. [Extracted from the article]

For thousands of years, pearl and nacre powders have been important traditional Chinese medicines known for their skin whitening effects. To prepare the enzymatic hydrolysates of Hyriopsis cumingii nacre powder (NP-HCH), complex enzymatic hydrolysis by pineapple protease and of neutral protease was carried out after the powder was pre-treated with a high-temperature and high-pressure method. The peptides were identified using LC-MS/MS and picked out through molecular docking and molecular dynamics simulations. Subsequently, the tyrosinase inhibitory and antioxidant properties of novel tyrosinase inhibitory peptides were investigated in vitro. In addition, the enzymatic activity of tyrosinase in B16F10 cells as well as melanin content and antioxidant enzyme levels were also examined. The results showed that a tyosinase inhibitory peptide (Tyr-Pro-Asn-Pro-Tyr, YPNPY) with an efficient IC50 value of 0.545 ± 0.028 mM was identified. The in vitro interaction results showed that YPNPY is a reversible competitive inhibitor of tyrosinase, suggesting that it binds to the free enzyme. The B16F10 cell whitening test revealed that YPNPY can reduce the melanin content of B16F10 cells by directly inhibiting the activity of intracellular tyrosinase. Additionally, it indirectly affects melanin production by acting as an antioxidant. These results suggest that YPNPY could be widely used as a tyrosinase inhibitor in whitening foods and drugs. [ABSTRACT FROM AUTHOR]

Tyrosinase is a binuclear copper-containing enzyme that catalyzes the conversation of monophenols to diphenols via o-hydroxylation and then the oxidation of o-diphenols to o-quinones which is profoundly linked to eukaryotic melanin synthesis and fruits browning. The hyperpigmentation due to unusual tyrosinase activity has gained growing health concern. Plants and their metabolites are considered promising and effective sources for potent antityrosinase enzymes. Hence, searching for potent, specific tyrosinase inhibitor from different plant extracts is an alternative approach in regulating overproduction of tyrosinase. Among the tested extracts, the hydro-alcoholic extract of Moringa oleifera L. leaves displayed the potent anti-tyrosinase activity (IC50 = 98.93 µg/ml) in a dose-dependent manner using L-DOPA as substrate; however, the kojic acid showed IC50 of 88.92 µg/ml. The tyrosinase-diphenolase (TYR-Di) kinetic analysis revealed mixed inhibition type for the Ocimum basilicum L. and Artemisia annua L. extracts, while the Coriandrum sativum L. extract displayed a non-competitive type of inhibition. Interestingly, the extract of Moringa oleifera L. leaves exhibited a competitive inhibition, low inhibition constant of free enzyme ( K ii app ) value and no Pan-Assay Interfering Substances, hinting the presence of strong potent inhibitors. The major putative antityrosinase compound in the extract was resolved, and chemically identified as rutin based on various spectroscopic analyses using UV–Vis, FTIR, mass spectrometry, and 1H NMR. The in silico computational molecular docking has been performed using rutin and A. bisporus tyrosinase (PDB code: 2Y9X). The binding energy of the predicted interaction between tropolone native ligand, kojic acid, and rutin against 2Y9X was respectively − 5.28, − 4.69, and − 7.75 kcal/mol. The docking simulation results revealed the reliable binding of rutin to the amino acid residues (ASN260, HIS259, SER282) in the tyrosinase catalytic site. Based on the developed results, rutin extracted from M. oleifera L. leaves has the capability to be powerful anti-pigment agent with a potential application in cosmeceutical area. In vivo studies are required to unravel the safety and efficiency of rutin as antityrosinase compound. [ABSTRACT FROM AUTHOR]

Neuromelanin-pigmented neurons of the substantia nigra are selectively lost during the progression of Parkinson's disease. These neurons accumulate iron in the disease state, and iron-mediated neuron damage is implicated in cell death. Animal models of Parkinson's have evidenced iron loading inside the nucleoli of nigral neurons, however the nature of intranuclear iron deposition in the melanised neurons of the human substantia nigra is not understood. Here, scanning transmission x-ray microscopy (STXM) is used to probe iron foci in relation to the surrounding ultrastructure in melanised neurons of human substantia nigra from a confirmed Parkinson's case. In addition to the expected neuromelanin-bound iron, iron deposits are also associated with the edge of the cell nucleolus. Speciation analysis confirms these deposits to be ferric (Fe3+) iron. The function of intranuclear iron in these cells remains unresolved, although both damaging and protective mechanisms are considered. This finding shows that STXM is a powerful label-free tool for the in situ, nanoscale chemical characterisation of both organic and inorganic intracellular components. Future applications are likely to shed new light on incompletely understood biochemical mechanisms, such as metal dysregulation and morphological changes to cell nucleoli, that are important in understanding the pathogenesis of Parkinson's. Showcasing the application of scanning transmission x-ray microscopy to study the oxidation state of intranuclear iron in nigral neurons. Implications and potential future applications are discussed. [ABSTRACT FROM AUTHOR]

