Search

Introduction: The Brazilian Amazon has one of the richest biomes and the largest source of freshwater on the planet. However, anthropogenic activities have also turned this region into one of the highest points of human exposure to mercury ever recorded. Therefore, the aim of the present work was to perform a scope review with meta-analysis in order to evaluate the total mercury (THg) and methylmercury (MeHg) levels in Brazilian Amazon fish, as well as to carry out a local population health risk assessment. Methods: A literature search was systematically performed in research databases and gray literature, remaining 14 studies from 2017 to 2022 for final analysis. The studies were submitted to raw mean and subgroup meta-analysis, followed by a risk characterization and the calculation of a maximum safe consumption of fish for the Amazonian population. Results: The selected studies covered 4 Amazonian states, as well as included the analysis of >30 fish species of different trophic levels and sampling in >15 cities. The overall total mercury mean obtained for Brazilian Amazon fish was 0.29 ug g⁻¹. Significant difference was observed between THg levels according to fish trophic level (p < 0.05), which reinforces the MeHg biomagnification. When THg levels from all fish samples were pooled, it was not observed a significant difference among the Amazonian states and the fish sampling season. However, significant variations between microregions and species-specific variations over the seasons should not be discarded. All estimated daily methylmercury intake exceeded the reference dose of 0.1 ug kg BW⁻¹ day⁻¹, resulting in a hazard quotient (HQ) greater than 1 and indicating a risk of chronic exposure by the local population. The maximum safe consumption of fish calculated based on the overall total mercury mean was set as 31, 147 and 173 g week⁻¹ for children, adult women and adult men, respectively, which is much lower than the reality of consumption by the riverside communities (2870 g week⁻¹). Conclusion: There is an urgent need to reduce Hg exposure levels in the region as well as to recommend other protective nutritional strategies to the local population such as defining the fish species with lower mercury contamination levels and their safe weekly consumption.

This study addresses the challenge of optimizing powdered water kefir's fermentation and preservation processes to enhance its physical-chemical, microbiological, and technological characteristics. The main objective was to determine the best fermentation conditions and evaluate the efficacy of different drying methods. The optimal fermentation conditions were 5 % kefir grains, 10 % brown sugar, and an incubation temperature of 25 °C. Remarkably, the microbiological analysis revealed high abundances of Zymomonas mobilis (grains: 94.31 % and beverage: 91.68 %), Sporolactobacillus spathodeae (grains: 3.00 % and beverage: 5.42 %), and Liquorilactobacillus satsumensis (grains: 1.47 % and beverage: 0.62 %) among bacteria, and Lachancea fermentati (grains: 95.54 % and beverage: 67.53 %), Wickerhamomyces anomalus (grains: 3.00 % and beverage: 26.77 %) among fungi. The study innovatively demonstrates that lyophilization preserves the viability of these microorganisms, making it a promising method for producing stable, probiotic-rich powdered kefir. Although spray drying resulted in a logarithmic reduction of 3 logs CFU/g, it maintained sufficient microorganism counts, proving its viability as an alternative drying method. These methods retain the ideal physical-chemical properties and expand the accessibility and practical applications of water kefir. This research underscores the potential for powdered water kefir to deliver health benefits conveniently and versatilely, paving the way for broader industrial and academic applications.

Over the years, there has been an increase in demand for plant-based foods as alternatives. In line with this, this work explores the production and in vitro digestion of a fermented plant-based beverage (FPBB) produced with pea and rice proteins and 0% (FPBB-C), 5% (FPBB-5), and 10% (FPBB-10) uvaia pulp through lactic fermentation with Lacticaseibacillus rhamnosus GG. The in vitro gastrointestinal digestion process was conducted to assess the bioaccessibility of L. rhamnosus GG, total phenolic content (TPC), and antioxidant activity before and after simulating the gastrointestinal conditions. After 48 h of digestion, highly viable L. rhamnosus GG cells remained throughout the gastrointestinal system. FPBB-C (106.89%) and FPBB-5 (109.38%) exhibited higher survival rates than FPBB-10 (102.20%), indicating that these beverages have a higher prebiotic action potential. Compared with the non-digested samples, after 48 h of digestion, all samples exhibited a significant increase in TPC. The same behavior occurs for the antioxidant activity of FPBB-C, FPBB-5, and FPBB-10 by DPPH (4.06, 3.96, and 8.44 mg TEAC mL−1), ABTS (10.28, 11.06, 11.97 mg TEAC mL−1), and FRAP method (917.02, 863.87, and 1983.23 mg TEAC mL−1). Thirteen compounds were identified and quantified in uvaia pulp by HPLC-DAD-ESI-MS, particularly epigallocatechin gallate, quercetin-3-rhamnose, and quercetin-3-glucoside. Isorhamnetin was the main phenolic compound detected in the colon, assumably due to the conversion of quercetin-3-glucoside by the probiotic cells. In conclusion, as all counts were above 9 log CFU g−1, the FPBB formulations containing pea, rice protein, and uvaia pulp become a promising vehicle for carrying L. rhamnosus GG.

