Search

Stink bugs represent an increasing risk to soybean production in the Midwest region of the United States. The current sampling protocol for stink bugs in this region is tailored for population density estimation and thus is more relevant to research purposes. A practical decision-making framework with more efficient sampling effort for management of herbivorous stink bugs is needed. Therefore, a binomial sequential sampling plan was developed for herbivorous stink bugs in the Midwest region. A total of 146 soybean fields were sampled across 11 states using sweep nets in 2016, 2017, and 2018. The binomial sequential sampling plans were developed using combinations of five tally thresholds at two proportion infested action thresholds to identify those that provided the best sampling outcomes. Final assessment of the operating characteristic curves for each plan indicated that a tally threshold of 3 stink bugs per 25 sweeps, and proportion infested action thresholds of 0.75 and 0.95 corresponding to the action thresholds of 5 and 10 stink bugs per 25 sweeps, provided the optimal balance between highest probability of correct decisions (≥ 99%) and lowest probability of incorrect decisions (≤ 1%). In addition, the average sample size for both plans (18 and 12 sets of 25 sweeps, respectively) was lower than that for the other proposed plans. The binomial sequential sampling plan can reduce the number of sample units required to achieve a management decision, which is important because it can potentially reduce risk/cost of management for stink bugs in soybean in this region.

Cover crops (CC) support populations of pest and beneficial arthropods. The status of these arthropods in the subsequent cash crop depends on several factors such as CC species, management, biomass production, and weather conditions. A systematic review was performed to identify how CC management influences pest and beneficial arthropods and to identify knowledge gaps for the future research efforts. Eight studies included in this review indicated that CC increase beneficial arthropods or some beneficial arthropods compared with the CC managed fields. A minority of the studies indicated an increase in pest presence when using CC. Cover crop species, termination time and methods, and CC management had variable responses on arthropod activity-density. The variable responses, differences on study designs, and complexity of CC management influence arthropod activity in a CC-corn [Zea mays L. (Poaceae)]/soybean [Glycine max L. (Fabaceae)] system, limiting our ability to draw a broad and effective conclusion about the CC management impact on arthropods. Local research studies are needed to identify the impact of CC biomass quality and quantity, CC biomass thresholds for pest and beneficial arthropods, and cash crop yield impact of CC management-arthropod-related studies. Studies using the standard farming practices of each U.S. region and using standard measurements are needed to guide farmers that use cover crops. This systematic review aims to provide a better understanding of how the complexity of management in cover crop-corn/soybean management affects arthropod activity-density and to identify potential gaps in research and address future research needs.

High-pressure gasification processes are important for conversion of solid materials into gaseous fuels and other chemicals. Laser absorption diagnostics are an important means to study these processes, but are challenging to implement due to the extreme temperatures and pressures present in the system. Here, we combine broadband high-resolution dual-comb spectroscopy with an advanced spectral absorption database and a new means for baseline-free absorption spectroscopy analysis to enable measurements of temperature and water vapor concentration in the core of an entrained flow gasifier operating at up to 1700 K and 15 bar. The dual-comb spectrometer measures the absorption of water vapor from 6800 to 7150 cm−1 with a point spacing of 0.0067 cm−1. The bandwidth is helpful for resolving the complex, congested absorption fingerprint of water vapor that is used to determine the species concentrations and temperature. We interpret the spectrum with absorption models based on a database measured under carefully controlled high-temperature conditions with the dual-comb spectrometer. The database includes the pressure broadening, shift, and temperature dependence of these parameters for water vapor in argon, which is the gasifier bath gas. Finally, fitting the absorption model to the data is enabled by modified free induction decay analysis, which is an approach for quantitatively obtaining species and temperature information without determining the baseline intensity of the spectrometer. The baseline-free approach is crucial to success in this environment, where there are no non-absorbing regions of the spectrum to anchor the normalization of the laser intensity as in traditional direct absorption spectroscopy. We demonstrate good agreement with temperatures measured on the reactor core via optical pyrometry, and show that water vapor concentrations in the reactor core did not reach the expected system set points during some experiments.