Visual observation and therapeutic intervention against tumors hold significant appeal for tumor treatment, particularly in meeting the demands of intraoperative navigation. From a clinical perspective, the naked‐eye visualization of tumors provides a direct and convenient approach to identifying tumors and navigating during surgery. Nevertheless, there is an ongoing need to develop effective solutions in this frontier. Genetically engineered microorganisms are promising as living therapeutics for combatting malignant tumors, leveraging precise tumor targeting and versatile programmed functionalities. Here, genetically modified Escherichia coli (E. coli) MG1655 bacterial cells are introduced, called MelaBac cells, designed to express tyrosinase continuously. This bioengineered melanogenesis produces melanin capable of pigmenting both subcutaneous CT26 xenografts and chemically induced colorectal cancer (CRC). Additionally, MelaBac cells demonstrate the initiation of photonic hyperthermia therapy and immunotherapy against tumors, offering promising selective therapeutic interventions with high biocompatibility. [ABSTRACT FROM AUTHOR]

Ganoderma lucidum, a member of the Basidiomycetes family, is attracting attention for its medicinal potential due to its biological activity and the presence of numerous bioactive compounds. Although it is known that extracts of this mushroom inhibit melanin production, there are few reports on a single substance associated with this effect. In this study, we identified ganodermanontriol (GT), a novel compound from G. lucidum, that effectively inhibited melanin biosynthesis in B16F10 cells. GT inhibits melanin production by suppressing the expression of cellular tyrosinase proteins and microphthalmia-related transcription factor (MITF). Furthermore, GT affects the phosphorylation of cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB) and mitogen-activated protein kinase (MAPK) signaling molecules, which are involved in melanogenesis in B16F10 cells. Finally, the biosynthesis of GT and other substances by G. lucidum was evaluated using HPLC analysis. Thus, this study revealed the mechanism by which GT in G. lucidum inhibits melanin production in B16F10 cells, and these findings will contribute to promoting the potential use of this mushroom in the future. [ABSTRACT FROM AUTHOR]

Quasipaa spinosa, commonly known as the spiny frog, is an economically valued amphibian in China prized for its tender meat and nutritional value. This species exhibits marked sexual dimorphism, most notably the prominent spiny structures on males that are pivotal for mating success and species identification. The spines of Q. spinosa exhibit strong seasonal variation, changing significantly with the reproductive cycle, which typically spans from April to October. Sexually mature males develop densely packed, irregularly arranged round papillae with black spines on their chests during the breeding season, which may then reduce or disappear afterward, while females have smooth chest skin. Despite their ecological importance, the developmental mechanisms and biological functions of these spines have been inadequately explored. This study integrates morphological, transcriptomic, and metabolomic analyses to elucidate the mechanisms underlying the seasonal variation in spine characteristics of Q. spinosa. Our results demonstrate that spine density inversely correlates with body size and that spine development is accompanied by significant changes in epidermal thickness and keratinization during the breeding season. Comparative transcriptomic analysis across different breeding stages revealed significant gene expression alterations in pathways related to extracellular matrix interactions, tyrosine metabolism, Wnt signaling, and melanogenesis. Metabolomic analysis further identified significant seasonal shifts in metabolites essential for energy metabolism and melanin synthesis, including notable increases in citric acid and β-alanine. These molecular changes are consistent with the observed morphological adaptations, suggesting a complex regulatory mechanism supporting spine development and functionality. This study provides novel insights into the molecular basis of spine morphogenesis and its seasonal dynamics in Q. spinosa, contributing valuable information for the species' conservation and aquaculture. [ABSTRACT FROM AUTHOR]