The influence of storage stability and simulated gastrointestinal behavior of different extracts of guava leaves extracts (NC: not concentrated, and C10 and C20: concentrated by nanofiltration) was evaluated based on their total phenolic compound (TPC) contents and antioxidant activity as well as on their cytotoxic effects on A549 and Vero cells. The results showed that C10 and C20 presented high stability for 125 days probably due to their high TPC contents and antioxidant activity. The simulated gastrointestinal behavior modified their TPC contents; however, after all digestion steps, the TPC values were higher than 70%, which means that they were still available to exert their bioactivities. Additionally, the cytotoxic effects of these extracts were evaluated before and after the simulated gastrointestinal behavior or under different storage conditions. C10 presented the best selectivity indices (SI) values (IC50 Vero cells/IC50 A549 cells) at both conditions suggesting that it can be considered a potential extract to be developed as a functional food due to its resistance to the gastrointestinal digestion and storage conditions tested.

ABSTRACT: More than 30 types of artisanal cheeses are known in Brazil; however, microorganisms, such as Staphylococcus spp., can contaminate raw milk cheeses through different sources, from milking to processing. Staphylococcal food poisoning results from the consumption of food in which coagulase-positive staphylococci, mostly Staphylococcus aureus, have developed and produced enterotoxins. In addition, an emerging public health concern is the increasing antimicrobial resistance of some Staphylococcus strains. Furthermore, the ability of Staphylococcus spp. in sharing antibiotic resistance-related genes with other bacteria increases this problem. In light of these observations, this review aims to discuss the presence of, enterotoxins of, and antibiotic-resistant of Staphylococcus spp. in Brazilian artisanal cheese produced with raw milk.

Abstract Coffee, one of the most produced and consumed beverage in the world, has a range of variability in its quality. The aim of this work was to evaluate the consumer capacity to perceive the coffee quality through their fragrance and to verify the influence of previous information about quality on this perception using hedonic scale and Check All That Apply (CATA) sensory tests. The sensory tests were performed in two stages, one without and the other with quality related information of Mogiana coffee samples (Rio, Hard and Soft), and a traditional coffee sample. CATA attributes frequency of occurrence shows that samples discrimination could be done with specific attributes. For Soft coffee the attributes with more occurrence were sweet, caramel, brown sugar, and smooth. The Hard coffee sample was described by the attributes peanut, buttery, and chocolate. While for Rio coffee, the descriptive attributes most often mentioned were strong and burnt. The traditional sample stood out among consumers for its characteristics of old, medicine, sour, burnt, unpleasant and spicy. Therefore, the use of coffee powder fragrance can be alternative to differentiate the quality of the product and its function can be enhanced by passing on information on quality attributes to consumers.

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.

Irritable bowel syndrome (IBS) is a chronic condition that affects 11.2% of the world’s population. The management of gut microbiota using probiotic and synbiotic agents might be a valid alternative to assist in the treatment of IBS. The focus of this study was to evaluate the effects of prebiotic and synbiotic compounds carried by different foods on major symptoms of IBS through a systematic literature review. MEDLINE, EMBASE, Cochrane Central Register of Controlled Trials, and LILACS were accessed during July 2021. The studies included in this review were the ones that tested volunteers older than 16 years of age and were conducted using a randomized, controlled clinical trial. The risk of bias was assessed by using the Cochrane risk-of-bias tool for randomized trials (RoB2). Furthermore, the data found were qualitatively evaluated due to the studies’ differences. Two papers were able to fit the criteria, with a total sample size of 280 participants. No datum was found regarding the use of prebiotics in the treatment of IBS. Synbiotic agents, however, had a positive effect on gastrointestinal symptoms and the participants’ overall bowel satisfaction; however, it was not possible to reach a consensus on which effects. Further studies regarding the use of synbiotics and prebiotics must be carried out to determine which effects are the most significant in the treatment of IBS.