Background Field-evolved pyrethroid resistance has been confirmed in western corn rootworm (WCR) populations collected from the United States (US) western Corn Belt. Resistance levels of WCR adults estimated in lab bioassays were confirmed to significantly reduce the efficacy of foliar-applied bifenthrin. The objective of the present study was to investigate the impact of WCR pyrethroid resistance levels on the performance of common soil-applied insecticide formulations (23.4% tefluthrin, 17.15% bifenthrin, and 0.1% cyfluthrin + 2.0% tebupirimphos). Field trials were conducted in 2016 and 2017 in three Nebraska, US, counties (Saunders, Clay, and Keith) where distinct levels of WCR susceptibility to pyrethroids (susceptible, moderately resistant, and highly resistant) had been previously reported in adult and larval bioassays. Results All soil insecticide treatments effectively protected maize roots from a pyrethroid-susceptible WCR population at Saunders. In contrast, the efficacy of bifenthrin and tefluthrin soil insecticides was significantly reduced at Clay and Keith, where pyrethroid-resistant WCR populations were reported. At Keith, where an additional failure of the cyfluthrin + tebupirimphos soil insecticide was observed, WCR laboratory dose-response bioassays showed a consistent ∼5-fold resistance level to the active ingredients bifenthrin, tefluthrin, and cyfluthrin. Conclusion The efficacy of common soil insecticides used in the US for WCR management was significantly reduced in populations exhibiting relatively low levels of WCR pyrethroid resistance. Using a multitactical approach to manage WCR within an integrated pest management framework may mitigate resistance evolution and prolong the usefulness of WCR insecticides within the system. © 2019 Society of Chemical Industry.

Stink bugs are an emerging threat to soybean (Fabales: Fabaceae) in the North Central Region of the United States. Consequently, region-specific scouting recommendations for stink bugs are needed. The aim of this study was to characterize the spatial pattern and to develop sampling plans to estimate stink bug population density in soybean fields. In 2016 and 2017, 125 fields distributed across nine states were sampled using sweep nets. Regression analyses were used to determine the effects of stink bug species [Chinavia hilaris (Say) (Hemiptera: Pentatomidae) and Euschistus spp. (Hemiptera: Pentatomidae)], life stages (nymphs and adults), and field locations (edge and interior) on spatial pattern as represented by variance–mean relationships. Results showed that stink bugs were aggregated. Sequential sampling plans were developed for each combination of species, life stage, and location and for all the data combined. Results for required sample size showed that an average of 40–42 sample units (sets of 25 sweeps) would be necessary to achieve a precision of 0.25 for stink bug densities commonly encountered across the region. However, based on the observed geographic gradient of stink bug densities, more practical sample sizes (5–10 sample units) may be sufficient in states in the southeastern part of the region, whereas impractical sample sizes (>100 sample units) may be required in the northwestern part of the region. Our findings provide research-based sampling recommendations for estimating densities of these emerging pests in soybean.

The wheat stem maggot (Meromyza americana Fitch) (WSM) is a minor pest of wheat, rye, and other grasses. In 2017, growers in Nebraska reported dead center whorls and excessive tillering in early-season cornfields that followed wheat or rye terminated after planting corn. A survey was conducted to evaluate the risk factors for this insect in cover crop to corn transition systems. In each field, management practices and the percentage of injured plants were recorded. Symptomatic corn plants were collected from each field and dissected to determine larval and plant characteristics. In a few cases, small patches of a field were planted to a cover crop to manage soil erosion, and injured plants were only found where the cover crop was present. From these observations, the hypothesis is that terminating a cover crop after planting corn allowed the WSM larva to move from the dying cover crop to corn to complete its development. Cornfields infested with WSM had a frequency of injured corn plants from 0 to 60% with yield losses estimated at 30 bushels/acre. This paper provides the first detailed documentation of WSM injury in corn and addresses important management practices that may have influenced this uncommon situation.