Objective Methods Results Conclusion Hydrolyzed conchiolin protein (HCP) derived from pearl and nacre extracts exerts skin‐lightening effects; however, the underlying molecular mechanisms are not fully understood. Herein, we investigated the effect of HCP on melanogenesis and the signalling pathways involved.B16F10 cells and PIG cells were treated with HCP to verify its ability to inhibit melanin. Western Blot, immunofluorescence, and flow cytometry methods were performed to investigate the effect of HCP on melanogenesis signalling pathway proteins. The inhibitors were used to further validate the effect of HCP on PKA/CREB and MEK/ERK signalling pathways. To further evaluate the whitening ability of HCP, changes in melanin were detected using 3D melanin skin model and zebrafish model.HCP was found to significantly inhibit melanin synthesis and decrease the expression of melanogenesis‐related proteins, such as microphthalmia‐associated transcription factor (MITF), tyrosinase, and tyrosinase‐related protein‐2, in a dose‐dependent manner. Additionally, we revealed that HCP suppresses melanogenesis via the regulation of the PKA/cAMP response element‐binding (CREB) and MEK/extracellular signalling‐regulated kinase (ERK) signalling pathways. Using 3D melanin skin models, we demonstrated that HCP can achieve skin‐lightening effects by improving apparent chroma, increasing apparent brightness, and inhibiting melanin synthesis. Furthermore, HCP exhibits skin‐whitening effects in a zebrafish model.These results suggest that HCP suppresses the melanogenesis signalling cascade by inhibiting the PKA/CREB, MEK/ERK signalling pathway and downregulating MITF and its downstream signalling pathways, resulting in decreased melanin synthesis. In summary, HCP is a potential anti‐pigmentation agent with promising applications in cosmetics and pharmaceutical products. [ABSTRACT FROM AUTHOR]

Melanin naturally exists in organisms and is synthetized by tyrosinase (TYR); however, its over-production may lead to aberrant pigmentation and skin conditions. Loquat (Eriobotrya japonica (Thunb.) Lindl.) flowers contain a variety of bioactive compounds, while studies on their suppressive capabilities against melanin synthesis are limited. Loquat flower isolate product (LFP) was obtained by ethanol extraction and resin purification, and its inhibitory efficiency against TYR activity was investigated by enzyme kinetics and multiple spectroscopy analyses. In addition, the impact of LFP on melanin synthesis-related proteins' expression in mouse melanoma B16 cells was analyzed using Western blotting. HPLC-MS/MS analysis indicated that LFP was composed of 137 compounds, of which 12 compounds, including flavonoids (quercetin, isorhamnoin, p-coumaric acid, etc.) and cinnamic acid and its derivatives, as well as benzene and its derivatives, might have TYR inhibitory activities. LFP inhibited TYR activity in a concentration-dependent manner with its IC50 value being 2.8 mg/mL. The inhibition was an anti-competitive one through altering the enzyme's conformation rather than chelating copper ions at the active center. LFP reduced the expression of TYR, tyrosinase-related protein (TRP) 1, and TRP2 in melanoma B16 cells, hence inhibiting the synthesis of melanin. The research suggested that LFP had the potential to reduce the risks of hyperpigmentation caused by tyrosinase and provided a foundation for the utilization of loquat flower as a natural resource in the development of beauty and aging-related functional products. [ABSTRACT FROM AUTHOR]

Aralia elata (Miq.) Seem. (AES; family Araliaceae) is a medicinal plant and has been reported to have various bioactivities, including anticancer and hepatotoxicity protective activities. However, no studies have investigated the biological activities of AES or its extracts on skin. To address this, we aimed to explore the effect of AES-flower-derived absolute-type essential oil (AESFEO) on skin-related biological activities, especially skin wound healing and whitening-related responses in skin cells (human-derived keratinocytes [HaCaT cells] and melanocytes [B16BL6 cells]) and to identify the components of AESFEO. Cell biological activities were analyzed using WST and BrdU incorporation assays, ELISA, or by immunoblotting. In HaCaT cells, AESFEO promoted proliferation, type IV collagen production, and enhanced the phosphorylations of Erk1/2, p38 MAPK, JNK, and Akt. In B16BL6 cells, AESFEO reduced serum-induced proliferation, α-MSH-stimulated increases in melanin synthesis and tyrosinase activity, and α-MSH-induced increases in MITF, tyrosinase, TRP-1, and TRP-2 expressions. In addition, AESFEO inhibited the phosphorylation of Erk1/2, p38 MAPK, and JNK in α-MSH-stimulated B16BL6 cells. Eighteen compounds were identified in AESFEO by GC/MS. These results suggest that AESFEO has beneficial effects on keratinocyte activities related to skin wound healing and melanocyte activities related to inhibition of skin pigmentation. AESFEO may serve as a useful natural substance for developing agents that facilitate skin wound healing and inhibit melanogenesis. [ABSTRACT FROM AUTHOR]