Growing medical, engineering, biochemical, and biological interest has led to a steady pace of research and development into polymeric monolithic structures with densely interconnected pores for purifying bio compounds. Cryogels, which are generated by freezing a reactive polymerization mixture, are highlighted due to their versatility and low relative cost as macroporous, polymeric, monolithic adsorbents. The conversion of cryogels into affinity adsorbents is one possible alternative to their optimal application. Some of the most often utilized supports for immobilizing particular ligands are monolithic columns manufactured with epoxy radicals on their surfaces. The purification of biomolecules with a high degree of specificity, such as lectins and glycoproteins with an affinity for glycosylated groups, has garnered interest in the use of fixed non-traditional beds functionalized with ligands of particular interest. The interaction is both robust enough to permit the adsorption of glycoproteins and reversible enough to permit the dissociation of molecules in response to changes in the solution’s pH. When compared to other protein A-based approaches, this one has been shown to be more advantageous than its counterparts in terms of specificity, ease of use, and cost-effectiveness. Information on polymeric, macroporous, monolithic adsorbents used in the affinity chromatographic purification of lectins has been published and explored.

Campomanesia xanthocarpa var. littoralis, Campomanesia xanthocarpa (Berg), and Campomanesia eugenioides are native fruit plants found in Brazil. Due to the scarce number of controlled scientific studies comparing different native Campomanesia species, this study sought to determine their bioactive compounds and antioxidant properties. C. eugenioides proved to be a rich source of total phenolic compounds, also showing the best antioxidant capacity by the ABTS, DPPH and molybdenum reduction power methods. On the other hand, C. xanthocarpa var. littoralis showed the best results for total flavonoids content, and Iron(II) chelation power. The phenolic compounds contents present in C. eugenioides could be responsible for the best antioxidant activity. This study provides key scientific data regarding the use of valuable fruits from different edible Campomanesia species to produce bioactive ingredients, as well as natural preservatives for food products. Thus, our results contribute to the discovery of the potential application of these native Campomanesia Brazilian fruits, as a natural product with functional and antioxidant properties.

Objetivo: Descrever a experiência de acadêmicas de Terapia Ocupacional na inserção de um grupo de convivência de idosos em uma comunidade localizada na região central do Rio Grande do Sul, Brasil. Síntese dos dados: A ação foi desenvolvida no Estágio Supervisionado em Saúde da Comunidade, no período de março a julho do ano de 2015, realizado no sexto semestre do curso de Terapia Ocupacional. Na atuação dos acadêmicos com os participantes do grupo de convivência, foram realizadas atividades visando à integração de ações de ensino, pesquisa e extensão universitária, com foco na melhoria da qualidade de vida e condição de saúde das participantes através da prevenção de agravos e complicações, considerando as doenças crônicas não transmissíveis (DCNT) apresentadas pela maioria dos participantes do grupo de idosos. Conclusão: As experiências evidenciaram que os grupos de Terapia Ocupacional permitiram a identificação de potencialidades e habilidades de uma população pouco valorizada produtivamente na sociedade, de forma que o grupo se constituiu como um espaço de ressignificação de vidas, superação de dificuldades cotidianas, aquisição de hábitos de vida saudáveis e ajuda para um envelhecimento ativo.

The growing consumer interest in goat’s milk and dairy products is related to nutritive values and positive health benefits attached to these products. Goat’s milk is known for its lower allergenic potential and better digestibility, when compared to bovine milk, as well as the presence of health-promoting compounds. Therefore, goat milk can be used in the manufacture of a wide variety of products and can also be used as carrier for functional components, such as prebiotic substances or probiotic bacteria. Some in vivo studies have been carried out to explore its therapeutic potential and have shown excellent biological effects. However, probiotic/prebiotic research remains minimally explored regarding the functional aspects of goat dairy products. Thus, future studies using goat’s milk products as probiotic/prebiotic matrix could be assessed in several models in a similar fashion to what is studied with bovine milk.