Background Recent studies have reported that air pollution exposure may have neurotoxic properties. Objective To examine longitudinal associations between prenatal particles less than 2.5 μm in diameter (PM2.5) exposure and neurodevelopment during the first two years of children's life. Methods Analysis was conducted in PROGRESS, a longitudinal birth cohort between 2007 and 2013 in Mexico City. We used satellite data to predict daily PM2.5 concentrations at high spatial resolution. Multivariate mixed-effect regression models were adjusted to examine cognitive, language and motor scores in children up to 24 months of age (n = 740) and each trimester-specific and whole pregnancy exposure to PM2.5. Results: Models adjusted by child sex, gestational age, birth weight, smoking and mother's IQ, showed that each increase of 1 μg/m3 of PM2.5 was associated with a decreased language function of −0.38 points (95% CI: −0.77, −0.01). PM2.5 exposure at third trimester of pregnancy contributed most to the observed association. Conclusion Our findings suggest that language development up to 24 months of age may be particularly sensitive to PM2.5 exposure during pregnancy.

The soybean gall midge (Resseliella maxima Gagné) was recently identified as a new species causing injury to soybean in the Midwestern United States. Although this insect was only recently identified, it has likely been present in soybean fields for at least the last 8 yr based on anecdotal reports. The soybean gall midge has historically been observed late in the season on soybean plants that were believed to have been previously compromised by a plant pathogen or mechanical damage with little to no concern for economic losses. In late June 2018, dead and dying plants were found to be associated with the soybean gall midge across four midwestern states. The distribution of plant injury in the field, larval feeding within the stem, and timing of infestation indicate that it is likely an important pest of soybean. Yield losses in soybean gall midge infested fields can be up to 100% for the first 30 meters from the field edge, with losses of 17–31% further into the field. The rapid development of the soybean gall midge as an important pest of soybean has left large gaps in the knowledge necessary to develop an integrated pest management program.

Stink bugs (Hemiptera: Pentatomidae) are agricultural pests of increasing significance in the North Central Region of the United States, posing a threat to major crops such as soybean. Biological control can reduce the need for insecticides to manage these pests, but the parasitism of stink bugs by Tachinidae (Diptera) is poorly characterized in this region. The objective of this study was to evaluate the rate of parasitism of stink bugs by tachinids over 2 yr from nine states across the North Central Region. Parasitism was assessed by quantifying tachinid eggs on the integument of stink bug adults. Parasitism rates (i.e., percent of adult stink bugs with tachinid eggs) were compared across stink bug species, states, stink bug sex, and years. The mean percent parasitism of stink bugs by tachinids was about 6% across the region and did not differ among stink bug species. Mean percent parasitism was significantly higher in Missouri than in northern and western states. In addition, male stink bugs had significantly higher mean percent parasitism than females. Stink bug species commonly found in soybean in the region showed some parasitism and are therefore potentially vulnerable to oviposition by these parasitoids. This is the first study to characterize the level of parasitism of stink bugs by tachinids across the North Central Region.

Advances in natural gas extraction technology have led to increased activity in the production and transport sectors in the United States and, as a consequence, an increased need for reliable monitoring of methane leaks to the atmosphere. We present a statistical methodology in combination with an observing system for the detection and attribution of fugitive emissions of methane from distributed potential source location landscapes such as natural gas production sites. We measure long (> 500 m), integrated open-path concentrations of atmospheric methane using a dual frequency comb spectrometer and combine measurements with an atmospheric transport model to infer leak locations and strengths using a novel statistical method, the non-zero minimum bootstrap (NZMB). The new statistical method allows us to determine whether the empirical distribution of possible source strengths for a given location excludes zero. Using this information, we identify leaking source locations (i.e., natural gas wells) through rejection of the null hypothesis that the source is not leaking. The method is tested with a series of synthetic data inversions with varying measurement density and varying levels of model–data mismatch. It is also tested with field observations of (1) a non-leaking source location and (2) a source location where a controlled emission of 3.1 × 10−5 kg s−1 of methane gas is released over a period of several hours. This series of synthetic data tests and outdoor field observations using a controlled methane release demonstrates the viability of the approach for the detection and sizing of very small leaks of methane across large distances (4+ km2 in synthetic tests). The field tests demonstrate the ability to attribute small atmospheric enhancements of 17 ppb to the emitting source location against a background of combined atmospheric (e.g., background methane variability) and measurement uncertainty of 5 ppb (1σ), when measurements are averaged over 2 min. The results of the synthetic and field data testing show that the new observing system and statistical approach greatly decreases the incidence of false alarms (that is, wrongly identifying a well site to be leaking) compared with the same tests that do not use the NZMB approach and therefore offers increased leak detection and sizing capabilities.