Few reports have confirmed whether exosomes derived from fibroblasts can regulate the process of melanogenesis. We wondered whether exosomes derived from fibroblasts could have a potent regulatory effect on melanogenesis and explored the underlying mechanisms. This study aimed to find the role of fibroblasts in melanocytes and revealed the related mechanisms. RT-qPCR, Western blot analysis were conducted to measure the RNA and protein expression level of various related genes. miRNA sequencing, mass spectrum analysis and subsequent bioinformatics analysis were employed to find the underlying targets. Zebrafish were employed to measure the melanin synthesis related process in vivo. Furthermore, electron microscopy, ROS measurement and dual-luciferase reporter assay were adopted to investigate the relationship between these processes. We found that exosomes derived from human primary dermal fibroblasts were internalized by human primary melanocytes and MNT1 cells and that the melanin content and the expression of melanin synthesis-related proteins TYR and MITF was inhibited by exosomes derived from UVB-induced human primary dermal fibroblasts. The miRNA expression profile in secreted exosomes changed significantly, with miR-25–5p identified as capable of regulating TSC2 expression via the CDS region. The miR-25–5p-TSC2 axis could affect the melanin content through subsequent cellular organelle dysfunction, such as mitochondrial dysfunction, endoplasmic reticulum stress and dysregulation of lysosomal cysteine proteases. We unveiled a novel regulatory role of fibroblasts in melanocytes, facilitated by the secretion of exosomes. miR-25–5p within exosomes plays a pivotal role in regulating melanogenesis via TSC2-induced cellular organelle dysfunction. • A new regulatory role of fibroblasts in melanocytes was revealed and this process was achieved by the secretion of exosomes. • miR-25–5p in exosomes plays a role in regulating melanogenesis. • TSC2-induced cellular organelle dysfunction could affect the process of melanogenesis. [ABSTRACT FROM AUTHOR]

Domestic animals have multiple phenotypes of skin and coat color, which arise from different genes and their products, such as proteins and metabolites responsible with melanin deposition. However, the complex regulatory network of melanin synthesis remains to be fully unraveled. Here, the skin and tongue tissues of Liangshan black sheep (black group) and Liangshan semi-fine-wool sheep (pink group) were collected, stained with hematoxylin–eosin (HE) and Masson–Fontana, and the transcriptomic and metabolomic data were further analyzed. We found a large deposit of melanin granules in the epidermis of the black skin and tongue. Transcriptome and metabolome analysis identified 744 differentially expressed genes (DEGs) and 443 differentially expressed metabolites (DEMs) between the pink and black groups. Gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) enrichment analyses revealed the DEGs and DEMs were mainly enriched in the pathways of secondary metabolic processes, melanin biosynthesis processes, melanin metabolism processes, melanosome membranes, pigment granule membranes, melanosome, tyrosine metabolism, and melanogenesis. Notably, we revealed the gene ENSARG00020006042 may be a family member of YWHAs and involved in regulating melanin deposition. Furthermore, several essential genes (TYR, TYRP1, DCT, PMEL, MLANA, SLC45A2) were significantly associated with metabolite prostaglandins and compounds involved in sheep pigmentation. These findings provide new evidence of the strong correlation between prostaglandins and related compounds and key genes that regulate sheep melanin synthesis, furthering our understanding of the regulatory mechanisms and molecular breeding of pigmentation in sheep. [ABSTRACT FROM AUTHOR]

Melanosomes are specialized membrane-bound organelles where melanin is synthesized and stored. The levels of melanin can be effectively reduced by inhibiting melanin synthesis or promoting melanosome degradation via autophagy. Ceramide, a key component in the metabolism of sphingolipids, is crucial for preserving the skin barrier, keeping it hydrated, and warding off the signs of aging. Our preliminary study indicated that a long-chain C22-ceramide compound (Ehux-C22) isolated from the marine microalga Emiliania huxleyi, reduced melanin levels via melanosomal autophagy in B16 cells. Recently, microRNAs (miRNAs) were shown to act as melanogenesis-regulating molecules in melanocytes. However, whether the ceramide Ehux-C22 can induce melanosome autophagy at the post-transcriptional level, and which potential autophagy-dependent mechanisms are involved, remains unknown. Here, miR-199a-3p was screened and identified as a novel upregulated miRNA in Ehux-C22-treated B16 cells. An in vitro high melanin expression model in cultured mouse melanoma cells (B16 cells) was established by using 0.2 μM alpha-melanocyte-stimulating hormone(α-MSH) and used for subsequent analyses. miR-199a-3p overexpression significantly enhanced melanin degradation, as indicated by a reduction in the melanin level and an increase in melanosome autophagy. Further investigation demonstrated that in B16 cells, Ehux-C22 activated miR-199a-3p and inhibited mammalian target of rapamycin(mTOR) level, thus activating the mTOR-ULK1 signaling pathway by promoting the expression of unc-51-like autophagy activating kinase 1 (ULK1), B-cell lymphoma-2 (Bcl-2), Beclin-1, autophagy-related gene 5 (ATG5), and microtubule-associated protein light chain 3 (LC3-II) and degrading p62. Therefore, the roles of Ehux-C22-regulated miR-199a-3p and the mTOR pathway in melanosomal autophagy were elucidated. This research may provide novel perspectives on the post-translational regulation of melanin metabolism, which involves the coordinated control of melanosomes. [ABSTRACT FROM AUTHOR]