Objetivo: identificar, na literatura científica, estratégias assistenciais para o controle da tuberculose drogarresistente. Método: revisão integrativa da literatura, com análise de pesquisas relevantes sobre a questão nortedora: Quais são as evidências científicas sobre as estratégias assistenciais para o controle da tuberculose drogarresistente? Busca realizada nas bases Literatura Latino-Americana e do Caribe em Ciências da Saúde, Medical Literature Analysis, Índice Bibliográfico Espanhol em Ciências da Saúde e Banco de Dados em Enfermagem, entre janeiro e março de 2020. Foram incluídos dez artigos para discussão dos resultados que responderam à questão da pesquisa, atendendo aos critérios de inclusão e exclusão. Resultados: nos estudos publicados nos últimos cinco anos, 80% abordaram estratégias assistenciais para o controle da tuberculose drogarresistente e 20% evidenciaram falhas na assistência aos portadores da doença. Conclusão: a revisão da literatura identificou várias estratégias assistenciais para o controle da tuberculose drogarresistente, com destaque para a descentralização do diagnóstico e tratamento compartilhado, possibilitando uma atenção ampliada e integral aos pacientes. ABSTRACT Objective: from the scientific literature, to identify care strategies for controlling drug-resistant tuberculosis. Method: this integrative literature review examined relevant research on the research question – What is the scientific evidence on care strategies for controlling drug-resistant tuberculosis? – by searching Latin American and Caribbean Health Sciences Information, Medical Literature Analysis, Índice Bibliográfico Español en Ciencias de la Salud and Banco de Dados em Enfermagem, between January and March 2020. Ten articles were included in order to discuss findings that answered the research question, after meeting the inclusion and exclusion criteria. Results: of studies published in the past five years, 80% addressed care strategies for controlling drug-resistant tuberculosis and 20% revealed shortcomings in care for patients with the disease. Conclusion: the literature review identified several care strategies for controlling drug-resistant tuberculosis, particularly by decentralized diagnosis and shared treatment, allowing expanded, comprehensive patient care. RESUMEN Objetivo: identificar, en la literatura científica, estrategias de asistencia para el control de la tuberculosis farmacorresistente. Método: se trata de una revisión integradora de la literatura, con análisis de investigaciones relevantes sobre la cuestión rectora: ¿Cuáles son las evidencias científicas sobre las estrategias de asistencia para el control de la tuberculosis farmacorresistente? La búsqueda fue realizada en las bases Literatura Latinoamericana y del Caribe en Ciencias de la Salud, Medical Literature Analysis, Índice Bibliográfico Español en Ciencias de la Salud y Banco de Datos en Enfermería, de enero a marzo de 2020. Se incluyeron diez artículos para discutir los resultados que respondieron a la pregunta de la investigación, cumpliendo con los criterios de inclusión y exclusión. Resultados: en los estudios publicados en los últimos cinco años, el 80% abordó estrategias de atención para el control de la tuberculosis farmacorresistente y el 20% mostró fallas en la atención de los pacientes con la enfermedad. Conclusión: la revisión de la literatura identificó varias estrategias asistenciales para el control de la tuberculosis farmacorresistente, con énfasis en la descentralización del diagnóstico y tratamiento compartido, permitiendo una atención ampliada e integral a los pacientes.

A Terapia Ocupacional desenvolve sua prática e estudo sobre as atividades humanas com a utilização de recursos e instrumentos terapêuticos, que podem beneficiar o processo de envelhecimento. Nesse sentido, o estudo visou reconhecer e descrever a percepção de mulheres com idade entre 40 e 60 anos de idade, participantes de um grupo de Terapia Ocupacional, quanto às repercussões da utilização de um Guia Prático de Alongamento, no desempenho das atividades cotidianas. Para tanto, realizou-se uma pesquisa qualitativa, exploratória e descritiva, por meio de Grupo Focal. Verificou-se que a utilização do Guia influenciou no controle da dor, na autonomia para realização de atividades de vida diária e na percepção do próprio corpo das participantes do estudo. Conclui-se que o Guia Prático de Alongamento é uma ferramenta simples, porém relevante para melhorar a consciência corporal, a autonomia e independência de indivíduos em processo de envelhecimento, sugerindo-o como um instrumento indicado para outras populações. AbstractOccupational Therapy carries out the practice and study of human activities by employing therapeutic resources and instruments, which can benefit the aging process. Thus, the aim of this study was to identify and describe the perception of women between the ages of 40 and 60 in an Occupational Therapy group regarding the effects of using a Practical Guide to Stretching on the performance of their daily activities. In that sense, a qualitative, exploratory and descriptive Focus Group research was carried out. It was verified that the use of the Practical Guide had an influence on participants’ pain control, autonomy to perform daily activities and body perception. It was concluded that the Practical Guide to Stretching is a simple but relevant tool that helps aging individuals improve their body awareness, autonomy and independence. It is also a suitable tool for other populations.Keywords: Muscle Stretching Exercises; Qualitative Research; Occupational Therapy.