Evolved gas analysis (EGA) mass-spectrometry (MS) is used to characterize the solid state pyrolysis decomposition pathways of air- and moisture-sensitive organometallic compounds. In this study, the single-source GaAs compounds (Et2AsGaEt2)3 (1), (t-Bu2AsGaEt2)2 (2), and [t-Bu(H)AsGaEt2]2 (3) were heated in capillary tubes under inert condition and the volatile products were analyzed by MS. In addition, the relative ratios of evolved gases were characterized using gas chromatography (GC), while the solid state pyrolysis products were analyzed by EDS, 1H NMR and XRD. Pyrolysis of GaAs single-source materials in the solid state reveals chemical information on the stability of the Ga As bond, an observation masked in gas-phase analysis of single-source materials during chemical vapor deposition. Information on Ga As bond stability may be elucidated due to the volatility of the by-products formed during Ga-As precursor pyrolysis. Loss of Ga As bond integrity in materials with alkyl substitution on Ga and As leads to formation of mobile and volatile alkyl diarsine species, as was observed for the pyrolysis of 1. An in-situ method to monitor solid-state pyrolysis by mass spectrometry identified the loss of a tetraalkyl-diarsine as the critical factor that drives formation of sub-stoichiometric GaAs products from single-source precursors. Replacing a single alkyl group on the As atom with a H (precursor 3) leads to the loss of an alkane instead of tetraalkyl-diarsine formation. Solid-state pyrolysis precursor 3 results in the formation of polycrystalline GaAs in up to 58% yield with a 52:48 Ga:As stoichiometry.

We present the first quantitative intercomparison between two open-path dual-comb spectroscopy (DCS) instruments which were operated across adjacent 2 km open-air paths over a 2-week period. We used DCS to measure the atmospheric absorption spectrum in the near infrared from 6023 to 6376 cm−1 (1568 to 1660 nm), corresponding to a 355 cm−1 bandwidth, at 0.0067 cm−1 sample spacing. The measured absorption spectra agree with each other to within 5 × 10−4 in absorbance without any external calibration of either instrument. The absorption spectra are fit to retrieve path-integrated concentrations for carbon dioxide (CO2), methane (CH4), water (H2O), and deuterated water (HDO). The retrieved dry mole fractions agree to 0.14 % (0.57 ppm) for CO2, 0.35 % (7 ppb) for CH4, and 0.40 % (36 ppm) for H2O at ∼ 30 s integration time over the 2-week measurement campaign, which included 24 °C outdoor temperature variations and periods of strong atmospheric turbulence. This agreement is at least an order of magnitude better than conventional active-source open-path instrument intercomparisons and is particularly relevant to future regional flux measurements as it allows accurate comparisons of open-path DCS data across locations and time. We additionally compare the open-path DCS retrievals to a World Meteorological Organization (WMO)-calibrated cavity ring-down point sensor located along the path with good agreement. Short-term and long-term differences between the open-path DCS and point sensor are attributed, respectively, to spatial sampling discrepancies and to inaccuracies in the current spectral database used to fit the DCS data. Finally, the 2-week measurement campaign yields diurnal cycles of CO2 and CH4 that are consistent with the presence of local sources of CO2 and absence of local sources of CH4.

