Search

Helictotrichon sempervirens (blue oatgrass) is a perennial grass widely grown for ornamental use in Canada. Rusted blue oatgrass plants with diseased leaves covered with uredinia were collected from two locations at metropolitan Vancouver, British Columbia (BC), in summer 2022. The rust fungus was identified as Puccinia gibberosa (= P. coronata var. gibberosa) based on combined results of morphological characteristics and molecular analyses. The internal transcribed spacer two (ITS2) and partial large subunit ribosomal DNA were amplified and sequenced. The sequence obtained for the rust fungus showed 99.9% identity with the previously reported P. coronata var. gibberosa from USA. This is the first report of rust caused by P. gibberosa on blue oatgrass in Canada. Evidence from phylogenetic analyses supports the recognition of this rust at the species level. A revised description for P. gibberosa is provided, including synonyms, host range and distribution across the globe, and incorporating comprehensive molecular and morphological results for several North American and European specimens. In addition, a lectotype and an epitype are designated here for the rust species. [ABSTRACT FROM AUTHOR]

As an agroforestry resource willow species (Salix spp.) becoming increasingly important in the protection of riverbanks, recovery of floodable lands, soil bioremediation, biomass production, and wicker furniture manufacture, Babylon willow (Salix babylonica) is widely planted all over the world and is found throughout Iran as part of the rural landscape and is mostly planted for ornamental or bioremediation purposes. Rust fungi in the genus Melampsora usually cause disease on Salix species. Identification of Melampsora species is often complicated because there are few differences in spore morphology and little is publicly available in comparative sequence data. Willow trees in Iran have been reported to be infected by 15 Melampsora species; however, most of these records are based on morphological characterization. During surveillance activities carried out in June 2007, a rust species was detected on isolated Babylon willow trees in an area in Northern Iran. Both the rust fungus and the host plant were identified on the basis of morphological features and DNA sequencing. Based on a combination of morphology, large subunit (LSU) rDNA sequencing and phylogenetic analyses, our rust specimen was identified as Melampsora ferrinii, which is newly reported from Iran on Salix babylonica. Melampsora ferrinii was originally described from the Americas and this is the first time that this rust has been observed on its telial host, Babylon willow, in Asia. The documentation of the rust fungus was performed using both scanning electron microscopy (SEM) and light microscopy. Additionally, an identification key for Melampsora species reported on Salix spp. in Iran is included. [ABSTRACT FROM AUTHOR]

Amorphous titanium dioxide (TiO2) film coating by atomic layer deposition (ALD) is a promising strategy to extend the photoelectrode lifetime to meet the industrial standard for solar fuel generation. To realize this promise, the essential structure-property relationship that dictates the protection lifetime needs to be uncovered. In this work, we reveal that in addition to the imbedded crystalline phase, the presence of residual chlorine (Cl) ligands is detrimental to the silicon (Si) photoanode lifetime. We further demonstrate that post-ALD in-situ water treatment can effectively decouple the ALD reaction completeness from crystallization. The as-processed TiO2 film has a much lower residual Cl concentration and thus an improved film stoichiometry, while its uniform amorphous phase is well preserved. As a result, the protected Si photoanode exhibits a substantially improved lifetime to ~600 h at a photocurrent density of more than 30 mA/cm2. This study demonstrates a significant advancement toward sustainable hydrogen generation. Residual Cl ligands are found critical to the stability of amorphous TiO2 coatings by atomic layer deposition. Here, in-situ water treatment is developed to remove residual Cl, while preserve its uniform amorphous phase, which improves the lifetime of Si photoanode to 600 h for hydrogen production. [ABSTRACT FROM AUTHOR]

The evolution of medium range ordering (MRO) and crystallization behavior of amorphous TiO2 films grown by atomic layer deposition (ALD) were studied using in situ four-dimensional scanning transmission electron microscopy. The films remain fully amorphous when grown at 120 °C or below, but they start showing crystallization of anatase phases when grown at 140 °C or above. The degree of MRO increases as a function of temperature and maximizes at 140 °C when crystallization starts to occur, which suggests that crystallization prerequires the development of nanoscale MRO that serves as the site of nucleation. In situ annealing of amorphous TiO2 films grown at 80 °C shows enhancement of MRO but limited number of nucleation, which suggests that post-annealing develops only a small portion of MRO into crystal nuclei. The MRO regions that do not develop into crystals undergo structural relaxation instead, which provides insights into the critical size and degree of ordering and the stability of certain MRO types at different temperatures. In addition, crystallographic defects were observed within crystal phases, which likely negate corrosion resistance of the film. Our result highlights the importance of understanding and controlling MRO for optimizing ALD-grown amorphous films for next-generation functional devices and renewable energy applications. [ABSTRACT FROM AUTHOR]