Phenylalanine is a crucial amino acid in the process of melanogenesis. However, the exact mechanism by which it is transported into melanocytes has not been disclosed. The aim of this study was to identify and examine the key transporters that are responsible for phenylalanine transportation and evaluate their significance in melanogenesis. The amino acid transporter SLC16A10 was found to be up‐regulated in both melasma (GSE72140) and sun‐exposed skin (GSE67098). The protein levels of SLC16A10 were proportional to the melanin content in melanocytic nevi, indicating that SLC16A10 was related to melanogenesis. After SLC16A10 overexpression, melanin increased significantly in MNT1 cells. Meanwhile, the expression of melanogenesis‐related proteins such as TYR and TYRP1 increased, while their RNA levels did not change. Transcriptomics data indicated that SLC16A10 can enhance the function of ribosome. Furthermore, targeted metabolomics data and ELISA results demonstrated SLC16A10 mainly affected the transport of phenylalanine into the cells. Then, phenylalanine was added to the cell culture medium after SLC16A10 overexpression, melanin synthesis in cells furtherly increased, which verified that SLC16A10 enhances melanogenesis by promoting the uptake of phenylalanine. Finally, we found that SLC16A10 expression increased after UVB irradiation. Knockdown SLC16A10 reduced UVB‐induced melanin production and phenylalanine uptake by cells. In summary, SLC16A10 enhances melanogenesis by promoting the uptake of phenylalanine, and upregulation SLC16A10 is likely responsible for the UVB‐induced hyperpigmentation as well. [ABSTRACT FROM AUTHOR]

1. Melanin distribution typically exhibits a gradient dilution along the dorsal-ventral axis of the body, including in domestic geese. However, the specific genes and molecular mechanisms responsible for this melanin distribution pattern remain incompletely understood. 2. The transcriptomic comparisons were conducted at three embryonic stages, specifically on embryonic d 15 (E15), 22 (E22), and 29 (E29), between the pigmented dorsal skin and the depigmented distal foot. 3. Differentially expressed genes (DEGs) associated with melanin synthesis were identified, particularly TYR, TYRP1, and EDNRB2, which exhibited significantly higher expression levels in the dorsal skin at E15 and E22. However, expression levels significantly decreased in later stages (E29). 4. The ASIP gene showed remarkably high-expression levels in the distal feet compared to the dorsal skin post-E22 stage (log2FC: 5.31/6.88 at E22/E29). Gene Ontology (GO) enrichment analysis detected eight terms associated with melanin synthesis and melanosome formation (p < 0.05), including melanosome membrane (GO: 0033162) and melanin biosynthetic process (GO: 0042438). Additionally, KEGG pathway analysis showed significant enrichment of the melanogenesis pathway (hsa004916) at d 22 (E22). [ABSTRACT FROM AUTHOR]

Introduction: Vitiligo is an acquired skin pigmentation disorder, the cause of which is poorly understood. Researchers in this field are dedicated to exploring novel treatments for achieving re-pigmentation. Methods: Mice were randomly selected and divided into control, model, and model+laser groups. Evaluate the impact of different levels of carbon dioxide laser irradiation on tyrosinase activity, melanocyte viability, and melanin content. Results: In this study, it was found that the cell viability and melanin content were significantly enhanced in human melanocytes after treatment with different energy densities of fractional carbon dioxide laser. In addition, laser-treated vitiligo mouse models showed mild pathological changes. Discussion: Therefore, we believe that fractional carbon dioxide laser may be a potential adjunctive modality for treating vitiligo. [ABSTRACT FROM AUTHOR]

Pearl and nacre powders have been valuable traditional Chinese medicines with whitening properties for thousands of years. We utilized a high-temperature and high-pressure method along with compound enzyme digestion to prepare the enzymatic hydrolysates of nacre powder of Pinctada martensii (NP-PMH). The peptides were identified using LC–MS/MS and screened through molecular docking and molecular dynamics simulations. The interactions between peptides and tyrosinase were elucidated through enzyme kinetics, circular dichroism spectropolarimetry, and isothermal titration calorimetry. Additionally, their inhibitory effects on B16F10 cells were explored. The results showed that a tyrosinase-inhibitory peptide (Ala-His-Tyr-Tyr-Asp, AHYYD) was identified, which inhibited tyrosinase with an IC50 value of 2.012 ± 0.088 mM. The results of the in vitro interactions showed that AHYYD exhibited a mixed-type inhibition of tyrosinase and also led to a more compact enzyme structure. The binding reactions of AHYYD with tyrosinase were spontaneous, leading to the formation of a new set of binding sites on the tyrosinase. The B16F10 cell-whitening assay revealed that AHYYD could reduce the melanin content of the cells by directly inhibiting the activity of intracellular tyrosinase. Additionally, it indirectly affects melanin production by acting as an antioxidant. These results suggest that AHYYD could be widely used as a tyrosinase inhibitor in whitening foods and pharmaceuticals. [ABSTRACT FROM AUTHOR]