Resistance in western corn rootworm to transgenic corn hybrids was first confirmed in 2011 in Midwestern USA, and threatens their continued use. Farmers are often the first line of resistance detection, so their understanding and attitudes toward this issue are critical for improving resistance management. We conducted telephone focus groups during 2013 with farmers who had experienced rootworm resistance. There were four stages in dealing with unexpected rootworm injury: Awareness of a problem, diagnosis, confirmation, and recommendations. Most farmers discovered the problem themselves, but this usually happened too late in the growing season to limit yield loss. Once aware of a problem, farmers first sought help diagnosing the problem from their seed dealer, chemical rep, and/or crop consultant. They considered the problem to be a significant one, both because of its severity and suddenness, and were concerned about their difficulty in obtaining a correct diagnosis. They eventually used extension entomology specialists to confirm the diagnosis. Farmers gathered recommendations from independent consultants, input suppliers, and extension and indicated that they would aggressively deal with the problem, because they were not sure of what would work to protect their crop. They recommended that public extension put more emphasis on increasing awareness of the problem, assessing the extent of the problem and being an unbiased source of information. However, farmers were unlikely to report rootworm injury if the perceived barriers to reporting outweighed the perceived incentives. These barriers were emotional ones, including being unsure who to trust, fear that reporting will be time-consuming, and shame that they did something wrong. The incentive was access to credible advice. They did not automatically acknowledge the broader social benefits of reporting. Thus, extension probably needs to be explicit about these broader benefits to obtain information about the extent of the problem. With the conflicting demands and multiple information sources, it will be a challenge for extension to involve farmers to improve resistance monitoring and management. Key words: Resistance management, focus group, qualitative analysis, Diabrotica virgifera, genetically modified organism, transgenic crop, extension.

We demonstrate the first frequency comb laser absorption spectroscopy in an industrial environment. Recent advancements in robust frequency comb design enabled installation of the sensor in an operating power plant, where we simultaneously measured temperature, H 2 O and CO 2 concentration in the exhaust of a 16 MW stationary gas turbine. The frequency comb laser spectrometer probed 16,000 individual wavelengths of light spaced by 0.007 cm −1 (0.0014 nm) near 1440 nm, spanning 279 absorption features of H 2 O and 43 features of CO 2 . Fits to the measured absorption spectra yield simultaneous temperature, H 2 O and CO 2 concentrations with between 10 and 60 second time resolution. Measurements over a 5 hour period tracked variations in the exhaust consistent with various changes to the gas turbine operation. Much larger wavelength ranges (200+ nm) and different time resolutions are possible depending on the desired precision by changing various settings on the same spectrometer. Overall, this work demonstrates the potential for frequency comb laser absorption spectroscopy in industrial combustion environments.

A mild, regioselective, iridium-catalyzed C-H amidation and borylation of anthraquinones to the o-sulfonamide and m-borylated products has been developed. The anthraquinone carbonyl moieties direct the C-H amidation with high selectivity to afford the ortho-substituted products in modest to high yields.

During the past several years, canola (Brassica napus L.) has been grown experimentally in different areas of Texas to evaluate its potential as a crop, particularly for use as a biofuel source. In early April 2007, symptoms typical of Sclerotinia stem rot were observed in a canola variety trial that was flowering in Wharton County, Texas. Stems had white mycelia growing on the outside, or a bleached appearance, near the soil surface and plants were lodging. Inside bleached stems, there were spherical to cylindrical, black sclerotia that were 3 to 10 mm. Isolations from surface-disinfested stems onto potato dextrose agar (PDA) consistently yielded white, fluffy colonies with sclerotia typical of Sclerotinia sclerotiorum (Lib.) de Bary (1). Sequence analyses were conducted on two replicates of mycelium by extracting fungal DNA with the Qiagen DNeasy Plant Mini Kit (Valencia, CA). PCR amplification was performed using two primer sequences (92-4 AF377919: TCGCCTCAGAAGAATGTGC/AGCGGGTTACAAGGAGATGG; and 119-4 AF377925: GTAACAAGAGACCAAAATTCGG/TGAACGAGCTGTCATTCCC) (2) that have previously been used to characterize S. sclerotiorum (3). The BLAST search revealed that the sequences were 99 and 98% homologous with S. sclerotiorum Accession Nos. AF377919 and AF377925 over 376 and 377 bp of aligned sequence, respectively. Agar segments (1 cm2) from a 5-day-old culture grown on PDA were placed in the leaf axils of 15 2-month-old canola plants (‘Wichita’) growing in pots. Plants were placed in a humid chamber under fluorescent lights at 16 to 22°C. After 2 days, water soaking and necrosis occurred on petioles and stems adjacent to the inoculum, but not on plants treated with sterile PDA. S. sclerotiorum was consistently reisolated from symptomatic tissue plated on acidified PDA. The inoculations were repeated once with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of canola in Texas. Currently, there is no significant canola production in Texas; however, interest in biofuels could lead to an increase in planted acres. Sclerotinia stem rot of canola could become a significant disease problem in areas of Texas where canola is planted as a winter crop. References: (1) L. M. Kohn. Phytopathology 69:881, 1979. (2) C. Sirjusingh and L. M. Kohn. Mol. Ecol. Notes 1:267, 2001. (3) J. E. Woodward et al. Plant Dis. 92:1468, 2008.