Triticale (× Triticosecale), was initially produced by crossing wheat (Triticum) with rye (Secale). Although still a minor crop in Canada, triticale grain is used both as human food (in bread, pastry products, and the brewing industry) and as livestock feed (Larter 2015). In September 2023 typical leaf rust samples were observed and collected in winter Triticale at Lacombe, Alberta. Typical exposed rust colored uredinia were mainly on adaxial leaf surface. Urediniospores obovoid, ellipsoid or globoid, measured 24-33 × 19-26 µm; with yellow-brown echinulate wall 1-1.5 µm thick. These spores mostly had 8 to 9 scattered germ pores, approximately bizonate with moderate to strong internal ring. Telia not present. Due to the absence of the telial stage, the morphological features of uredinia and urediniospores align our species with Puccinia triticina and P. recondita. These species have overlapping uredinial characteristics and can potentially both cause disease on Triticale (Yekelo et al. 2019). For testing pathogenicity on Triticale, two-week-old winter Triticale seedlings were infected with single pustule isolate from the Albertan leaf rust sourced from Triticale (AB-1). For seedling inoculation, we used 20 mg of pure urediniospores suspended in 5-6 ml of NOVEC 7100™ Engineered fluid, applied with an airbrush compressor system equipped with a 0.3 mm nozzle. All inoculated plants were kept in a dew chamber at 13°C for 24 hours in the dark, and then transferred to a Reach-In growth chamber with a 16-hour photoperiod (21°C day/15°C night). After 10 days, all inoculated seedlings showed uredinia. Control plants that were only sprayed with NOVEC 7100 and kept under the same conditions remained healthy, showing no rust symptoms. To clarify the identity of leaf rust, we sequenced the nuclear ribosomal rRNA internal transcribed spacer region (ITS) and elongation factor 1 alpha gene (EF1-a) for both the field collection (DAOM 985259) and the single pustule inoculated collection (DAOM 985258) and the data were deposited in NCBI GenBank (accession # PQ317950 and PQ317949 for ITS and PQ338170 and PQ338169 for EF1-a, respectively). Obtained sequences of both field and the inoculated collections were identical and shared %100 identity with available sequences of P. triticina in GenBank (MT955180 for ITS and JX533504 for EF1-a) (Liu et al. 2013). To further investigate the pathogenicity of the Albertan leaf rust isolate (AB-1) on Triticale, we conducted additional rounds of inoculation tests. In those experiments, two-week-old seedlings of winter rye and Avocet wheat were inoculated under the above-mentioned conditions and methods. After 9 to 10 days, both rye and wheat plants showed uredinia on the infected leaves. This indicates that the Triticale isolate of leaf rust was capable of infecting rye and wheat in addition to Triticale. Since Triticale is primarily planted as a forage or cover crop, its susceptibility to wheat leaf rust could contribute to the build-up of inoculum and subsequent infection of commercial wheat crops (Yekelo et al. 2019). Our research showed, there was no record of leaf rust (P. triticina) on Triticale based on USDA Fungal Databases (https://fungi.ars.usda.gov/) and also no herbarium specimen of leaf rust on Triticale in Canada and United States based on MyCoPortal (https://www.mycoportal.org). To our knowledge this is the first morphologically and molecularly documented report of P. triticina on Triticale in Alberta and probably in Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