Objetivo: Verificar a efetividade das estratégias de marketing social e de acolhimento desenvolvidas em um hemocentro e, antes e após as ações realizadas, verificar a demanda reprimida de sangue e hemocomponentes em um hospital de referência. Métodos: Trata-se de estudo comparativo, com abordagem quantitativa, realizado em um hemocentro e no serviço de hemoterapia de um hospital de referência no município de Santa Maria, RS, Brasil, entre setembro e dezembro de 2015. As estratégias compreenderam ação de marketing social, realizada por meio do envio de cartas, e-mails e telefonemas às pessoas em condições de realizar uma nova doação, e o acolhimento, que consistiu em realizar a acolhida do usuário por meio de um álbum seriado. A partir do levantamento de informações do banco de dados, especificamente dos registros de transfusões solicitadas e efetivadas, comparou-se o número de doações efetivadas antes e após as ações ao quantitativo do ano anterior com base na estatística descritiva e teste t de Student. Resultados: O número de doações em geral aumentou, principalmente no último mês em que ocorreram as ações (p=0,0397). Entretanto, a média de doações voluntárias de sangue total apresentou redução, passando de 237 doações/mês, em 2014, para 222 doações/mês, em 2015. A média de doações voluntárias de plaquetas por aférese aumentou de 11 doações/mês, em 2014, para 17 doações/mês, em 2015. Conclusão: As estratégias implementadas no período do estudo contribuíram para o aumento no número de doações de plaquetas por aférese, porém, com relação à doação de sangue total, não houve resultado positivo.

A diabetes mellitus (DM) é uma doença que vem aumentando exponencialmente nos últimos anos de vida dos indivíduos, e uma opção de tratamento farmacológico é feito através dos hipoglicemiantes orais (HO). Em virtude de serem substâncias amplamente utilizadas e terem como principal via de excreção a urinária, este tratamento pode provocar variações nos resultados dos parâmetros urinários. Portanto, este estudo tem a finalidade de avaliar a interferência causada pelo uso de hipoglicemiantes no exame de urina. Para esta investigação, foi feita uma pesquisa bibliográfica em diferentes bases de dados, selecionando os artigos pertinentes ao tema: diabetes, interferências laboratoriais e tratamento farmacológico. Os HO podem ser classificados em três grupos de acordo com o mecanismo de ação: estimuladores de insulinas pelo pâncreas, como sulfoniluréias e metiglinidas; as sensibilizadoras de insulina, são as biguanidas, as tiazolidinedionas e as redutoras da absorção de carboidratos, que são as inibidoras da alfa-glicosidase. O exame de urina é uma ferramenta complementar no controle da DM devido a sua fácil coleta e baixo custo. As classes de hipoglicemiantes orais identificados como potencialmente interferentes no exame de urina foram as biguanidas (metformina) e as sulfoniluréias (tobultamida, tolazamida, glicazida, clorpropramida). Resultam em interferência nos parâmetros densidade, proteínas, glicose, cetonas e bilirrubinas, levando a um diagnóstico inadequado e um tratamento insatisfatório gerando prejuízos ao bem estar do paciente.