Soybean aphid, Aphis glycines Matsumura, remains the key insect pest of soybean, Glycine max (L.) Merrill, in the north-central United States. Management of this pest has relied primarily on scouting and application of foliar insecticides based on an economic threshold (ET) of 250 aphids per plant. This review explains why this ET remains valid for soybean aphid management, despite changes in crop value and input costs. In particular, we review how soybean aphid impacts soybean yield, the role of biology and economics in recommendations for soybean aphid management, and the short- and long-term consequences of inappropriately timed insecticide applications. Accepted for publication 13 December 2016.

Stink bugs (Hemiptera: Pentatomidae) are an increasing threat to soybean (Fabales: Fabaceae) production in the North Central Region of the United States, which accounts for 80% of the country’s total soybean production. Characterization of the stink bug community is essential for development of management programs for these pests. However, the composition of the stink bug community in the region is not well defined. This study aimed to address this gap with a 2-yr, 9-state survey. Specifically, we characterized the relative abundance, richness, and diversity of taxa in this community, and assessed phenological differences in abundance of herbivorous and predatory stink bugs. Overall, the stink bug community was dominated by Euschistus spp. (Hemiptera: Pentatomidae) and Chinavia hilaris (Say) (Hemiptera: Pentatomidae). Euschistus variolarius (Palisot de Beauvois) (Hemiptera: Pentatomidae), C. hilaris and Halyomorpha halys (Stål) (Hemiptera: Pentatomidae) were more abundant in the northwestern, southeastern and eastern parts, respectively, of the North Central Region of the United States. Economically significant infestations of herbivorous species occurred in fields in southern parts of the region. Species richness differed across states, while diversity was the same across the region. Herbivorous and predatory species were more abundant during later soybean growth stages. Our results represent the first regional characterization of the stink bug community in soybean fields and will be fundamental for the development of state- and region-specific management programs for these pests in the North Central Region of the United States.

Manganese is a naturally occurring metal that is a both an essential nutrient at lower levels and a neurotoxicant at higher levels. Recent studies suggest that higher prenatal manganese exposure re...

Background/Aim: Global increases in sedentary behavior are a major public health concern requiring research into its causes. We investigate environmental factors such as temperature and green space...

Background: Lead (Pb), manganese (Mn), and methylmercury are known neurotoxic metals and often co-exist in the environment. Less is known about their interactive and joint effects on specific child...

Introduction: Neurodevelopment delay is an important public health problem, affecting up to 15% of children. We aim to identify environmental risk factors that predict delayed trajectories of neuro...

Background: Environmental exposure to metals has been associated with decreased bone density and higher risk of fracture mainly among premenopausal women and older adults. Metals such as lead (Pb) ...

Background. Due to well established relevance of season on air pollution assessment, we estimated prenatal PM2.5 (particulate matter < 2.5 microns) exposure by season of the year at different ge...

In Mexico City’s Metropolitan Area (MCMA), home to over twenty million persons, air quality usually surpasses the standards for PM 2.5, and obesity is highly prevalent. Recent studies suggest...

BACKGROUND: Air pollution is a key global public health challenge. The Mexico City Metropolitan Area (MCMA), a megalopolis of 23 million people, exceeds the WHO’s recommendation for the annua...

Introduction: The industrial transition of the past decades has increased the burden of toxic pollution in many low-income countries. Children growing up in these countries now face potentially hig...

Introduction: There is a growing body of literature that supports an association between prenatal air pollution exposure and increased risk of childhood obesity. However, relationships between pren...