Abstract Excessive activity of the tyrosinase enzyme during melanogenesis results in hyperpigmentation in the skin. To address this issue, there is a need to develop effective tyrosinase inhibitors as a treatment for hyperpigmentation. In this study, we synthesized some novel 4H-chromene-3-carbonitrile compounds (6a-o) and assessed their inhibitory activities against tyrosinase, comparing them with kojic acid, which is known as a positive control. Compound 6f emerged as the most effective inhibitor, with an IC50 of 35.38 ± 2.12 µM. Kinetic studies of 6f exhibited competitive inhibition, with K i = 16.15 µM. Molecular docking studies highlighted the importance of π-π stacking and hydrogen bonding interactions within the binding site. Molecular dynamics simulations showed that the R-enantiomer 6f exhibited superior binding stability compared to the S-enantiomer, with a lower standard deviation of RMSD and more persistent interactions with the key active site residues. These findings underscore the potential of the R-enantiomer of compound 6f as a potent tyrosinase inhibitor and provide insights for developing effective treatments for hyperpigmentation and related skin conditions.

In our previous study, we documented the anti-melanogenic efficacy of calebin-A (CBA), which is a curcuminoid analog. The effects of its newly synthesized analogs, i.e., bisdemethoxy calebin (BD), demethoxycalebin-1 (DA1), demethoxycalebin-2 (DA2), and tetrahydrocalebin-A (THCBA), on melanogenesis have not been examined yet. Herein, we evaluated these four CBA analogs to determine their impacts on the enzymatic activity of mushroom tyrosinase. Additionally, we examined their effects on melanogenesis and the tyrosinase activity in B16F10 mouse and MNT-1 human melanoma cells. The antioxidant activity of the analogs was also assessed. Our results revealed that BD was ineffective, while DA1 and DA2 showed similar antioxidant activities, with THCBA exhibiting the greatest antioxidant activity. Next, the diphenolase activity assay results revealed that DA1 showed the most excellent inhibitory efficacy, DA2 and BD showed similar inhibition profiles, and THCBA was ineffective. In addition, the results of the monophenolase activity showed a similar pattern, except that THCBA suppressed the activity. The four analogs were evaluated for any cytotoxicity over a 48 h duration in B16F10 and HaCaT keratinocytes, where DA1 exerted cytotoxicity at the concentration of 50 µM. Based on this, the analogs were evaluated over a 10–50 µM concentration range, while DA1 was evaluated over 10–35 µM. BD showed the greatest efficacy at multiple concentrations in significantly diminishing melanogenesis in hormone-stimulated B16F10 cells, while DA1 and DA2 suppressed melanin at 35 and 50 µM, respectively, and THCBA stimulated melanogenesis at 50 µM. In addition, BD and DA1 suppressed tyrosinase activity in B16F10 cells, with no effect in the case of DA2 and THCBA analogs. However, in MNT-1 cells, only DA1 showed efficacy in suppressing melanin production while the other three analogs were ineffective. Interestingly, BD and DA1 suppressed MNT-1 cell tyrosinase activity. Collectively, our results indicate that of the four analogs, DA1 merits further investigation as a potential compound for hyperpigmentation skin disorders. Additional research is necessary to delineate the molecular mechanisms underlying the melanogenesis-inhibitory effect of CBA analogs and examine their efficacy in diminishing melanogenesis in normal human melanocytes.