Arbuscular mycorrhizal (AM) fungi can sequester different potentially toxic elements, such as trace elements (TEs), within their structures to alleviate the toxicity for its host plant and themselves. To elucidate the role of AM fungi in TEs immobilization in the rhizosphere of host plants, it is important to know the TEs distribution in AM fungal structures. In the present study, we investigated the distribution and concentration of TEs within extraradical spores and mycelium of the AM fungus Rhizophagus intraradices, collected from the rhizosphere of Senecio bonariensis plants grown in a soil polluted with multiple TEs, by using Particle-Induced X-ray Emission with a micro-focused beam (micro PIXE). This technique enabled the simultaneous micrometric mapping of elements in a sample. The calculated values were compared with those in the polluted substrate, measured by the Wavelength Dispersive X-ray Fluorescence technique. The highest concentrations of Fe, P, Ti, Mn, Cr, Cu and Zn were found in AM fungal spores, where they were accumulated, while extraradical mycelium was enriched in Cu. Finally, we demonstrated that AM fungi can simultaneously accumulate high amounts of different TEs in their structures, thus reducing the toxicity of these elements to its host plant., Competing Interests: Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper., (Copyright © 2024 British Mycological Society. Published by Elsevier Ltd. All rights reserved.)

Arbuscular mycorrhizal (AM) fungal community associated with pecan ( Caryaillinoinensis ) roots and rhizospheric soils was assessed by spore isolation and morphological characterisation and by pyrosequencing of AM molecular markers. The AM fungal community associated with pecan growing in the field, was always more diverse than that associated with pecan growing in containers. This was not observed when AM richness was studied, suggesting that soil disturbance by a reduction in host plant richness leads to a less equitable distribution of AM fungal species, in contrast to natural soils. The chosen primers (AMV4.5F/AMDGR) for pyrosequencing showed high AM fungal specificity. Based on 97% sequence similarity, 49 operational taxonomic units (MOTUs) were obtained and, amongst these, 41 MOTUs corresponded to the Glomeromycotaphylum . The number of obtained AM sequences ranged from 2164, associated with field samples, to 5572 obtained from pecan trap pot culture samples, defining 30 and 29 MOTUs, respectively. Richness estimated by conventional species identification was 6 and 9 AM fungal species in soil and pot samples, respectively. Claroideoglomuslamellosum , Funneliformismosseae and Entrophosporainfrequens were the only taxa detected using both techniques. Predominant sequences in the pecan rhizosphere samples, such as Rhizoglomusirregulare and other less abundant ( Dominikiairanica , Dominikiaindica , Sclerocystissinuosa , Paraglomuslaccatum ), were detected only by pyrosequencing. Detection of AM fungal species based on spore morphology, in combination with molecular approaches, provides a more comprehensive estimate of fungal community composition.

Background: Intraoperative fluorescein detection has been used in the fields of vascular and oncologic neurosurgery since 1948. Modifications of the optics in order to enhance the fluorescence contrast under microscopic view have been developed by many authors. The industries, during the past 10 years, provided commercial high-cost optimized apparatuses. Reviewing the literature, we found that the prototypical techniques were definitely inexpensive but lacked reliability, reproducibility, and standard legal norms., Methods: We describe the developing of a fluorescein detection system that could be economic, simple, effective, and law abiding., Results: We employed a commercial violet-blue filter designed for fluorescein excitation in endoscopic procedures and used commercial photographic yellow optical filters for fluorescence detection. All the instrumentation is cleared for clinical use, and its cost is up to 200 times lower than commercial apparatuses., Conclusion: Our results show a good distinction of fluorescein-stained structures, with overall acceptable operating light conditions., (Copyright © 2016 Elsevier Inc. All rights reserved.)

The aim of this study was to assess the effects of agronomic practices on the arbuscular mycorrhizal (AM) fungal community in soils from the Pampa Ondulada region (Argentina), and to compare conclusions reached when using pyrosequencing or a morphological approach. The AM fungal diversity of 3 agricultural exploitations located in the Pampa Ondulada region (Argentina) was assessed by using 454 amplicon pyrosequencing and morphological (based on spore traits) approaches. Two kinds of soil managements are found in these sites: agronomic and non-agronomic. A total of 188 molecular operational taxonomic units and 29 morphological species of AM fungi were identified. No effect of soil management on AM richness was detected. AM fungal communities were more diverse and equitable in the absence of agronomic management. In contrast, the results on β-diversity varied according to the methodology used. We concluded that agronomic management of soil has a negative effect on AM fungal community biodiversity in the Pampa Ondulada region. We also conclude that both methodologies complement each other in the study of AM fungal ecology. This study greatly improved the knowledge about AM fungi in South America where the molecular diversity of AM fungi was practically unknown.