Amorphous titanium dioxide TiO 2 (a-TiO 2 ) has been widely studied, particularly as a protective coating layer on semiconductors to prevent corrosion and promote electron-hole conduction in photoelectrochemical reactions. The stability and longevity of a-TiO 2 is strongly affected by the thickness and structural heterogeneity, implying that understanding the structure properties of a-TiO 2 is crucial for improving the performance. This study characterized the structural and electronic properties of a-TiO 2 thin films (∼17 nm) grown on Si by atomic layer deposition (ALD). Fluctuation spectra V ( k ) and angular correlation functions were determined with 4-dimensional scanning transmission electron microscopy (4D-STEM), which revealed the distinctive medium-range ordering in the a-TiO 2 film. A realistic atomic model of a-TiO 2 was established guided by the medium-range ordering and the previously reported short-range ordering of a-TiO 2 film, as well as the interatomic potential. The structure was optimized by the StructOpt code using a genetic algorithm that simultaneously minimizes energy and maximizes the match to experimental short- and medium-range ordering. The StructOpt a-TiO 2 model presents improved agreements with the medium-range ordering and the k -space location of the dominant 2-fold angular correlations compared with a traditional melt-quenched model. The electronic structure of the StructOpt a-TiO 2 model was studied by ab initio calculations and compared to the crystalline phases and experimental results. This work uncovered the medium-range ordering in a-TiO 2 thin films and provided a realistic a-TiO 2 structure model for further investigation of structure-property relationships and materials design. In addition, the improved multi-objective optimization package StructOpt was provided for structure determination of complex materials guided by experiments and simulations.

Rumex crispus L. (curled dock) is a noxious weed in both grasslands (mainly pastures) and arable lands, but is also an early colonizer of many disturbed areas in lowland and upland regions. Rumex crispus is of agricultural significance because it competes with sown or native pasture and crops species and occupies areas that could be utilized by more palatable crop species. Rumex crispus can grow on almost all soil types but less often on peat and acidic soils. The range of altitude to which the species has become adapted varies from sea level to 3,500 m (Zaller 2004). This plant species has Eurasian origin and is widely distributed through temperate regions of North America as an introduced species. There is no previous rust report on R. crispus in Canada. On other Rumex species two Puccinia species viz. Puccinia acetosae (Schumach.) Körn., and P. ornata Arthur & Holw., have been previously reported from Canada (Farr & Rossman 2022). During the recent field survey from southern British Columbia, Langley, heavily rust infected leaves of R. crispus were observed. Uredinia and telia were present on both sides of the leaf mainly on the lower side. Uredinia early exposed, brown, and pulverulent. Urediniospores were obovoid, ellipsoid or oblong, measuring 20-28 × 17-23 µm. Urediniospore walls are yellowish brown to brown, 1.5-2 µm thick; covered in evenly distributed echinulae, spaced 2 to 3 μm apart, with smooth (non-echinulate) patches at the equator of the urediniospores. Urediniospores with 2- (mostly 3 and less often 2) germ pores, usually supraequatorial (at the upper part of the spore), or distributed irregularly (scattered), or 2 germ pores supraequatorial, one equatorial or all germ pores equatorial, germ pores covered with flat papilla. Telia similar to the uredinia, dark brown. Teliospores more or less globoid, ellipsoid, broadly ellipsoid, obovoid or oblong, 25--36 × 15-23 µm, brownish yellow to brown, smooth, 2-3 um thick, with apical or sup-apical germ pore, covered with a hemispherical, yellowish papilla, pedicels colorless, short. The above-mentioned characters fit Majewski's (1977) description for Uromyces rumicis (Schumach.) G. Winter. To confirm identity, the first 903 bp of the 5' end of the 28S rDNA of the above specimen was amplified following protocols of Aime (2006) and Aime et al. (2018) (GenBank accession no. ON166844). BLAST queries of the sequence shared 99.56% identity (900/903) with U. rumicis (GenBank accession no. KY764197). To our knowledge this is the first report of U. rumicis from Canada (Farr and Rossma 2022). There is only one previous published report of this rust species in North America made by French (1989) who reported U. rumicis on R. crispus from California. Uromyces rumicis is quite common on Rumex species including R. crispus in Eurasia and has also been reported on this host from Africa (Farr and Rossman 2022). It appears that the above rust fungus species may have been introduced to the North America by accompanying its host plant. A voucher specimen of infected R. crispus with U. rumicis was deposited at Arthur Fungarium (PUR) under the accession number PUR N24014. Uromyces rumicis is a heteromacrocyclic rust with aecial state on Ranunculaceae members especially Ranunculus ficaria L. This species is another introduced plant in North America. However, there is no report of the aecial state of this rust in North America to date. Existence of only two reports of U. rumicis in California and British Columbia, making it likely that U. rumicis became established in the West Coast of North America probably no earlier than the second half of the 20th century.