Background: Sophora flavescens, a traditional Chinese medicine for treating conditions associated with abnormal skin pigmentation, contains flavonoids with inhibitory effects on tyrosinase. However, their mechanisms of action and their modulatory effects on melanogenesis remain unclear. Methods: Herein, a group of prenylated flavonoids was identified from S. flavescens extracts and their inhibitory activities on mushroom tyrosinase were evaluated. The anti-melanogenesis effects of these prenylated flavonoids were investigated in cellular (with murine melanoma cells) and animal (with zebrafish) models. Results: Prenylated flavonoids including isoanhydroicaritin (IAI), kurarinone (KR), and sophoraflavanone G (SG) were the major active constituents in S. flavescens extracts with anti-tyrosinase activity (IC50 = 0.7, 7.1, and 6.7 µM, respectively). Enzyme kinetic assays showed that IAI, KR, and SG had a mixed type of tyrosinase inhibition, supported by data from computational docking. Notably, KR at concentrations of 5 and 10 µM enhanced intracellular tyrosinase activity and stimulated melanin production in B16F10 cells, whereas SG and IAI did not exhibit significant activity. Further studies with the zebrafish model showed that IAI (80 and 160 µM) inhibited melanin biosynthesis by about 30.0% while KR (20 µM) stimulated melanogenesis by 36.9%. Furthermore, a zebrafish depigmentation model supported the anti-melanogenesis effect of IAI (80 and 160 µM) by 33.0% and 34.4%, respectively. Conclusion: In summary, IAI was identified as a tyrosinase inhibitor with an antimelanogenic effect and KR was an enhancer for melanin production in B16F10 cells and zebrafish. Findings from the current study suggest that IAI and KR from S. flavescens may exert contrasting effects in the modulation of melanin production, providing important insights into the development of S. flavescens as a cosmeceutical or medicinal ingredient. [ABSTRACT FROM AUTHOR]

A common goal in evolutionary biology is to discern the mechanisms that produce the astounding diversity of morphologies seen across the tree of life. Aposematic species, those with a conspicuous phenotype coupled with some form of defence, are excellent models to understand the link between vivid colour pattern variations, the natural selection shaping it, and the underlying genetic mechanisms underpinning this variation. Mimicry systems in which species share a conspicuous phenotype can provide an even better model for understanding the mechanisms of colour production in aposematic species, especially if comimics have divergent evolutionary histories. Here we investigate the genetic mechanisms by which mimicry is produced in poison frogs. We assembled a 6.02‐Gbp genome with a contig N50 of 310 Kbp, a scaffold N50 of 390 Kbp and 85% of expected tetrapod genes. We leveraged this genome to conduct gene expression analyses throughout development of four colour morphs of Ranitomeya imitator and two colour morphs from both R. fantastica and R. variabilis which R. imitator mimics. We identified a large number of pigmentation and patterning genes differentially expressed throughout development, many of them related to melanophores/melanin, iridophore development and guanine synthesis. We also identify the pteridine synthesis pathway (including genes such as qdpr and xdh) as a key driver of the variation in colour between morphs of these species, and identify several plausible candidates for colouration in vertebrates (e.g. cd36, ep‐cadherin and perlwapin). Finally, we hypothesise that keratin genes (e.g. krt8) are important for producing different structural colours within these frogs. [ABSTRACT FROM AUTHOR]

Arbutin and 6′-O-caffeoylarbutin (CA) from Vaccinium dunalianum Wight are known for their ability to inhibit melanin synthesis. To boost the production of arbutin and CA, precursor feeding with hydroquinone (HQ) was studied in V. dunalianum suspension cells. The effect of HQ on the biosynthesis of arbutin and CA in the suspension cells was investigated using high-performance liquid chromatography (HPLC), and possible molecular mechanisms were analyzed using metabolomics and transcriptomics analyses. HPLC analysis only showed that the addition of HQ significantly enhanced arbutin synthesis in cells, peaking at 15.52 ± 0.28 mg·g−1 after 0.5 mmol·L−1 HQ treatment for 12 h. Subsequently, metabolomics identified 78 differential expression metabolites (DEMs), of which arbutin and CA were significantly up-regulated metabolites. Moreover, transcriptomics found a total of 10,628 differential expression genes (DEGs). The integrated transcriptomics and metabolomics revealed that HQ significantly enhanced the expression of two arbutin synthase (AS) genes (Unigene0063512 and Unigene0063513), boosting arbutin synthesis. Additionally, it is speculated that CA was generated from arbutin and 3,4,5-tricaffeoylquinic acid catalyzed by caffeoyl transferase, with Unigene0044545, Unigene0043539, and Unigene0017356 as potentially associated genes with CA synthesis. These findings indicate that the precursor feeding strategy offers a promising approach for the mass production of arbutin and CA in V. dunalianum suspension cells and provides new insights for CA biosynthesis in V. dunalianum. [ABSTRACT FROM AUTHOR]

Colour signals play pivotal roles in different communication systems, and the evolution of these characters has been associated with behavioural ecology, integumentary production processes and perceptual mechanisms of the species involved. Here, we present the first insight into the molecular and histological basis of skin colour polymorphism within a miniaturized species of pumpkin toadlet, potentially representing the lowest size threshold for colour polytypism in tetrapods. Brachycephalus actaeus exhibits a coloration ranging from cryptic green to conspicuous orange skin, and our findings suggest that colour morphs differ in their capability to be detected by potential predators. We also found that the distribution and abundance of chromatophores are variable in the different colour morphs. The expression pattern of coloration related genes was predominantly associated with melanin synthesis (including dct, edn1, mlana, oca2, pmel, slc24a5, tyrp1 and wnt9a). Up‐regulation of melanin genes in grey, green and brown skin was associated with higher melanophore abundance than in orange skin, where xanthophores predominate. Our findings provide a significant foundation for comparing and understanding the diverse pathways that contribute to the evolution of pigment production in the skin of amphibians. [ABSTRACT FROM AUTHOR]

Melanogenesis‐stimulated B16‐F10 cells enter in a quiescent state, present inhibited mitochondrial respiration and increased reactive oxygen species levels. These alterations suggest that these cells may be under redox signaling, allowing tumor survival. The aim of this study was to evaluate redox‐modified proteins in B16‐F10 cells after melanogenesis stimulation and rose bengal‐photodynamic therapy (RB‐PDT). A redox proteomics label‐free approach based on the biotin switch assay technique with biotin‐HPDP and N‐ethylmaleimide was used to assess the thiol‐oxidized protein profile. Aconitase was oxidized at Cys‐448 and Cys‐451, citrate synthase was oxidized at Cys‐202 and aspartate aminotransferase (Got2) was oxidized at Cys‐272 and Cys‐274, exclusively after melanogenesis stimulation. After RB‐PDT, only guanine nucleotide‐binding protein subunit beta‐2‐like 1 (Gnb2l1) was oxidized (Cys‐168). In contrast, melanogenesis stimulation followed by RB‐PDT led to the oxidation of different cysteines in Gnb2l1 (Cys‐153 and Cys‐249). Besides that, glyceraldehyde‐3‐phosphate dehydrogenase (Gapdh) presented oxidation at Cys‐245, peptidyl‐prolyl cis‐trans isomerase A (Ppia) was oxidized at Cys‐161 and 5,6‐dihydroxyindole‐2‐carboxylic acid oxidase (Tyrp1) was oxidized at Cys‐65, Cys‐30, and Cys‐336 after melanogenesis stimulation followed by RB‐PDT. The redox alterations observed in murine melanoma cells and identification of possible target proteins are of great importance to further understand tumor resistance mechanisms. [ABSTRACT FROM AUTHOR]

Background: Neither a TYRP1-mediated highly conserved genetic network underlying skin color towards optimum defense nor the pathological tendency of its mutation is well understood. The Oujiang Color Common Carp (Cyprinus carpio var. color) as a model organism, offering valuable insights into genetics, coloration, aquaculture practices, and environmental health. Here, we performed a comparative skin transcriptome analysis on TYRP1 mutant and wild fishes by applying a conservative categorical approach considering different color phenotypes. Results: Our results reveal that an unusual color phenotype may be sensitized with TYRP1 mutation as a result of upregulating several genes related to an anti-inflammatory autoimmune system in response to the COMT-mediated catecholamine neurotransmitters in the skin. Particularly, catecholamines-derived red/brown, red with blue colored membrane attack complex, and brown/grey colored reduced eumelanin are expected to be aggregated in the regenerated cells. Conclusions: It is, thus, concluded that the regenerated cells with catecholamines, membrane attack complex, and eumelanin altogether may contribute to the formation of the unusual (coffee-like) color phenotype in TYRP1 mutant. [ABSTRACT FROM AUTHOR]

Aims: Vitiligo is a chronic dermatological condition characterized by the progressive loss of melanocytes, for which traditional therapy has shown limited efficacy. This study aimed to establish a vitiligo model with easy operability, high repeatability, and stable depigmentation to provide a foundation for studying the pathogenesis and developing novel therapies for vitiligo. Methods: (1) Establishing vitiligo model: Firstly, deliver B16F10 cells to the back skin of C57BL/6 J via intradermal injection (day 0), and the CD4 depletion antibody was injected intraperitoneally on day 4 and 10. Secondly, the melanoma was surgically removed on day 12. Thirdly, CD8 antibody was administered intraperitoneally every fourth day till day 30. (2) Identification of vitiligo model: H&E staining, immunohistochemistry, and immunofluorescence were used to detect the melanocytes. The melanin was detected by transmission electron microscopy (TEM), Lillie ferrous sulfate staining and L-DOPA staining. Results: (1) The back skin and hair began to appear white on day 30. Melanin loss reached peak on day 60; (2) Hematoxylin and eosin (H&E) staining, immunohistochemistry and immunofluorescence results showed melanocytes were reduced. L-DOPA staining, Lillie ferrous sulfate staining and TEM results showed that melanin decreased in the epidermis. Conclusion: We successfully establishment a vitiligo mouse model which can be more capable to simulate the pathogenesis of human vitiligo and provide an important basis for the study of pathogenesis and therapy of vitiligo. [ABSTRACT FROM AUTHOR]